ID: 1160995381

View in Genome Browser
Species Human (GRCh38)
Location 19:1879863-1879885
Sequence CACCCAAGAGGGGACCAGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 4, 1: 6, 2: 2, 3: 16, 4: 254}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160995381_1160995398 25 Left 1160995381 19:1879863-1879885 CCCGCCTGGTCCCCTCTTGGGTG 0: 4
1: 6
2: 2
3: 16
4: 254
Right 1160995398 19:1879911-1879933 TCGCCCTCACCTGGTGCGCAGGG 0: 10
1: 1
2: 0
3: 6
4: 90
1160995381_1160995388 1 Left 1160995381 19:1879863-1879885 CCCGCCTGGTCCCCTCTTGGGTG 0: 4
1: 6
2: 2
3: 16
4: 254
Right 1160995388 19:1879887-1879909 GCCCAGGCTGAGCTGCCCCCAGG 0: 7
1: 5
2: 11
3: 70
4: 491
1160995381_1160995390 2 Left 1160995381 19:1879863-1879885 CCCGCCTGGTCCCCTCTTGGGTG 0: 4
1: 6
2: 2
3: 16
4: 254
Right 1160995390 19:1879888-1879910 CCCAGGCTGAGCTGCCCCCAGGG 0: 6
1: 1
2: 9
3: 60
4: 426
1160995381_1160995393 16 Left 1160995381 19:1879863-1879885 CCCGCCTGGTCCCCTCTTGGGTG 0: 4
1: 6
2: 2
3: 16
4: 254
Right 1160995393 19:1879902-1879924 CCCCCAGGGTCGCCCTCACCTGG 0: 5
1: 3
2: 6
3: 24
4: 238
1160995381_1160995397 24 Left 1160995381 19:1879863-1879885 CCCGCCTGGTCCCCTCTTGGGTG 0: 4
1: 6
2: 2
3: 16
4: 254
Right 1160995397 19:1879910-1879932 GTCGCCCTCACCTGGTGCGCAGG 0: 10
1: 1
2: 0
3: 5
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160995381 Original CRISPR CACCCAAGAGGGGACCAGGC GGG (reversed) Intronic