ID: 1160995393

View in Genome Browser
Species Human (GRCh38)
Location 19:1879902-1879924
Sequence CCCCCAGGGTCGCCCTCACC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 5, 1: 3, 2: 6, 3: 24, 4: 238}

Found 17 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160995380_1160995393 17 Left 1160995380 19:1879862-1879884 CCCCGCCTGGTCCCCTCTTGGGT 0: 2
1: 2
2: 9
3: 20
4: 204
Right 1160995393 19:1879902-1879924 CCCCCAGGGTCGCCCTCACCTGG 0: 5
1: 3
2: 6
3: 24
4: 238
1160995381_1160995393 16 Left 1160995381 19:1879863-1879885 CCCGCCTGGTCCCCTCTTGGGTG 0: 4
1: 6
2: 2
3: 16
4: 254
Right 1160995393 19:1879902-1879924 CCCCCAGGGTCGCCCTCACCTGG 0: 5
1: 3
2: 6
3: 24
4: 238
1160995369_1160995393 30 Left 1160995369 19:1879849-1879871 CCGCCCCCCGGCCCCCCGCCTGG 0: 2
1: 2
2: 13
3: 196
4: 1919
Right 1160995393 19:1879902-1879924 CCCCCAGGGTCGCCCTCACCTGG 0: 5
1: 3
2: 6
3: 24
4: 238
1160995385_1160995393 6 Left 1160995385 19:1879873-1879895 CCCCTCTTGGGTGTGCCCAGGCT 0: 6
1: 4
2: 1
3: 14
4: 243
Right 1160995393 19:1879902-1879924 CCCCCAGGGTCGCCCTCACCTGG 0: 5
1: 3
2: 6
3: 24
4: 238
1160995389_1160995393 -9 Left 1160995389 19:1879888-1879910 CCCAGGCTGAGCTGCCCCCAGGG 0: 6
1: 1
2: 13
3: 65
4: 467
Right 1160995393 19:1879902-1879924 CCCCCAGGGTCGCCCTCACCTGG 0: 5
1: 3
2: 6
3: 24
4: 238
1160995373_1160995393 25 Left 1160995373 19:1879854-1879876 CCCCGGCCCCCCGCCTGGTCCCC 0: 2
1: 3
2: 10
3: 64
4: 828
Right 1160995393 19:1879902-1879924 CCCCCAGGGTCGCCCTCACCTGG 0: 5
1: 3
2: 6
3: 24
4: 238
1160995383_1160995393 12 Left 1160995383 19:1879867-1879889 CCTGGTCCCCTCTTGGGTGTGCC 0: 4
1: 4
2: 2
3: 13
4: 152
Right 1160995393 19:1879902-1879924 CCCCCAGGGTCGCCCTCACCTGG 0: 5
1: 3
2: 6
3: 24
4: 238
1160995376_1160995393 19 Left 1160995376 19:1879860-1879882 CCCCCCGCCTGGTCCCCTCTTGG 0: 2
1: 2
2: 6
3: 25
4: 252
Right 1160995393 19:1879902-1879924 CCCCCAGGGTCGCCCTCACCTGG 0: 5
1: 3
2: 6
3: 24
4: 238
1160995372_1160995393 26 Left 1160995372 19:1879853-1879875 CCCCCGGCCCCCCGCCTGGTCCC 0: 2
1: 3
2: 13
3: 64
4: 736
Right 1160995393 19:1879902-1879924 CCCCCAGGGTCGCCCTCACCTGG 0: 5
1: 3
2: 6
3: 24
4: 238
1160995375_1160995393 23 Left 1160995375 19:1879856-1879878 CCGGCCCCCCGCCTGGTCCCCTC 0: 2
1: 4
2: 9
3: 90
4: 864
Right 1160995393 19:1879902-1879924 CCCCCAGGGTCGCCCTCACCTGG 0: 5
1: 3
2: 6
3: 24
4: 238
1160995371_1160995393 27 Left 1160995371 19:1879852-1879874 CCCCCCGGCCCCCCGCCTGGTCC 0: 2
1: 3
2: 8
3: 172
4: 4268
Right 1160995393 19:1879902-1879924 CCCCCAGGGTCGCCCTCACCTGG 0: 5
1: 3
2: 6
3: 24
4: 238
1160995382_1160995393 15 Left 1160995382 19:1879864-1879886 CCGCCTGGTCCCCTCTTGGGTGT 0: 2
1: 0
2: 1
3: 17
4: 204
Right 1160995393 19:1879902-1879924 CCCCCAGGGTCGCCCTCACCTGG 0: 5
1: 3
2: 6
3: 24
4: 238
1160995386_1160995393 5 Left 1160995386 19:1879874-1879896 CCCTCTTGGGTGTGCCCAGGCTG 0: 6
1: 4
2: 3
3: 31
4: 279
Right 1160995393 19:1879902-1879924 CCCCCAGGGTCGCCCTCACCTGG 0: 5
1: 3
2: 6
3: 24
4: 238
1160995374_1160995393 24 Left 1160995374 19:1879855-1879877 CCCGGCCCCCCGCCTGGTCCCCT 0: 2
1: 7
2: 4
3: 61
4: 632
Right 1160995393 19:1879902-1879924 CCCCCAGGGTCGCCCTCACCTGG 0: 5
1: 3
2: 6
3: 24
4: 238
1160995387_1160995393 4 Left 1160995387 19:1879875-1879897 CCTCTTGGGTGTGCCCAGGCTGA 0: 6
1: 4
2: 2
3: 10
4: 198
Right 1160995393 19:1879902-1879924 CCCCCAGGGTCGCCCTCACCTGG 0: 5
1: 3
2: 6
3: 24
4: 238
1160995378_1160995393 18 Left 1160995378 19:1879861-1879883 CCCCCGCCTGGTCCCCTCTTGGG 0: 2
1: 2
2: 8
3: 15
4: 191
Right 1160995393 19:1879902-1879924 CCCCCAGGGTCGCCCTCACCTGG 0: 5
1: 3
2: 6
3: 24
4: 238
1160995391_1160995393 -10 Left 1160995391 19:1879889-1879911 CCAGGCTGAGCTGCCCCCAGGGT 0: 6
1: 1
2: 6
3: 37
4: 367
Right 1160995393 19:1879902-1879924 CCCCCAGGGTCGCCCTCACCTGG 0: 5
1: 3
2: 6
3: 24
4: 238

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160995393 Original CRISPR CCCCCAGGGTCGCCCTCACC TGG Exonic