ID: 1160995373

View in Genome Browser
Species Human (GRCh38)
Location 19:1879854-1879876
Sequence GGGGACCAGGCGGGGGGCCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 907
Summary {0: 2, 1: 3, 2: 10, 3: 64, 4: 828}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160995373_1160995393 25 Left 1160995373 19:1879854-1879876 CCCCGGCCCCCCGCCTGGTCCCC 0: 2
1: 3
2: 10
3: 64
4: 828
Right 1160995393 19:1879902-1879924 CCCCCAGGGTCGCCCTCACCTGG 0: 5
1: 3
2: 6
3: 24
4: 238
1160995373_1160995388 10 Left 1160995373 19:1879854-1879876 CCCCGGCCCCCCGCCTGGTCCCC 0: 2
1: 3
2: 10
3: 64
4: 828
Right 1160995388 19:1879887-1879909 GCCCAGGCTGAGCTGCCCCCAGG 0: 7
1: 5
2: 11
3: 70
4: 491
1160995373_1160995384 -6 Left 1160995373 19:1879854-1879876 CCCCGGCCCCCCGCCTGGTCCCC 0: 2
1: 3
2: 10
3: 64
4: 828
Right 1160995384 19:1879871-1879893 GTCCCCTCTTGGGTGTGCCCAGG 0: 6
1: 4
2: 2
3: 13
4: 151
1160995373_1160995390 11 Left 1160995373 19:1879854-1879876 CCCCGGCCCCCCGCCTGGTCCCC 0: 2
1: 3
2: 10
3: 64
4: 828
Right 1160995390 19:1879888-1879910 CCCAGGCTGAGCTGCCCCCAGGG 0: 6
1: 1
2: 9
3: 60
4: 426

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160995373 Original CRISPR GGGGACCAGGCGGGGGGCCG GGG (reversed) Intronic