ID: 1160995387

View in Genome Browser
Species Human (GRCh38)
Location 19:1879875-1879897
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 6, 1: 4, 2: 2, 3: 10, 4: 198}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160995387_1160995390 -10 Left 1160995387 19:1879875-1879897 CCTCTTGGGTGTGCCCAGGCTGA 0: 6
1: 4
2: 2
3: 10
4: 198
Right 1160995390 19:1879888-1879910 CCCAGGCTGAGCTGCCCCCAGGG 0: 6
1: 1
2: 9
3: 60
4: 426
1160995387_1160995393 4 Left 1160995387 19:1879875-1879897 CCTCTTGGGTGTGCCCAGGCTGA 0: 6
1: 4
2: 2
3: 10
4: 198
Right 1160995393 19:1879902-1879924 CCCCCAGGGTCGCCCTCACCTGG 0: 5
1: 3
2: 6
3: 24
4: 238
1160995387_1160995397 12 Left 1160995387 19:1879875-1879897 CCTCTTGGGTGTGCCCAGGCTGA 0: 6
1: 4
2: 2
3: 10
4: 198
Right 1160995397 19:1879910-1879932 GTCGCCCTCACCTGGTGCGCAGG 0: 10
1: 1
2: 0
3: 5
4: 62
1160995387_1160995402 22 Left 1160995387 19:1879875-1879897 CCTCTTGGGTGTGCCCAGGCTGA 0: 6
1: 4
2: 2
3: 10
4: 198
Right 1160995402 19:1879920-1879942 CCTGGTGCGCAGGGCCTGCCAGG 0: 11
1: 0
2: 2
3: 39
4: 362
1160995387_1160995398 13 Left 1160995387 19:1879875-1879897 CCTCTTGGGTGTGCCCAGGCTGA 0: 6
1: 4
2: 2
3: 10
4: 198
Right 1160995398 19:1879911-1879933 TCGCCCTCACCTGGTGCGCAGGG 0: 10
1: 1
2: 0
3: 6
4: 90
1160995387_1160995403 25 Left 1160995387 19:1879875-1879897 CCTCTTGGGTGTGCCCAGGCTGA 0: 6
1: 4
2: 2
3: 10
4: 198
Right 1160995403 19:1879923-1879945 GGTGCGCAGGGCCTGCCAGGCGG 0: 10
1: 2
2: 3
3: 33
4: 324

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160995387 Original CRISPR TCAGCCTGGGCACACCCAAG AGG (reversed) Intronic