ID: 1160995386

View in Genome Browser
Species Human (GRCh38)
Location 19:1879874-1879896
Sequence CAGCCTGGGCACACCCAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 323
Summary {0: 6, 1: 4, 2: 3, 3: 31, 4: 279}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160995386_1160995393 5 Left 1160995386 19:1879874-1879896 CCCTCTTGGGTGTGCCCAGGCTG 0: 6
1: 4
2: 3
3: 31
4: 279
Right 1160995393 19:1879902-1879924 CCCCCAGGGTCGCCCTCACCTGG 0: 5
1: 3
2: 6
3: 24
4: 238
1160995386_1160995403 26 Left 1160995386 19:1879874-1879896 CCCTCTTGGGTGTGCCCAGGCTG 0: 6
1: 4
2: 3
3: 31
4: 279
Right 1160995403 19:1879923-1879945 GGTGCGCAGGGCCTGCCAGGCGG 0: 10
1: 2
2: 3
3: 33
4: 324
1160995386_1160995390 -9 Left 1160995386 19:1879874-1879896 CCCTCTTGGGTGTGCCCAGGCTG 0: 6
1: 4
2: 3
3: 31
4: 279
Right 1160995390 19:1879888-1879910 CCCAGGCTGAGCTGCCCCCAGGG 0: 6
1: 1
2: 9
3: 60
4: 426
1160995386_1160995402 23 Left 1160995386 19:1879874-1879896 CCCTCTTGGGTGTGCCCAGGCTG 0: 6
1: 4
2: 3
3: 31
4: 279
Right 1160995402 19:1879920-1879942 CCTGGTGCGCAGGGCCTGCCAGG 0: 11
1: 0
2: 2
3: 39
4: 362
1160995386_1160995397 13 Left 1160995386 19:1879874-1879896 CCCTCTTGGGTGTGCCCAGGCTG 0: 6
1: 4
2: 3
3: 31
4: 279
Right 1160995397 19:1879910-1879932 GTCGCCCTCACCTGGTGCGCAGG 0: 10
1: 1
2: 0
3: 5
4: 62
1160995386_1160995398 14 Left 1160995386 19:1879874-1879896 CCCTCTTGGGTGTGCCCAGGCTG 0: 6
1: 4
2: 3
3: 31
4: 279
Right 1160995398 19:1879911-1879933 TCGCCCTCACCTGGTGCGCAGGG 0: 10
1: 1
2: 0
3: 6
4: 90
1160995386_1160995388 -10 Left 1160995386 19:1879874-1879896 CCCTCTTGGGTGTGCCCAGGCTG 0: 6
1: 4
2: 3
3: 31
4: 279
Right 1160995388 19:1879887-1879909 GCCCAGGCTGAGCTGCCCCCAGG 0: 7
1: 5
2: 11
3: 70
4: 491

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160995386 Original CRISPR CAGCCTGGGCACACCCAAGA GGG (reversed) Intronic