ID: 1161007585

View in Genome Browser
Species Human (GRCh38)
Location 19:1944233-1944255
Sequence TTCTCTCGTGTGGCTGCCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 78}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161007585_1161007590 -8 Left 1161007585 19:1944233-1944255 CCGCCGGCAGCCACACGAGAGAA 0: 1
1: 0
2: 0
3: 6
4: 78
Right 1161007590 19:1944248-1944270 CGAGAGAACCTGTTGGTTGGCGG 0: 1
1: 0
2: 0
3: 5
4: 84
1161007585_1161007592 5 Left 1161007585 19:1944233-1944255 CCGCCGGCAGCCACACGAGAGAA 0: 1
1: 0
2: 0
3: 6
4: 78
Right 1161007592 19:1944261-1944283 TGGTTGGCGGCCTCTGTGCAAGG 0: 1
1: 0
2: 1
3: 9
4: 151
1161007585_1161007594 19 Left 1161007585 19:1944233-1944255 CCGCCGGCAGCCACACGAGAGAA 0: 1
1: 0
2: 0
3: 6
4: 78
Right 1161007594 19:1944275-1944297 TGTGCAAGGCCGTCTGAGTGAGG 0: 1
1: 0
2: 0
3: 10
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161007585 Original CRISPR TTCTCTCGTGTGGCTGCCGG CGG (reversed) Intronic
900616074 1:3566236-3566258 TTCTCTGATGTGGCTGCCCCAGG - Intronic
902617319 1:17630894-17630916 TTCTCTCCTGGGGATGCCTGGGG + Intronic
903518404 1:23928361-23928383 GTCTCTCATGTGGTTGCTGGTGG - Intergenic
909593226 1:77375704-77375726 TTCTATTGTGTGGCTGTAGGAGG - Intronic
912366277 1:109136413-109136435 TTCTCCCTTGTGGCTTCCGAAGG + Intronic
912589220 1:110797931-110797953 TTCTGTCCTGTGGCAGCCTGGGG + Intergenic
919405045 1:197169108-197169130 TTCTCATATGTGGCTGCTGGTGG + Intronic
920080216 1:203367616-203367638 TTCTCAGGTGTGGCTGCTGCTGG + Intergenic
923663194 1:235976858-235976880 TTCTGTCATGTGGAGGCCGGAGG + Exonic
1068668265 10:59698501-59698523 TTCTCTCTTCTGGCTGGCAGTGG - Intronic
1069634066 10:69914644-69914666 TCCTCTGGTGTGGGTGCAGGTGG - Intronic
1071021393 10:81061179-81061201 TTCTCCAGTGATGCTGCCGGAGG + Intergenic
1074151374 10:110762680-110762702 TTCTTTCCTGTGGCTGGCTGTGG + Intronic
1074500789 10:114022400-114022422 TTATCTCGTGTGTGTGTCGGGGG - Intergenic
1075093285 10:119455144-119455166 TGCTCTGGTGGGGCTGCCAGGGG + Exonic
1084684875 11:70687680-70687702 TCCTCTCCTTTGCCTGCCGGCGG + Intronic
1089882601 11:121789237-121789259 TTCTCTCAAGTGGCAGCTGGGGG - Intergenic
1091232021 11:133994353-133994375 TTCTCCCTTGTGGGTGCCAGAGG + Intergenic
1093273011 12:17089115-17089137 TTCTCTCTTGTGACTACCAGTGG + Intergenic
1097359736 12:58645729-58645751 TTCTCTCTTGGGGGTGGCGGGGG + Intronic
1104166174 12:126231844-126231866 TTCACTCATGTAGCTGGCGGAGG + Intergenic
1114214227 14:20643741-20643763 TTCTCTCCTGTGGGTCCCGCAGG + Intergenic
1121733402 14:96202070-96202092 TTCTCTTGGGAGGCTGCCTGGGG - Intergenic
1122557884 14:102591607-102591629 CTCCCTCGTGGGGGTGCCGGGGG + Intergenic
1131299752 15:91187207-91187229 TTATCTGGTGTGACTGCCTGAGG + Intronic
1134242197 16:12514284-12514306 TTCTCTCATGTGGCTTCCTAGGG + Intronic
1136958007 16:34806223-34806245 TTCTGCCGCGTGGCTGCTGGAGG + Intergenic
1141935538 16:87235823-87235845 TTCTCTCATGGGGCTTCCAGAGG - Intronic
1142185773 16:88694099-88694121 TTCCCTCGTGTGGCCGTAGGAGG + Intergenic
1143615492 17:8046972-8046994 TTCTCTCCTGTGTCTGCCTGAGG + Exonic
1152548899 17:81019542-81019564 TTCTCCTGTGTGCCTGCCTGGGG + Intergenic
1152563149 17:81088738-81088760 TTCCATCGTGTGGGTACCGGAGG + Intronic
1153427192 18:4978205-4978227 TTCTCTCATGTGGCTTCCAGTGG - Intergenic
1157095592 18:44682928-44682950 TTCCCTCCTCTGGCTCCCGGTGG - Intronic
1157166304 18:45361263-45361285 TTCTGTCCTGTGGCTACTGGGGG - Intronic
1161007585 19:1944233-1944255 TTCTCTCGTGTGGCTGCCGGCGG - Intronic
1162312861 19:9917516-9917538 TTCTCTCCTGTGTCTGCTTGGGG + Intronic
1165383989 19:35499858-35499880 TCCTCTCGGTTGGTTGCCGGAGG - Intronic
1168468119 19:56620271-56620293 TTCTCTGGTATGGCTGCCCCAGG - Intronic
925257515 2:2502837-2502859 TGCTCTCGTGTGCCTGGCTGTGG - Intergenic
927146721 2:20171030-20171052 TTCTGTTGTGTGGCTGCCCTGGG - Intergenic
932776355 2:74530312-74530334 TTCGCGCGCGTGGCTGGCGGTGG + Exonic
935529761 2:104218057-104218079 TTCACTCCTGTGGCTGGCAGTGG - Intergenic
938876074 2:135532091-135532113 CTCTCTCGTGTGGCTGGCGCCGG + Intronic
942087393 2:172456146-172456168 GTCTCTCCTCTGGCTGCAGGGGG - Intronic
942124844 2:172813480-172813502 TACTCTGTTGTGGCTGCAGGAGG + Intronic
942220082 2:173760339-173760361 TTCTCTCGTGGGGCTGTTGCTGG - Intergenic
943653358 2:190481094-190481116 TTCTCATGTGTGGCTTCAGGTGG + Intronic
948178229 2:235960469-235960491 TTCTCTGGGGTGGCTGGAGGTGG + Intronic
1169209717 20:3759262-3759284 TTCTCTCTTCTTGCTGCCAGGGG - Intronic
1171199842 20:23232078-23232100 TGCTCTGGTGTGGCTGTCAGAGG - Intergenic
1175445258 20:59015525-59015547 CCCTAACGTGTGGCTGCCGGTGG - Intergenic
1182960252 22:34465487-34465509 TTCGCTCATGTGGCTGCTGGTGG - Intergenic
1183714497 22:39525835-39525857 TTCTCTTGTTTGGCAGCGGGGGG - Intergenic
952136099 3:30422363-30422385 TTCTCTTGTGTGCCTGTAGGTGG - Intergenic
954782678 3:53072836-53072858 TGCCCTCTAGTGGCTGCCGGCGG + Intronic
955266653 3:57450748-57450770 TTTTCTCGGGTAGCTGCCTGTGG - Intronic
967211504 3:187174325-187174347 TTCCCTCTTTTGGCTGCTGGAGG - Intronic
968001168 3:195207826-195207848 CTCACTCGTGTGGCTGCTGGTGG + Intronic
968487421 4:870516-870538 TTCTCTGGTGTAGCTGGTGGTGG + Intronic
968551878 4:1228072-1228094 TTGCCTGGTGTGGCTGGCGGTGG - Intronic
968574516 4:1359013-1359035 TGCTCCCGGGTGGCTGCCCGAGG - Intronic
972089554 4:35264187-35264209 TTCTCTAGTCTGGATGCTGGAGG + Intergenic
972687741 4:41367419-41367441 TACTCTAGTGTGGCTGTTGGAGG + Intronic
973192502 4:47401533-47401555 TTCTCTCTAGTGGCTGAGGGGGG + Intronic
980745950 4:137015877-137015899 CTTTCTCTTGTGGCTGACGGAGG + Intergenic
981042697 4:140237990-140238012 CTCTCTCCTGTGGCTTCCAGAGG + Intergenic
982524401 4:156459299-156459321 TTCTCTTTTGTAGCTGCCGATGG - Intergenic
987410611 5:17611185-17611207 TTCTGTCTTTTGGCTGCAGGAGG - Intergenic
987413169 5:17634655-17634677 TTCTGTCTTTTGGCTGCAGGAGG - Intergenic
988464720 5:31477561-31477583 TTCTCAGGTGTGGCTGGCAGGGG - Intronic
993766427 5:91864148-91864170 TTCTCTCCTGTGTCTGTGGGTGG + Intergenic
995063055 5:107832138-107832160 CTCCCTGGTGTGGCTGCCAGAGG + Intergenic
996746890 5:126853654-126853676 TTCACTCTGGTGGCTGGCGGGGG - Intergenic
1005164557 6:22904758-22904780 TGAGCTCGTGTGGCTGCGGGTGG - Intergenic
1007387965 6:41532088-41532110 TGCTGCCGTGGGGCTGCCGGAGG + Intergenic
1008956615 6:57222365-57222387 TTCTGGCGGGTGGCTGGCGGCGG + Intergenic
1014995072 6:128132542-128132564 TTCTCTAGTGTGGGCCCCGGTGG - Intronic
1019723947 7:2590293-2590315 TTCCCTGGTGAGGCTGCTGGTGG - Intronic
1032664816 7:134025530-134025552 TTCTCTCCTGTGGCTGCAGTGGG + Intronic
1034487740 7:151376559-151376581 TCCACTCGTATGGCTGACGGGGG + Intronic
1040906435 8:52474008-52474030 GTCTATCTGGTGGCTGCCGGTGG - Intergenic
1055025064 9:71711009-71711031 TTCCCAGGTGTGGCTGCCTGTGG + Intronic
1192797688 X:74437778-74437800 TTCTCTCTTCTTGCTGCCTGTGG - Intronic
1201940937 Y:19459215-19459237 TTCTTTGGTGTGGTTGACGGGGG - Intergenic