ID: 1160995383

View in Genome Browser
Species Human (GRCh38)
Location 19:1879867-1879889
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 4, 1: 4, 2: 2, 3: 13, 4: 152}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160995383_1160995390 -2 Left 1160995383 19:1879867-1879889 CCTGGTCCCCTCTTGGGTGTGCC 0: 4
1: 4
2: 2
3: 13
4: 152
Right 1160995390 19:1879888-1879910 CCCAGGCTGAGCTGCCCCCAGGG 0: 6
1: 1
2: 9
3: 60
4: 426
1160995383_1160995388 -3 Left 1160995383 19:1879867-1879889 CCTGGTCCCCTCTTGGGTGTGCC 0: 4
1: 4
2: 2
3: 13
4: 152
Right 1160995388 19:1879887-1879909 GCCCAGGCTGAGCTGCCCCCAGG 0: 7
1: 5
2: 11
3: 70
4: 491
1160995383_1160995397 20 Left 1160995383 19:1879867-1879889 CCTGGTCCCCTCTTGGGTGTGCC 0: 4
1: 4
2: 2
3: 13
4: 152
Right 1160995397 19:1879910-1879932 GTCGCCCTCACCTGGTGCGCAGG 0: 10
1: 1
2: 0
3: 5
4: 62
1160995383_1160995393 12 Left 1160995383 19:1879867-1879889 CCTGGTCCCCTCTTGGGTGTGCC 0: 4
1: 4
2: 2
3: 13
4: 152
Right 1160995393 19:1879902-1879924 CCCCCAGGGTCGCCCTCACCTGG 0: 5
1: 3
2: 6
3: 24
4: 238
1160995383_1160995402 30 Left 1160995383 19:1879867-1879889 CCTGGTCCCCTCTTGGGTGTGCC 0: 4
1: 4
2: 2
3: 13
4: 152
Right 1160995402 19:1879920-1879942 CCTGGTGCGCAGGGCCTGCCAGG 0: 11
1: 0
2: 2
3: 39
4: 362
1160995383_1160995398 21 Left 1160995383 19:1879867-1879889 CCTGGTCCCCTCTTGGGTGTGCC 0: 4
1: 4
2: 2
3: 13
4: 152
Right 1160995398 19:1879911-1879933 TCGCCCTCACCTGGTGCGCAGGG 0: 10
1: 1
2: 0
3: 6
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160995383 Original CRISPR GGCACACCCAAGAGGGGACC AGG (reversed) Intronic