ID: 1160995397

View in Genome Browser
Species Human (GRCh38)
Location 19:1879910-1879932
Sequence GTCGCCCTCACCTGGTGCGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 10, 1: 1, 2: 0, 3: 5, 4: 62}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160995387_1160995397 12 Left 1160995387 19:1879875-1879897 CCTCTTGGGTGTGCCCAGGCTGA 0: 6
1: 4
2: 2
3: 10
4: 198
Right 1160995397 19:1879910-1879932 GTCGCCCTCACCTGGTGCGCAGG 0: 10
1: 1
2: 0
3: 5
4: 62
1160995376_1160995397 27 Left 1160995376 19:1879860-1879882 CCCCCCGCCTGGTCCCCTCTTGG 0: 2
1: 2
2: 6
3: 25
4: 252
Right 1160995397 19:1879910-1879932 GTCGCCCTCACCTGGTGCGCAGG 0: 10
1: 1
2: 0
3: 5
4: 62
1160995381_1160995397 24 Left 1160995381 19:1879863-1879885 CCCGCCTGGTCCCCTCTTGGGTG 0: 4
1: 6
2: 2
3: 16
4: 254
Right 1160995397 19:1879910-1879932 GTCGCCCTCACCTGGTGCGCAGG 0: 10
1: 1
2: 0
3: 5
4: 62
1160995385_1160995397 14 Left 1160995385 19:1879873-1879895 CCCCTCTTGGGTGTGCCCAGGCT 0: 6
1: 4
2: 1
3: 14
4: 243
Right 1160995397 19:1879910-1879932 GTCGCCCTCACCTGGTGCGCAGG 0: 10
1: 1
2: 0
3: 5
4: 62
1160995378_1160995397 26 Left 1160995378 19:1879861-1879883 CCCCCGCCTGGTCCCCTCTTGGG 0: 2
1: 2
2: 8
3: 15
4: 191
Right 1160995397 19:1879910-1879932 GTCGCCCTCACCTGGTGCGCAGG 0: 10
1: 1
2: 0
3: 5
4: 62
1160995380_1160995397 25 Left 1160995380 19:1879862-1879884 CCCCGCCTGGTCCCCTCTTGGGT 0: 2
1: 2
2: 9
3: 20
4: 204
Right 1160995397 19:1879910-1879932 GTCGCCCTCACCTGGTGCGCAGG 0: 10
1: 1
2: 0
3: 5
4: 62
1160995386_1160995397 13 Left 1160995386 19:1879874-1879896 CCCTCTTGGGTGTGCCCAGGCTG 0: 6
1: 4
2: 3
3: 31
4: 279
Right 1160995397 19:1879910-1879932 GTCGCCCTCACCTGGTGCGCAGG 0: 10
1: 1
2: 0
3: 5
4: 62
1160995382_1160995397 23 Left 1160995382 19:1879864-1879886 CCGCCTGGTCCCCTCTTGGGTGT 0: 2
1: 0
2: 1
3: 17
4: 204
Right 1160995397 19:1879910-1879932 GTCGCCCTCACCTGGTGCGCAGG 0: 10
1: 1
2: 0
3: 5
4: 62
1160995383_1160995397 20 Left 1160995383 19:1879867-1879889 CCTGGTCCCCTCTTGGGTGTGCC 0: 4
1: 4
2: 2
3: 13
4: 152
Right 1160995397 19:1879910-1879932 GTCGCCCTCACCTGGTGCGCAGG 0: 10
1: 1
2: 0
3: 5
4: 62
1160995391_1160995397 -2 Left 1160995391 19:1879889-1879911 CCAGGCTGAGCTGCCCCCAGGGT 0: 6
1: 1
2: 6
3: 37
4: 367
Right 1160995397 19:1879910-1879932 GTCGCCCTCACCTGGTGCGCAGG 0: 10
1: 1
2: 0
3: 5
4: 62
1160995389_1160995397 -1 Left 1160995389 19:1879888-1879910 CCCAGGCTGAGCTGCCCCCAGGG 0: 6
1: 1
2: 13
3: 65
4: 467
Right 1160995397 19:1879910-1879932 GTCGCCCTCACCTGGTGCGCAGG 0: 10
1: 1
2: 0
3: 5
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160995397 Original CRISPR GTCGCCCTCACCTGGTGCGC AGG Exonic