ID: 1160995396

View in Genome Browser
Species Human (GRCh38)
Location 19:1879905-1879927
Sequence GCACCAGGTGAGGGCGACCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 10, 1: 1, 2: 0, 3: 23, 4: 185}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160995396_1160995405 7 Left 1160995396 19:1879905-1879927 CCAGGGTCGCCCTCACCTGGTGC 0: 10
1: 1
2: 0
3: 23
4: 185
Right 1160995405 19:1879935-1879957 CTGCCAGGCGGCGTCGATGTCGG 0: 5
1: 7
2: 0
3: 3
4: 61
1160995396_1160995409 29 Left 1160995396 19:1879905-1879927 CCAGGGTCGCCCTCACCTGGTGC 0: 10
1: 1
2: 0
3: 23
4: 185
Right 1160995409 19:1879957-1879979 GCATAGAGGTTCCTCTCGGAAGG 0: 5
1: 1
2: 6
3: 4
4: 68
1160995396_1160995402 -8 Left 1160995396 19:1879905-1879927 CCAGGGTCGCCCTCACCTGGTGC 0: 10
1: 1
2: 0
3: 23
4: 185
Right 1160995402 19:1879920-1879942 CCTGGTGCGCAGGGCCTGCCAGG 0: 11
1: 0
2: 2
3: 39
4: 362
1160995396_1160995403 -5 Left 1160995396 19:1879905-1879927 CCAGGGTCGCCCTCACCTGGTGC 0: 10
1: 1
2: 0
3: 23
4: 185
Right 1160995403 19:1879923-1879945 GGTGCGCAGGGCCTGCCAGGCGG 0: 10
1: 2
2: 3
3: 33
4: 324
1160995396_1160995408 25 Left 1160995396 19:1879905-1879927 CCAGGGTCGCCCTCACCTGGTGC 0: 10
1: 1
2: 0
3: 23
4: 185
Right 1160995408 19:1879953-1879975 GTCGGCATAGAGGTTCCTCTCGG 0: 5
1: 1
2: 6
3: 9
4: 55
1160995396_1160995407 15 Left 1160995396 19:1879905-1879927 CCAGGGTCGCCCTCACCTGGTGC 0: 10
1: 1
2: 0
3: 23
4: 185
Right 1160995407 19:1879943-1879965 CGGCGTCGATGTCGGCATAGAGG 0: 5
1: 3
2: 4
3: 1
4: 8

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160995396 Original CRISPR GCACCAGGTGAGGGCGACCC TGG (reversed) Exonic