ID: 1161000415

View in Genome Browser
Species Human (GRCh38)
Location 19:1907922-1907944
Sequence CCGGAACAGGCACAGTGTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 70}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161000415_1161000429 29 Left 1161000415 19:1907922-1907944 CCTGAACACTGTGCCTGTTCCGG 0: 1
1: 0
2: 0
3: 3
4: 70
Right 1161000429 19:1907974-1907996 GGGCCCAGCCTGCAGTGTCCCGG 0: 1
1: 2
2: 7
3: 41
4: 381
1161000415_1161000421 0 Left 1161000415 19:1907922-1907944 CCTGAACACTGTGCCTGTTCCGG 0: 1
1: 0
2: 0
3: 3
4: 70
Right 1161000421 19:1907945-1907967 GATTTTGACCTGCCCTCCAAGGG 0: 1
1: 0
2: 0
3: 11
4: 98
1161000415_1161000420 -1 Left 1161000415 19:1907922-1907944 CCTGAACACTGTGCCTGTTCCGG 0: 1
1: 0
2: 0
3: 3
4: 70
Right 1161000420 19:1907944-1907966 GGATTTTGACCTGCCCTCCAAGG 0: 1
1: 0
2: 0
3: 19
4: 128
1161000415_1161000424 8 Left 1161000415 19:1907922-1907944 CCTGAACACTGTGCCTGTTCCGG 0: 1
1: 0
2: 0
3: 3
4: 70
Right 1161000424 19:1907953-1907975 CCTGCCCTCCAAGGGCGCGGCGG 0: 1
1: 0
2: 1
3: 11
4: 173
1161000415_1161000425 9 Left 1161000415 19:1907922-1907944 CCTGAACACTGTGCCTGTTCCGG 0: 1
1: 0
2: 0
3: 3
4: 70
Right 1161000425 19:1907954-1907976 CTGCCCTCCAAGGGCGCGGCGGG 0: 1
1: 0
2: 1
3: 13
4: 148
1161000415_1161000422 5 Left 1161000415 19:1907922-1907944 CCTGAACACTGTGCCTGTTCCGG 0: 1
1: 0
2: 0
3: 3
4: 70
Right 1161000422 19:1907950-1907972 TGACCTGCCCTCCAAGGGCGCGG 0: 1
1: 0
2: 1
3: 13
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161000415 Original CRISPR CCGGAACAGGCACAGTGTTC AGG (reversed) Intronic
900676544 1:3890741-3890763 CCGGACCCGGCACTGTGTTTTGG + Exonic
902559326 1:17267235-17267257 CCAGATCAGACACAGTCTTCAGG - Intronic
904163526 1:28538104-28538126 CAGGAACTGACACAGTGCTCAGG - Exonic
907467982 1:54652138-54652160 CCGGAACAAGCAAACTGTTAAGG + Intronic
907712499 1:56897313-56897335 CAGGAACAAGCAGAGTGTGCTGG + Intronic
909369741 1:74870144-74870166 CCTGCACATGCACAGTGTACAGG + Intergenic
915115941 1:153599621-153599643 AGGGAACAGGCACAGTATTGAGG + Intergenic
915341993 1:155181719-155181741 CAGGAACAGGCAGGGGGTTCAGG - Intronic
1063985077 10:11493765-11493787 CAGGAACAGGCCCAGAGGTCCGG - Intronic
1064094248 10:12411377-12411399 CAGGAACCTGCACAGTGATCAGG - Intronic
1066447194 10:35493974-35493996 CCTGGTCAGGCCCAGTGTTCTGG - Intronic
1067296839 10:44979550-44979572 CCGCCACAGGTACAGTGGTCAGG + Intronic
1090549882 11:127808299-127808321 GCAGAGCAGGCACAGTGTTCTGG - Intergenic
1102524827 12:113504904-113504926 CCGTCACAGGAACAGTGTTTTGG - Intergenic
1108059819 13:46521328-46521350 CCAGAACAGGCATACTGGTCGGG - Intergenic
1113185453 13:107681787-107681809 CTGGAACAAGCACAGTGTCAGGG - Intronic
1113369675 13:109712070-109712092 CTGTAACAGGTACAGAGTTCTGG + Intergenic
1115292376 14:31786793-31786815 GAAGAACAGGCAGAGTGTTCTGG + Intronic
1121617995 14:95326526-95326548 CCAGCACAGCCACAGTGTTTGGG - Intergenic
1125980544 15:43996316-43996338 CTGGGACAGGCCCAGTGTTGAGG + Intronic
1127334519 15:57970457-57970479 CTGGAAGAGCCACAGTGTACTGG + Intronic
1132424563 15:101703964-101703986 CAGGCACAGTTACAGTGTTCTGG + Intronic
1133808960 16:9146564-9146586 CTGGAGCATGCACAGTGATCCGG + Intergenic
1133862324 16:9607683-9607705 CCTGAACAGTCACAGTGATGGGG + Intergenic
1134022006 16:10927834-10927856 CAGGGACAGGCACAGTGTGCCGG + Exonic
1135969226 16:27060307-27060329 ACAGAGCAGGCACAGTGCTCCGG - Intergenic
1136547428 16:30963611-30963633 CCGGAGCAGGAGCAGTCTTCGGG + Intronic
1138359375 16:56414486-56414508 TCTGAAAAGGCACACTGTTCTGG + Intronic
1139580418 16:67870066-67870088 CCTGAAGAGGCACAGAATTCAGG + Intronic
1144862543 17:18314711-18314733 CGGGAAAAGGCACGGTCTTCGGG + Exonic
1148566328 17:48635097-48635119 CAGGCTCAGGCAGAGTGTTCAGG + Intergenic
1150774778 17:68070888-68070910 CCTGACCATGCACACTGTTCCGG - Intergenic
1154982383 18:21513954-21513976 ATGGAACATTCACAGTGTTCAGG + Exonic
1161000415 19:1907922-1907944 CCGGAACAGGCACAGTGTTCAGG - Intronic
1167067286 19:47196019-47196041 CCGGAAGAGGCAGAGTGTGATGG - Intronic
927921050 2:26971852-26971874 CTGGAGGAGGCACAGTGTACAGG - Intronic
928844536 2:35654625-35654647 AGAAAACAGGCACAGTGTTCTGG + Intergenic
929054640 2:37865501-37865523 CCTGAACATTCACTGTGTTCAGG - Intergenic
933818494 2:86088430-86088452 CCAGCAGAGGCACAGTGTGCAGG - Intronic
933873208 2:86590572-86590594 CAGGAACAGGCAAAGATTTCAGG - Intronic
933942796 2:87259163-87259185 CCCCAAAAGGCACACTGTTCTGG - Intergenic
935703708 2:105837560-105837582 CAGGGACATGCACAGTGCTCAGG - Intronic
936337422 2:111602399-111602421 CCCCAAAAGGCACACTGTTCTGG + Intergenic
936680821 2:114769165-114769187 CCTGAAGAGGCACAGTGGTGTGG + Intronic
937857784 2:126685076-126685098 CCGGAAAAGACGCAGTGTACAGG - Intronic
1171316862 20:24203034-24203056 GGGGAACAGGCACAGTGACCTGG + Intergenic
1172121074 20:32599014-32599036 CAGGAACAGGCACAGAGGGCAGG + Intronic
1176026228 20:62986899-62986921 CACCAACTGGCACAGTGTTCAGG - Intergenic
952046210 3:29324246-29324268 AGGGAAGAGGCACAGTATTCTGG + Intronic
954437630 3:50504253-50504275 GCTGAACAGGCACTGTGTGCAGG + Intergenic
958068576 3:88578975-88578997 CAGGAACAGGCCCAGTGACCTGG - Intergenic
960350198 3:116583313-116583335 ACTGAACAGGCAAAGTGTACTGG + Intronic
962263746 3:133931134-133931156 CCGGAAAAGGAAGAGTGTGCAGG - Intergenic
990160011 5:52927438-52927460 CTGGAAGAGGCACAGAATTCTGG - Intronic
990236230 5:53771367-53771389 CTGGATCAGGCCCAGTGTTGGGG - Intergenic
992013846 5:72556866-72556888 CTGGAAAAGGCAGCGTGTTCTGG + Intergenic
1003487449 6:6591885-6591907 TGGGACCAGGCACAGGGTTCAGG + Intronic
1003990423 6:11481431-11481453 CAGAAATAGGCACAGTGTCCGGG + Intergenic
1004761895 6:18676524-18676546 CTTCAACAGGCACAGTGTTGTGG + Intergenic
1005842063 6:29750063-29750085 CTGGGACAGTCACAGTGTTTAGG - Intergenic
1007709036 6:43810055-43810077 CTGGATCAGGCACTGTGTTTAGG - Intergenic
1014478976 6:121911749-121911771 CCAGTACAGGTACAGTGGTCTGG + Intergenic
1015073092 6:129121217-129121239 ACGGAACAAGCACAGTGATGAGG - Intronic
1015713524 6:136166925-136166947 CCAGACCAGGCACAGCCTTCTGG - Intronic
1023836853 7:44073611-44073633 CCGGAGCAGGTACATTGTTGGGG - Exonic
1035639520 8:1173728-1173750 TCGGAAAAAGCACAGTATTCGGG + Intergenic
1035699524 8:1627354-1627376 TCGGGACAGGCACAGTGGCCAGG + Intronic
1039944853 8:42120345-42120367 CCGGAAGAGGCACAGTCCTCAGG + Intergenic
1056299630 9:85227706-85227728 CCAGAACAGTCCCAGTGCTCAGG - Intergenic
1057410299 9:94811708-94811730 CCGGGACAGGCACAGGGGCCTGG - Intronic
1058601816 9:106678716-106678738 CAGGAAAAGGCACAGAATTCAGG - Intergenic
1192248823 X:69394364-69394386 CCTAAACAGGCAAGGTGTTCAGG + Intergenic
1192605658 X:72514441-72514463 CCTGAACATGCACAGTGACCAGG - Intronic
1198794971 X:140385038-140385060 CTGGAAAAGGAACAGTGTTTGGG - Intergenic