ID: 1160995388

View in Genome Browser
Species Human (GRCh38)
Location 19:1879887-1879909
Sequence GCCCAGGCTGAGCTGCCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 584
Summary {0: 7, 1: 5, 2: 11, 3: 70, 4: 491}

Found 18 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160995382_1160995388 0 Left 1160995382 19:1879864-1879886 CCGCCTGGTCCCCTCTTGGGTGT 0: 2
1: 0
2: 1
3: 17
4: 204
Right 1160995388 19:1879887-1879909 GCCCAGGCTGAGCTGCCCCCAGG 0: 7
1: 5
2: 11
3: 70
4: 491
1160995380_1160995388 2 Left 1160995380 19:1879862-1879884 CCCCGCCTGGTCCCCTCTTGGGT 0: 2
1: 2
2: 9
3: 20
4: 204
Right 1160995388 19:1879887-1879909 GCCCAGGCTGAGCTGCCCCCAGG 0: 7
1: 5
2: 11
3: 70
4: 491
1160995386_1160995388 -10 Left 1160995386 19:1879874-1879896 CCCTCTTGGGTGTGCCCAGGCTG 0: 6
1: 4
2: 3
3: 31
4: 279
Right 1160995388 19:1879887-1879909 GCCCAGGCTGAGCTGCCCCCAGG 0: 7
1: 5
2: 11
3: 70
4: 491
1160995374_1160995388 9 Left 1160995374 19:1879855-1879877 CCCGGCCCCCCGCCTGGTCCCCT 0: 2
1: 7
2: 4
3: 61
4: 632
Right 1160995388 19:1879887-1879909 GCCCAGGCTGAGCTGCCCCCAGG 0: 7
1: 5
2: 11
3: 70
4: 491
1160995368_1160995388 16 Left 1160995368 19:1879848-1879870 CCCGCCCCCCGGCCCCCCGCCTG 0: 2
1: 2
2: 16
3: 205
4: 1659
Right 1160995388 19:1879887-1879909 GCCCAGGCTGAGCTGCCCCCAGG 0: 7
1: 5
2: 11
3: 70
4: 491
1160995381_1160995388 1 Left 1160995381 19:1879863-1879885 CCCGCCTGGTCCCCTCTTGGGTG 0: 4
1: 6
2: 2
3: 16
4: 254
Right 1160995388 19:1879887-1879909 GCCCAGGCTGAGCTGCCCCCAGG 0: 7
1: 5
2: 11
3: 70
4: 491
1160995383_1160995388 -3 Left 1160995383 19:1879867-1879889 CCTGGTCCCCTCTTGGGTGTGCC 0: 4
1: 4
2: 2
3: 13
4: 152
Right 1160995388 19:1879887-1879909 GCCCAGGCTGAGCTGCCCCCAGG 0: 7
1: 5
2: 11
3: 70
4: 491
1160995372_1160995388 11 Left 1160995372 19:1879853-1879875 CCCCCGGCCCCCCGCCTGGTCCC 0: 2
1: 3
2: 13
3: 64
4: 736
Right 1160995388 19:1879887-1879909 GCCCAGGCTGAGCTGCCCCCAGG 0: 7
1: 5
2: 11
3: 70
4: 491
1160995378_1160995388 3 Left 1160995378 19:1879861-1879883 CCCCCGCCTGGTCCCCTCTTGGG 0: 2
1: 2
2: 8
3: 15
4: 191
Right 1160995388 19:1879887-1879909 GCCCAGGCTGAGCTGCCCCCAGG 0: 7
1: 5
2: 11
3: 70
4: 491
1160995366_1160995388 26 Left 1160995366 19:1879838-1879860 CCCAGGGAAGCCCGCCCCCCGGC 0: 6
1: 0
2: 1
3: 14
4: 195
Right 1160995388 19:1879887-1879909 GCCCAGGCTGAGCTGCCCCCAGG 0: 7
1: 5
2: 11
3: 70
4: 491
1160995371_1160995388 12 Left 1160995371 19:1879852-1879874 CCCCCCGGCCCCCCGCCTGGTCC 0: 2
1: 3
2: 8
3: 172
4: 4268
Right 1160995388 19:1879887-1879909 GCCCAGGCTGAGCTGCCCCCAGG 0: 7
1: 5
2: 11
3: 70
4: 491
1160995376_1160995388 4 Left 1160995376 19:1879860-1879882 CCCCCCGCCTGGTCCCCTCTTGG 0: 2
1: 2
2: 6
3: 25
4: 252
Right 1160995388 19:1879887-1879909 GCCCAGGCTGAGCTGCCCCCAGG 0: 7
1: 5
2: 11
3: 70
4: 491
1160995375_1160995388 8 Left 1160995375 19:1879856-1879878 CCGGCCCCCCGCCTGGTCCCCTC 0: 2
1: 4
2: 9
3: 90
4: 864
Right 1160995388 19:1879887-1879909 GCCCAGGCTGAGCTGCCCCCAGG 0: 7
1: 5
2: 11
3: 70
4: 491
1160995367_1160995388 25 Left 1160995367 19:1879839-1879861 CCAGGGAAGCCCGCCCCCCGGCC 0: 6
1: 1
2: 1
3: 38
4: 378
Right 1160995388 19:1879887-1879909 GCCCAGGCTGAGCTGCCCCCAGG 0: 7
1: 5
2: 11
3: 70
4: 491
1160995373_1160995388 10 Left 1160995373 19:1879854-1879876 CCCCGGCCCCCCGCCTGGTCCCC 0: 2
1: 3
2: 10
3: 64
4: 828
Right 1160995388 19:1879887-1879909 GCCCAGGCTGAGCTGCCCCCAGG 0: 7
1: 5
2: 11
3: 70
4: 491
1160995369_1160995388 15 Left 1160995369 19:1879849-1879871 CCGCCCCCCGGCCCCCCGCCTGG 0: 2
1: 2
2: 13
3: 196
4: 1919
Right 1160995388 19:1879887-1879909 GCCCAGGCTGAGCTGCCCCCAGG 0: 7
1: 5
2: 11
3: 70
4: 491
1160995385_1160995388 -9 Left 1160995385 19:1879873-1879895 CCCCTCTTGGGTGTGCCCAGGCT 0: 6
1: 4
2: 1
3: 14
4: 243
Right 1160995388 19:1879887-1879909 GCCCAGGCTGAGCTGCCCCCAGG 0: 7
1: 5
2: 11
3: 70
4: 491
1160995364_1160995388 29 Left 1160995364 19:1879835-1879857 CCTCCCAGGGAAGCCCGCCCCCC 0: 6
1: 4
2: 4
3: 45
4: 344
Right 1160995388 19:1879887-1879909 GCCCAGGCTGAGCTGCCCCCAGG 0: 7
1: 5
2: 11
3: 70
4: 491

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160995388 Original CRISPR GCCCAGGCTGAGCTGCCCCC AGG Intronic