ID: 1160995402

View in Genome Browser
Species Human (GRCh38)
Location 19:1879920-1879942
Sequence CCTGGTGCGCAGGGCCTGCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 414
Summary {0: 11, 1: 0, 2: 2, 3: 39, 4: 362}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160995383_1160995402 30 Left 1160995383 19:1879867-1879889 CCTGGTCCCCTCTTGGGTGTGCC 0: 4
1: 4
2: 2
3: 13
4: 152
Right 1160995402 19:1879920-1879942 CCTGGTGCGCAGGGCCTGCCAGG 0: 11
1: 0
2: 2
3: 39
4: 362
1160995389_1160995402 9 Left 1160995389 19:1879888-1879910 CCCAGGCTGAGCTGCCCCCAGGG 0: 6
1: 1
2: 13
3: 65
4: 467
Right 1160995402 19:1879920-1879942 CCTGGTGCGCAGGGCCTGCCAGG 0: 11
1: 0
2: 2
3: 39
4: 362
1160995385_1160995402 24 Left 1160995385 19:1879873-1879895 CCCCTCTTGGGTGTGCCCAGGCT 0: 6
1: 4
2: 1
3: 14
4: 243
Right 1160995402 19:1879920-1879942 CCTGGTGCGCAGGGCCTGCCAGG 0: 11
1: 0
2: 2
3: 39
4: 362
1160995387_1160995402 22 Left 1160995387 19:1879875-1879897 CCTCTTGGGTGTGCCCAGGCTGA 0: 6
1: 4
2: 2
3: 10
4: 198
Right 1160995402 19:1879920-1879942 CCTGGTGCGCAGGGCCTGCCAGG 0: 11
1: 0
2: 2
3: 39
4: 362
1160995391_1160995402 8 Left 1160995391 19:1879889-1879911 CCAGGCTGAGCTGCCCCCAGGGT 0: 6
1: 1
2: 6
3: 37
4: 367
Right 1160995402 19:1879920-1879942 CCTGGTGCGCAGGGCCTGCCAGG 0: 11
1: 0
2: 2
3: 39
4: 362
1160995386_1160995402 23 Left 1160995386 19:1879874-1879896 CCCTCTTGGGTGTGCCCAGGCTG 0: 6
1: 4
2: 3
3: 31
4: 279
Right 1160995402 19:1879920-1879942 CCTGGTGCGCAGGGCCTGCCAGG 0: 11
1: 0
2: 2
3: 39
4: 362
1160995396_1160995402 -8 Left 1160995396 19:1879905-1879927 CCAGGGTCGCCCTCACCTGGTGC 0: 10
1: 1
2: 0
3: 23
4: 185
Right 1160995402 19:1879920-1879942 CCTGGTGCGCAGGGCCTGCCAGG 0: 11
1: 0
2: 2
3: 39
4: 362
1160995395_1160995402 -7 Left 1160995395 19:1879904-1879926 CCCAGGGTCGCCCTCACCTGGTG 0: 5
1: 6
2: 2
3: 15
4: 119
Right 1160995402 19:1879920-1879942 CCTGGTGCGCAGGGCCTGCCAGG 0: 11
1: 0
2: 2
3: 39
4: 362
1160995394_1160995402 -6 Left 1160995394 19:1879903-1879925 CCCCAGGGTCGCCCTCACCTGGT 0: 5
1: 2
2: 2
3: 22
4: 159
Right 1160995402 19:1879920-1879942 CCTGGTGCGCAGGGCCTGCCAGG 0: 11
1: 0
2: 2
3: 39
4: 362
1160995392_1160995402 -5 Left 1160995392 19:1879902-1879924 CCCCCAGGGTCGCCCTCACCTGG 0: 5
1: 2
2: 4
3: 19
4: 240
Right 1160995402 19:1879920-1879942 CCTGGTGCGCAGGGCCTGCCAGG 0: 11
1: 0
2: 2
3: 39
4: 362

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160995402 Original CRISPR CCTGGTGCGCAGGGCCTGCC AGG Exonic