ID: 1160995391

View in Genome Browser
Species Human (GRCh38)
Location 19:1879889-1879911
Sequence ACCCTGGGGGCAGCTCAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 417
Summary {0: 6, 1: 1, 2: 6, 3: 37, 4: 367}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160995391_1160995402 8 Left 1160995391 19:1879889-1879911 CCAGGCTGAGCTGCCCCCAGGGT 0: 6
1: 1
2: 6
3: 37
4: 367
Right 1160995402 19:1879920-1879942 CCTGGTGCGCAGGGCCTGCCAGG 0: 11
1: 0
2: 2
3: 39
4: 362
1160995391_1160995398 -1 Left 1160995391 19:1879889-1879911 CCAGGCTGAGCTGCCCCCAGGGT 0: 6
1: 1
2: 6
3: 37
4: 367
Right 1160995398 19:1879911-1879933 TCGCCCTCACCTGGTGCGCAGGG 0: 10
1: 1
2: 0
3: 6
4: 90
1160995391_1160995405 23 Left 1160995391 19:1879889-1879911 CCAGGCTGAGCTGCCCCCAGGGT 0: 6
1: 1
2: 6
3: 37
4: 367
Right 1160995405 19:1879935-1879957 CTGCCAGGCGGCGTCGATGTCGG 0: 5
1: 7
2: 0
3: 3
4: 61
1160995391_1160995403 11 Left 1160995391 19:1879889-1879911 CCAGGCTGAGCTGCCCCCAGGGT 0: 6
1: 1
2: 6
3: 37
4: 367
Right 1160995403 19:1879923-1879945 GGTGCGCAGGGCCTGCCAGGCGG 0: 10
1: 2
2: 3
3: 33
4: 324
1160995391_1160995393 -10 Left 1160995391 19:1879889-1879911 CCAGGCTGAGCTGCCCCCAGGGT 0: 6
1: 1
2: 6
3: 37
4: 367
Right 1160995393 19:1879902-1879924 CCCCCAGGGTCGCCCTCACCTGG 0: 5
1: 3
2: 6
3: 24
4: 238
1160995391_1160995397 -2 Left 1160995391 19:1879889-1879911 CCAGGCTGAGCTGCCCCCAGGGT 0: 6
1: 1
2: 6
3: 37
4: 367
Right 1160995397 19:1879910-1879932 GTCGCCCTCACCTGGTGCGCAGG 0: 10
1: 1
2: 0
3: 5
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160995391 Original CRISPR ACCCTGGGGGCAGCTCAGCC TGG (reversed) Intronic