ID: 1160995394

View in Genome Browser
Species Human (GRCh38)
Location 19:1879903-1879925
Sequence ACCAGGTGAGGGCGACCCTG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 5, 1: 2, 2: 2, 3: 22, 4: 159}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160995394_1160995405 9 Left 1160995394 19:1879903-1879925 CCCCAGGGTCGCCCTCACCTGGT 0: 5
1: 2
2: 2
3: 22
4: 159
Right 1160995405 19:1879935-1879957 CTGCCAGGCGGCGTCGATGTCGG 0: 5
1: 7
2: 0
3: 3
4: 61
1160995394_1160995407 17 Left 1160995394 19:1879903-1879925 CCCCAGGGTCGCCCTCACCTGGT 0: 5
1: 2
2: 2
3: 22
4: 159
Right 1160995407 19:1879943-1879965 CGGCGTCGATGTCGGCATAGAGG 0: 5
1: 3
2: 4
3: 1
4: 8
1160995394_1160995403 -3 Left 1160995394 19:1879903-1879925 CCCCAGGGTCGCCCTCACCTGGT 0: 5
1: 2
2: 2
3: 22
4: 159
Right 1160995403 19:1879923-1879945 GGTGCGCAGGGCCTGCCAGGCGG 0: 10
1: 2
2: 3
3: 33
4: 324
1160995394_1160995408 27 Left 1160995394 19:1879903-1879925 CCCCAGGGTCGCCCTCACCTGGT 0: 5
1: 2
2: 2
3: 22
4: 159
Right 1160995408 19:1879953-1879975 GTCGGCATAGAGGTTCCTCTCGG 0: 5
1: 1
2: 6
3: 9
4: 55
1160995394_1160995402 -6 Left 1160995394 19:1879903-1879925 CCCCAGGGTCGCCCTCACCTGGT 0: 5
1: 2
2: 2
3: 22
4: 159
Right 1160995402 19:1879920-1879942 CCTGGTGCGCAGGGCCTGCCAGG 0: 11
1: 0
2: 2
3: 39
4: 362

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160995394 Original CRISPR ACCAGGTGAGGGCGACCCTG GGG (reversed) Exonic