ID: 1160995371

View in Genome Browser
Species Human (GRCh38)
Location 19:1879852-1879874
Sequence GGACCAGGCGGGGGGCCGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4453
Summary {0: 2, 1: 3, 2: 8, 3: 172, 4: 4268}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160995371_1160995390 13 Left 1160995371 19:1879852-1879874 CCCCCCGGCCCCCCGCCTGGTCC 0: 2
1: 3
2: 8
3: 172
4: 4268
Right 1160995390 19:1879888-1879910 CCCAGGCTGAGCTGCCCCCAGGG 0: 6
1: 1
2: 9
3: 60
4: 426
1160995371_1160995388 12 Left 1160995371 19:1879852-1879874 CCCCCCGGCCCCCCGCCTGGTCC 0: 2
1: 3
2: 8
3: 172
4: 4268
Right 1160995388 19:1879887-1879909 GCCCAGGCTGAGCTGCCCCCAGG 0: 7
1: 5
2: 11
3: 70
4: 491
1160995371_1160995384 -4 Left 1160995371 19:1879852-1879874 CCCCCCGGCCCCCCGCCTGGTCC 0: 2
1: 3
2: 8
3: 172
4: 4268
Right 1160995384 19:1879871-1879893 GTCCCCTCTTGGGTGTGCCCAGG 0: 6
1: 4
2: 2
3: 13
4: 151
1160995371_1160995393 27 Left 1160995371 19:1879852-1879874 CCCCCCGGCCCCCCGCCTGGTCC 0: 2
1: 3
2: 8
3: 172
4: 4268
Right 1160995393 19:1879902-1879924 CCCCCAGGGTCGCCCTCACCTGG 0: 5
1: 3
2: 6
3: 24
4: 238

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160995371 Original CRISPR GGACCAGGCGGGGGGCCGGG GGG (reversed) Intronic