ID: 1160995378

View in Genome Browser
Species Human (GRCh38)
Location 19:1879861-1879883
Sequence CCCAAGAGGGGACCAGGCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 2, 1: 2, 2: 8, 3: 15, 4: 191}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160995378_1160995390 4 Left 1160995378 19:1879861-1879883 CCCCCGCCTGGTCCCCTCTTGGG 0: 2
1: 2
2: 8
3: 15
4: 191
Right 1160995390 19:1879888-1879910 CCCAGGCTGAGCTGCCCCCAGGG 0: 6
1: 1
2: 9
3: 60
4: 426
1160995378_1160995393 18 Left 1160995378 19:1879861-1879883 CCCCCGCCTGGTCCCCTCTTGGG 0: 2
1: 2
2: 8
3: 15
4: 191
Right 1160995393 19:1879902-1879924 CCCCCAGGGTCGCCCTCACCTGG 0: 5
1: 3
2: 6
3: 24
4: 238
1160995378_1160995388 3 Left 1160995378 19:1879861-1879883 CCCCCGCCTGGTCCCCTCTTGGG 0: 2
1: 2
2: 8
3: 15
4: 191
Right 1160995388 19:1879887-1879909 GCCCAGGCTGAGCTGCCCCCAGG 0: 7
1: 5
2: 11
3: 70
4: 491
1160995378_1160995398 27 Left 1160995378 19:1879861-1879883 CCCCCGCCTGGTCCCCTCTTGGG 0: 2
1: 2
2: 8
3: 15
4: 191
Right 1160995398 19:1879911-1879933 TCGCCCTCACCTGGTGCGCAGGG 0: 10
1: 1
2: 0
3: 6
4: 90
1160995378_1160995397 26 Left 1160995378 19:1879861-1879883 CCCCCGCCTGGTCCCCTCTTGGG 0: 2
1: 2
2: 8
3: 15
4: 191
Right 1160995397 19:1879910-1879932 GTCGCCCTCACCTGGTGCGCAGG 0: 10
1: 1
2: 0
3: 5
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160995378 Original CRISPR CCCAAGAGGGGACCAGGCGG GGG (reversed) Intronic