ID: 1160995395

View in Genome Browser
Species Human (GRCh38)
Location 19:1879904-1879926
Sequence CACCAGGTGAGGGCGACCCT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 5, 1: 6, 2: 2, 3: 15, 4: 119}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160995395_1160995407 16 Left 1160995395 19:1879904-1879926 CCCAGGGTCGCCCTCACCTGGTG 0: 5
1: 6
2: 2
3: 15
4: 119
Right 1160995407 19:1879943-1879965 CGGCGTCGATGTCGGCATAGAGG 0: 5
1: 3
2: 4
3: 1
4: 8
1160995395_1160995402 -7 Left 1160995395 19:1879904-1879926 CCCAGGGTCGCCCTCACCTGGTG 0: 5
1: 6
2: 2
3: 15
4: 119
Right 1160995402 19:1879920-1879942 CCTGGTGCGCAGGGCCTGCCAGG 0: 11
1: 0
2: 2
3: 39
4: 362
1160995395_1160995403 -4 Left 1160995395 19:1879904-1879926 CCCAGGGTCGCCCTCACCTGGTG 0: 5
1: 6
2: 2
3: 15
4: 119
Right 1160995403 19:1879923-1879945 GGTGCGCAGGGCCTGCCAGGCGG 0: 10
1: 2
2: 3
3: 33
4: 324
1160995395_1160995405 8 Left 1160995395 19:1879904-1879926 CCCAGGGTCGCCCTCACCTGGTG 0: 5
1: 6
2: 2
3: 15
4: 119
Right 1160995405 19:1879935-1879957 CTGCCAGGCGGCGTCGATGTCGG 0: 5
1: 7
2: 0
3: 3
4: 61
1160995395_1160995409 30 Left 1160995395 19:1879904-1879926 CCCAGGGTCGCCCTCACCTGGTG 0: 5
1: 6
2: 2
3: 15
4: 119
Right 1160995409 19:1879957-1879979 GCATAGAGGTTCCTCTCGGAAGG 0: 5
1: 1
2: 6
3: 4
4: 68
1160995395_1160995408 26 Left 1160995395 19:1879904-1879926 CCCAGGGTCGCCCTCACCTGGTG 0: 5
1: 6
2: 2
3: 15
4: 119
Right 1160995408 19:1879953-1879975 GTCGGCATAGAGGTTCCTCTCGG 0: 5
1: 1
2: 6
3: 9
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160995395 Original CRISPR CACCAGGTGAGGGCGACCCT GGG (reversed) Exonic