ID: 1161007353

View in Genome Browser
Species Human (GRCh38)
Location 19:1943175-1943197
Sequence GTTCCCTTCACCCCGGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 92}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161007346_1161007353 22 Left 1161007346 19:1943130-1943152 CCGTGCAGCGGGCAAATGGGGTG 0: 1
1: 0
2: 0
3: 8
4: 111
Right 1161007353 19:1943175-1943197 GTTCCCTTCACCCCGGTGGGAGG 0: 1
1: 0
2: 0
3: 5
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161007353 Original CRISPR GTTCCCTTCACCCCGGTGGG AGG Intronic
900411407 1:2514327-2514349 GTGCCCAGCACCCCGGTGTGTGG - Intronic
902169710 1:14599574-14599596 GTGCCATTCACCCCTGCGGGGGG - Intronic
902389050 1:16092189-16092211 GATGCCTCCACCTCGGTGGGTGG - Intergenic
903226863 1:21898744-21898766 GGTCCCCTCAACCTGGTGGGGGG + Intronic
903819134 1:26087775-26087797 AATCCCTTGACCCCGGGGGGCGG + Intergenic
906055745 1:42915459-42915481 TTTCCTTTCCCCCAGGTGGGAGG - Intergenic
906639625 1:47433848-47433870 GCTCCCTTAGCCCAGGTGGGAGG - Intergenic
914816702 1:151068669-151068691 GATCCCTTGACCCTGGTGGGTGG - Intronic
917524050 1:175771481-175771503 GGTCCCCACACCCCTGTGGGTGG - Intergenic
1064478819 10:15719771-15719793 TCTCCCTCCGCCCCGGTGGGTGG + Exonic
1065004682 10:21368549-21368571 GTTCCCTTCACCACAGTGATTGG - Intergenic
1069543475 10:69312933-69312955 GTTTCCTTCACCTCCTTGGGAGG + Intronic
1069642152 10:69963023-69963045 GTTTCCTTCACCACAGTGAGGGG - Intronic
1070463816 10:76698117-76698139 GTTTCCTACATCCCTGTGGGAGG - Intergenic
1077385344 11:2267130-2267152 GTCCGCTTCACGCCAGTGGGTGG + Intergenic
1080877474 11:36289691-36289713 TTTCCCTTGACCCATGTGGGTGG + Intergenic
1085596971 11:77820018-77820040 TCTCCCTTCACCTGGGTGGGCGG - Intronic
1090034339 11:123235393-123235415 GTTCCCTTCCCACCAGTCGGTGG + Intergenic
1091795359 12:3294788-3294810 ATTCCGTTCAACCTGGTGGGAGG + Intergenic
1093759624 12:22893217-22893239 GTTCCCTTTACCCCTGTCTGTGG - Intergenic
1100531877 12:95468720-95468742 GTTCCCTTGACCCCCTTGGTGGG + Intergenic
1106248462 13:27967270-27967292 GTGGCCTTCTCCCCGGTCGGCGG + Intronic
1107491049 13:40880071-40880093 GTCCTCTTAACCACGGTGGGGGG + Intergenic
1112401000 13:99078267-99078289 TTTCCCTTCACTCCGAAGGGGGG - Intronic
1118018943 14:61691196-61691218 TTTCCCTTCTCCCCTGTGGAAGG + Intergenic
1127503143 15:59573249-59573271 CTTCCCGTCACCCAGGTTGGAGG - Intergenic
1130285710 15:82552804-82552826 CTTTCCTTCACCAGGGTGGGAGG - Intronic
1131245332 15:90786983-90787005 TTTGCCGTCACCCAGGTGGGTGG + Intronic
1143412501 17:6719188-6719210 GGTCGCTTCAGCCCAGTGGGTGG + Intergenic
1143690798 17:8563455-8563477 GTTCCCTTGACCCCGGATTGGGG - Intronic
1146844342 17:36173842-36173864 GCTCCCTTGACCCTGGCGGGGGG - Intronic
1146856647 17:36261777-36261799 GCTCCCTTGACCCTGGCGGGGGG - Intronic
1146863970 17:36326598-36326620 GCTCCCTTGACCCTGGCGGGGGG + Intronic
1146872557 17:36385688-36385710 GCTCCCTTGACCCTGGCGGGGGG - Intronic
1146879915 17:36436773-36436795 GCTCCCTTGACCCTGGCGGGGGG - Intronic
1146903257 17:36601707-36601729 GTACCCTTCACCTCGGTGTTGGG + Exonic
1147066830 17:37927186-37927208 GCTCCCTTGACCCTGGCGGGGGG + Intronic
1147075441 17:37986312-37986334 GCTCCCTTGACCCTGGCGGGGGG - Intronic
1147078362 17:38006747-38006769 GCTCCCTTGACCCTGGCGGGGGG + Intronic
1147086966 17:38065858-38065880 GCTCCCTTGACCCTGGCGGGGGG - Intronic
1147094300 17:38130682-38130704 GCTCCCTTGACCCTGGCGGGGGG + Intergenic
1147102911 17:38189821-38189843 GCTCCCTTGACCCTGGCGGGGGG - Intergenic
1152019538 17:77773124-77773146 GTGCCATTCACCCAGGTGAGGGG - Intergenic
1159425266 18:68276601-68276623 GATCACTTGAACCCGGTGGGTGG - Intergenic
1160773454 19:844020-844042 GTTCTCCTCATCCAGGTGGGCGG + Exonic
1161007353 19:1943175-1943197 GTTCCCTTCACCCCGGTGGGAGG + Intronic
1161383984 19:3981303-3981325 GTTCCCTCCACCCCGAGGGCTGG + Intronic
1161884358 19:6982340-6982362 GTTCCCATCACCCGGGTAGTGGG - Intergenic
1162744936 19:12792868-12792890 GCTCCCTGGACCCCAGTGGGAGG - Exonic
1167575263 19:50314830-50314852 GCTCCCCTCCCCCCTGTGGGGGG - Intronic
929492231 2:42407409-42407431 GTTGCCATCACCAAGGTGGGAGG - Intronic
931166991 2:59758918-59758940 GTTCCCTGTGCCCCAGTGGGGGG + Intergenic
935265748 2:101392433-101392455 ATTCCCTTCCCCCAGGTGTGGGG - Intergenic
936245352 2:110821436-110821458 TCTCCCTCCACCCAGGTGGGAGG - Intronic
1170485142 20:16807951-16807973 GTTCCCTCCACCCCTGAGGTTGG + Intergenic
1171166535 20:22976775-22976797 GTTCCCTTCCCCACTGAGGGTGG - Intergenic
1171403857 20:24896537-24896559 GTTCCCATCTTCCTGGTGGGGGG + Intergenic
1171967632 20:31542418-31542440 GTGCCCTTCTCCCCTGGGGGTGG - Intronic
1174017733 20:47502197-47502219 CTTCCCCTCAGCCCGGGGGGCGG + Intronic
1176009484 20:62885123-62885145 GTGCCCTTCACCCCAGGGCGTGG - Intronic
1176235025 20:64049965-64049987 GTTCCCCGCCCCCCGCTGGGAGG + Intronic
1178373116 21:32044275-32044297 CTTCCCTTCCACGCGGTGGGAGG + Intronic
1179525153 21:41971276-41971298 GCTCCCCTCTCCCCGCTGGGAGG + Intergenic
1185097678 22:48820655-48820677 GCTGCCTGCACCACGGTGGGGGG + Intronic
949484432 3:4524148-4524170 GTCCCCTGCACCCAGGTGAGGGG + Intronic
951915186 3:27793184-27793206 GCTCCCAGCACCCTGGTGGGAGG + Intergenic
969212063 4:5695566-5695588 GTTCCCCTCACCTGGGTGTGTGG + Intronic
969417133 4:7068196-7068218 TTTCCCCACCCCCCGGTGGGCGG + Exonic
984241705 4:177227129-177227151 GTTCCCTTCCACGCTGTGGGAGG - Intergenic
989064195 5:37443351-37443373 GATCCCTTCAGCCCTGTGAGTGG + Exonic
992028617 5:72697386-72697408 GTTCCCTTCACTCCTGTGAGTGG - Intergenic
998044209 5:138973051-138973073 GATCCCTTCAGCCAGGTGGCAGG - Intronic
999313348 5:150568124-150568146 GATCCCTTCAGCCCGGGGGGAGG - Intergenic
1001292629 5:170474883-170474905 GTCCCCTTCTACGCGGTGGGGGG - Intronic
1003139282 6:3457149-3457171 GTTACCTCCACCTCGGCGGGGGG - Intergenic
1007339692 6:41182845-41182867 TTGCCCTTCACCCCTGTGGAAGG - Intergenic
1010969339 6:82247500-82247522 CTTCCCTTCAGCCCGGGGGCAGG - Intronic
1016951825 6:149587798-149587820 GTTCCCTTCCCCAAGGTTGGGGG + Intronic
1023628311 7:42138556-42138578 TTTCCCTTCACCCCTGGGGGAGG + Intronic
1028121406 7:87059688-87059710 GCTCCCGTCACGCCGGAGGGAGG + Exonic
1031508196 7:122613969-122613991 CTTCCCTTTAACCCAGTGGGAGG - Intronic
1036271828 8:7312078-7312100 GTTCCCTTTACTTGGGTGGGGGG + Intergenic
1044560141 8:93604794-93604816 GTTCCCTTCACCCAGGTCTTAGG - Intergenic
1044641959 8:94392346-94392368 GTTCCCTTGAACCCGGGAGGTGG - Intronic
1049278278 8:141730926-141730948 ATTCCTTTCACCCCGGGGGTGGG + Intergenic
1049389492 8:142360628-142360650 GCTCCCTTCAGGCTGGTGGGGGG - Intronic
1049833081 8:144714314-144714336 GCTCCCTCCACCCCGACGGGAGG - Intergenic
1051593832 9:18803551-18803573 GTGCCCTTCAGACAGGTGGGCGG - Intronic
1053616826 9:39775823-39775845 GGTCCCTTGACACCAGTGGGTGG - Intergenic
1054236691 9:62566560-62566582 GGTCCCTTGACACCAGTGGGTGG + Intergenic
1054267342 9:62931615-62931637 GGTCCCTTGACACCAGTGGGTGG + Intergenic
1054550828 9:66601068-66601090 GGTCCCTTGACACCAGTGGGTGG + Intergenic
1057388765 9:94626019-94626041 GTTTCCATGACCCCGCTGGGTGG + Intronic
1057568149 9:96183074-96183096 GTTCCTTTCACCCACGTGGGAGG + Intergenic
1060412687 9:123410570-123410592 CTTCCCTTCCCCGCTGTGGGTGG - Intronic
1062591351 9:137276207-137276229 GCTCCCTTCACCCCTGTAGATGG + Intergenic
1187858649 X:23660891-23660913 GGTCCTTCCACCCCAGTGGGTGG - Intergenic
1192237889 X:69307434-69307456 GTTCCCCTCACCCTTCTGGGGGG + Intergenic