ID: 1161011301

View in Genome Browser
Species Human (GRCh38)
Location 19:1960513-1960535
Sequence GTCCCCCGTGTGCCTGCGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 128}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161011299_1161011301 -2 Left 1161011299 19:1960492-1960514 CCGGCTCTGACACGCTGCCGTGT 0: 1
1: 0
2: 0
3: 1
4: 100
Right 1161011301 19:1960513-1960535 GTCCCCCGTGTGCCTGCGCCTGG 0: 1
1: 0
2: 0
3: 11
4: 128
1161011294_1161011301 30 Left 1161011294 19:1960460-1960482 CCTCGGGATGTTTGCCGTGCTGG 0: 1
1: 0
2: 0
3: 7
4: 45
Right 1161011301 19:1960513-1960535 GTCCCCCGTGTGCCTGCGCCTGG 0: 1
1: 0
2: 0
3: 11
4: 128
1161011297_1161011301 16 Left 1161011297 19:1960474-1960496 CCGTGCTGGATCTCACACCCGGC No data
Right 1161011301 19:1960513-1960535 GTCCCCCGTGTGCCTGCGCCTGG 0: 1
1: 0
2: 0
3: 11
4: 128
1161011298_1161011301 -1 Left 1161011298 19:1960491-1960513 CCCGGCTCTGACACGCTGCCGTG 0: 1
1: 0
2: 0
3: 6
4: 121
Right 1161011301 19:1960513-1960535 GTCCCCCGTGTGCCTGCGCCTGG 0: 1
1: 0
2: 0
3: 11
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161011301 Original CRISPR GTCCCCCGTGTGCCTGCGCC TGG Intronic
900354537 1:2253926-2253948 GTCCCCAGAGTGCCTGCTGCTGG + Intronic
900667381 1:3824740-3824762 GTTCCCCCTGTGCCTGTCCCTGG - Intronic
900956254 1:5888002-5888024 CTCCCCCGTTTCCCTGGGCCAGG + Intronic
903330663 1:22595406-22595428 GGTCCCCGTGTGCCTGGGGCTGG + Intronic
906185702 1:43860384-43860406 GTCTCCAGTGGGCCTGCTCCAGG + Intronic
907552245 1:55314354-55314376 GTCCCCTCTGTGCCTGCCACTGG + Intergenic
908675263 1:66596361-66596383 GTCCCCTGTGTGGCTGGGTCTGG + Intronic
912407434 1:109452419-109452441 GTCCCCTGTGTGGCTGGGTCTGG + Intergenic
913453411 1:119007814-119007836 TTGTCCCGTGTGCCTGCGCGGGG - Intergenic
915996769 1:160571707-160571729 GTCCCCAGTGGGCCTGCTCTAGG + Intronic
917521761 1:175753525-175753547 GTCCCCAGTGTGCCAGCCTCGGG - Intergenic
923088554 1:230720792-230720814 GTCCCCCATGTGGCTGGGTCTGG - Intergenic
924815481 1:247437923-247437945 GTCACCTGAGTGCCTACGCCTGG - Intronic
1067003379 10:42638402-42638424 GGCCCCCGGCTGCCTGCTCCTGG + Intronic
1070420592 10:76232829-76232851 GTCCCCTGTGTGTCTGGGCCTGG + Intronic
1070677191 10:78420293-78420315 GTCCCCAGGCTGCCTGCCCCTGG + Intergenic
1074745626 10:116529161-116529183 GTCCCCGGTGTGACTGGGTCTGG - Intergenic
1075095207 10:119466719-119466741 GTCCTCAGTGTTCCTGGGCCAGG + Intergenic
1076875705 10:133214589-133214611 ATCCCCTCTGTGCCTGAGCCTGG + Intronic
1077152205 11:1077432-1077454 GACCCCGATGTGCCTCCGCCAGG + Intergenic
1077323752 11:1954408-1954430 GTCCCCCTGGGCCCTGCGCCAGG + Intronic
1080445713 11:32335202-32335224 TTCCCCCGTGTGGCTGGGTCTGG + Intergenic
1083428398 11:62601393-62601415 GGGCCCCGTATCCCTGCGCCCGG + Intronic
1083628057 11:64082118-64082140 GGCCCTCCTGTGGCTGCGCCTGG + Intronic
1083663879 11:64264476-64264498 GTCCCCCCAGGGCCTGCGGCAGG + Intronic
1083672373 11:64306394-64306416 GCCCGCCGTGTGCCTGGGACCGG + Exonic
1202806740 11_KI270721v1_random:9603-9625 GTCCCCCTGGGCCCTGCGCCAGG + Intergenic
1091690990 12:2597320-2597342 GTCCCCCTTGTGCCAGCACCAGG + Intronic
1094849109 12:34374410-34374432 GTCCTCCGTGTGCATGAACCAGG + Intergenic
1095875859 12:47079744-47079766 GGCCGCCGTGTGCCCGCGCGCGG + Exonic
1097246740 12:57611344-57611366 TTCCCCCTCCTGCCTGCGCCGGG - Intronic
1102504282 12:113374003-113374025 GTGCCCAGTGTGCCTGCCCAAGG + Intronic
1108196574 13:48001298-48001320 GTCGCCTGTGCGCCTGCGCGCGG - Exonic
1111975934 13:94967711-94967733 GGCCGCCGGGTGCCTGCTCCGGG - Intergenic
1113611028 13:111645271-111645293 GTCTCCCGTGTGTCTGTGACAGG + Intronic
1120161001 14:81144161-81144183 GCCCCCGGTATGCCTGAGCCTGG - Exonic
1121530775 14:94651703-94651725 GTCCCCCATGGCCCTGTGCCTGG + Intergenic
1122829971 14:104391128-104391150 CTCCCCAGTGTGCCGGCTCCAGG + Intergenic
1128747647 15:70125647-70125669 GTCTCCCCAGTGCCTGTGCCAGG + Intergenic
1129970685 15:79775417-79775439 GTCCAGCGGGTGCCTGTGCCTGG + Intergenic
1132654452 16:1036074-1036096 GCCTCCTGTGTGCCTGTGCCTGG + Intergenic
1133255059 16:4511664-4511686 GTCCCCCTTGTGGGTGCGCTTGG - Exonic
1136096699 16:27962135-27962157 CTCCCCCGTGTCCCTGTGGCAGG + Intronic
1138195673 16:55050358-55050380 GTCTCCAGTGTACCTGCCCCAGG + Intergenic
1138349465 16:56338792-56338814 GTCCCCAGTGAGCATGAGCCTGG + Intronic
1138496850 16:57414024-57414046 GTCCTCCCGGTGCCTGCCCCTGG - Intronic
1141106999 16:81242127-81242149 GTGCCCTGGGTGCCTGTGCCTGG + Intronic
1141488140 16:84354654-84354676 GTCCCCACTGTGCCTGCACATGG + Intergenic
1142016775 16:87753036-87753058 GTGCCCCTTGTCCCTGCTCCAGG - Intronic
1142154287 16:88526172-88526194 GTCCGCCGTGTGCCGGCCCCGGG + Intronic
1142483135 17:230600-230622 GTCCCCTGTATGCCTGAGCCTGG - Intronic
1142635406 17:1254047-1254069 TTCCTCCCTGCGCCTGCGCCAGG - Intergenic
1142638290 17:1270982-1271004 GTCCCCGGTGTCCCCGCGCGCGG - Exonic
1143016060 17:3891971-3891993 GTCCCCAGAGTGTGTGCGCCTGG + Intronic
1145212006 17:21020840-21020862 GTCCCCCATGGGCCTGCAGCTGG - Intronic
1150387514 17:64773601-64773623 GTCTCCCTGGAGCCTGCGCCTGG - Intergenic
1150414465 17:64975814-64975836 GTTCCCCGTCTGCCCTCGCCGGG + Intergenic
1151155599 17:72121595-72121617 GTTCCCCGTGTGCATCCGCGAGG + Exonic
1152615810 17:81337286-81337308 GCCCCCCGTGCTCCTGCACCTGG + Intergenic
1152662067 17:81547138-81547160 GTCCACTGTGTGCCTGCTCAGGG + Exonic
1160865758 19:1255249-1255271 GTCCCCAGTATGCAGGCGCCTGG - Intronic
1160875702 19:1295396-1295418 GTCCCCCGTGCTCCTGACCCCGG + Intronic
1161010529 19:1957584-1957606 GTCCCCCATGTCCCCTCGCCCGG + Intronic
1161011301 19:1960513-1960535 GTCCCCCGTGTGCCTGCGCCTGG + Intronic
1161809631 19:6464536-6464558 CTCTCCTGTGGGCCTGCGCCGGG + Intronic
1163152754 19:15424751-15424773 GGCCCCCGGGTGCCAGCCCCAGG + Exonic
1164473348 19:28554129-28554151 GTCCCCTGTGTACCTGGGCTTGG + Intergenic
1167041928 19:47027635-47027657 GTCTCCCGTCTGTCTGCCCCTGG + Intronic
1167604902 19:50476443-50476465 GACGCCCGTGCGCCTGCGCTGGG - Exonic
1168290127 19:55353521-55353543 ATCCTCCGTGTGCCTGTGTCCGG - Intronic
925185132 2:1842096-1842118 CCCACCCGTGTGCCAGCGCCGGG - Intronic
925194712 2:1913697-1913719 GACCCCCGTGTGCCATCCCCAGG - Intronic
925867211 2:8238918-8238940 GTCCCCAGTGTGGCTGCACCGGG + Intergenic
926168253 2:10534913-10534935 GCCTCCCGTGTGACTGGGCCAGG + Intergenic
927213257 2:20651322-20651344 GTTCACCGTGTGCCAGGGCCAGG - Intergenic
927809752 2:26174259-26174281 CTCCCCCATGAGCCTGCTCCCGG - Intronic
932611468 2:73203059-73203081 GTCCCCCGCGTGCGGGCGCCGGG - Intronic
935947608 2:108300481-108300503 GACCCCCATGTGCCTGCAGCAGG - Intronic
937978026 2:127593399-127593421 GTTCCCGTTGTGCCTGTGCCTGG + Intronic
939463875 2:142532173-142532195 GACCCCCGTGTGGCTGGGTCCGG - Intergenic
947748872 2:232522776-232522798 GCGCCCCGTGTGCCTGCCCCAGG + Exonic
947792602 2:232876701-232876723 GTGCCCGGTGCGCGTGCGCCGGG + Intronic
1170076967 20:12430036-12430058 GTCCCCCATGTGACTGGGTCTGG - Intergenic
1172317183 20:33965033-33965055 GGTCGTCGTGTGCCTGCGCCTGG + Intergenic
1172843576 20:37916267-37916289 GACGCCTGTGTGCCTGCTCCCGG + Intronic
1175887850 20:62302608-62302630 GTCACTCGTGTGGCTGAGCCAGG - Intronic
1176041440 20:63067962-63067984 GACCCCCGTGTGCCTGAGCACGG + Intergenic
1176077253 20:63254171-63254193 GTCCCCGGTGTGCGTGCGCGGGG - Intronic
1176185951 20:63779124-63779146 AGCCCCCGTGTGGCTGCGTCTGG - Intronic
1176223140 20:63979417-63979439 GCCCCCCGCGTGGCCGCGCCGGG - Exonic
1178859141 21:36274597-36274619 CTCCACCGTGTGTCTGCCCCTGG - Intronic
1181009429 22:20031919-20031941 ATCCCACGTGTGCCTGCTCGGGG + Intronic
1182117554 22:27765923-27765945 GCCCCCGGGGTGCCTGTGCCCGG + Intronic
1183097725 22:35563379-35563401 CACACCCGTCTGCCTGCGCCTGG - Intergenic
1183466644 22:37983562-37983584 GTTCCCCGTGTGCATCCGCGAGG - Exonic
1183675801 22:39298253-39298275 GTACCTTGTGAGCCTGCGCCTGG + Intergenic
1184508099 22:44916464-44916486 GTCAGCCATGTGCCAGCGCCCGG - Exonic
1184691728 22:46120333-46120355 GTCCCCCTGCTGCCTGGGCCAGG + Intergenic
955534098 3:59904808-59904830 TTCCCCTGTGTGGCTGGGCCTGG + Intronic
960616508 3:119600575-119600597 GTGTCCTGTGTGCCTGGGCCTGG - Intronic
963251039 3:143103852-143103874 GTCCCCAGTGTGGCTGGGTCCGG - Intergenic
969528100 4:7714335-7714357 GTCCCGCGTGTGCGAGTGCCGGG + Exonic
970919532 4:21376748-21376770 GTCCCCTGTGTGCCTGGTCTTGG - Intronic
974421593 4:61683489-61683511 GTGCCCCGTGTGTCTGGGTCTGG + Intronic
982370392 4:154627153-154627175 ATCCCCCGGCGGCCTGCGCCAGG + Intronic
985861773 5:2477159-2477181 GTCACCCATGTGCCTGAGACAGG - Intergenic
996117033 5:119630686-119630708 GTCCCCCGCCTGCCTGAGACTGG - Intronic
996453529 5:123655146-123655168 GTCCCCAGTGTGCCAGGCCCAGG + Intergenic
999248364 5:150167209-150167231 GGCCCCCGAGGGGCTGCGCCAGG - Exonic
1002789185 6:425132-425154 CTCCCTGGTGTGCCTCCGCCAGG + Intergenic
1003182811 6:3806567-3806589 GTCCCCTGTGTGCCTTCCCAGGG - Intergenic
1006540617 6:34737008-34737030 GTCCCCTGTGTGGCTGGGTCTGG - Intergenic
1008932457 6:56954892-56954914 GTCCCCGGCGGGGCTGCGCCCGG - Intergenic
1010490188 6:76466497-76466519 GTCCCCCATGTGGCTGGGTCTGG - Intergenic
1012472667 6:99589190-99589212 TTCCCTCGCGTGCCCGCGCCGGG + Intergenic
1015924147 6:138292658-138292680 GTCCTCCCTGTGCCCGTGCCGGG - Intronic
1017801484 6:157900088-157900110 GTTCCCCGTCTCCCTGCCCCTGG + Intronic
1019682891 7:2362492-2362514 GTCCCCCGTGTGACTGCCTTAGG + Intronic
1028987325 7:97018531-97018553 GCCCGCGGTGTGCCAGCGCCTGG - Intergenic
1029167132 7:98600325-98600347 GTGCCTTGTGTGCCTGTGCCTGG + Intergenic
1031791307 7:126108345-126108367 GTTCCCTGTGTGGCTGGGCCTGG - Intergenic
1032240074 7:130153478-130153500 GTTCCCCGGGTACCAGCGCCAGG - Intergenic
1032454840 7:132065489-132065511 GTCTTCCCTGTGCCTGCTCCTGG + Intergenic
1035168640 7:157005936-157005958 GTCCCCCGGCCGCGTGCGCCTGG + Intronic
1035593392 8:835547-835569 GTCCCCCGTGCTCCTGTGTCCGG + Intergenic
1035683220 8:1503954-1503976 GGTCACCGTGTGCCTGCACCTGG - Intronic
1035743325 8:1944905-1944927 GTCCCACGGGTGCCTGGGCCTGG - Intronic
1043390015 8:79783607-79783629 CTGCCCCGTGCGCATGCGCCTGG - Intergenic
1044091739 8:88010781-88010803 GTCCCCCATGTGGCTGGGTCTGG + Intergenic
1048857970 8:138700066-138700088 GTGCCCAGTGTGCCTCGGCCTGG - Intronic
1049241027 8:141537415-141537437 GTCCTCCTCGTGCCCGCGCCTGG + Intergenic
1049850292 8:144827053-144827075 CTCCCCCGCGTCCCTGCGACAGG - Intergenic
1052520559 9:29543126-29543148 ATCCCCTGTGTTCCTGCCCCTGG + Intergenic
1053150873 9:35741869-35741891 GTTCACAGTGTGCCTGCGTCGGG - Exonic
1053358217 9:37464998-37465020 GTCCCCGGTGTCCCGACGCCAGG - Intronic
1059426716 9:114225802-114225824 GTCCCCCGGGTCCCTGCAGCCGG + Intronic
1061882269 9:133574323-133574345 GCCCCCTGTGTGCCAGCCCCTGG - Intronic
1062029368 9:134355245-134355267 GTACCTAGTGTGCCTGGGCCCGG + Intronic
1062118164 9:134820276-134820298 GTCCCCTGGGTGCCTGCCCCAGG - Intronic
1062428817 9:136517937-136517959 CTCACCCGTGTGCCCTCGCCAGG - Exonic