ID: 1161004467

View in Genome Browser
Species Human (GRCh38)
Location 19:1927843-1927865
Sequence TACCGAAGGGGTGTGGGGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161004454_1161004467 29 Left 1161004454 19:1927791-1927813 CCACAACAAAGATTGAGGGCAAA No data
Right 1161004467 19:1927843-1927865 TACCGAAGGGGTGTGGGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161004467 Original CRISPR TACCGAAGGGGTGTGGGGAT GGG Intergenic
No off target data available for this crispr