ID: 1161011316

View in Genome Browser
Species Human (GRCh38)
Location 19:1960590-1960612
Sequence GGAAAATCTAATAGTAGTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 172}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161011310_1161011316 26 Left 1161011310 19:1960541-1960563 CCGTGTGTGTGTCTGTGTACACG 0: 1
1: 2
2: 10
3: 127
4: 797
Right 1161011316 19:1960590-1960612 GGAAAATCTAATAGTAGTCAGGG 0: 1
1: 0
2: 1
3: 14
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161011316 Original CRISPR GGAAAATCTAATAGTAGTCA GGG Intronic
905891120 1:41519030-41519052 GGCAAATTTAATATTAGGCATGG + Intronic
908818158 1:68055201-68055223 GGAAAATTAAATAGATGTCAAGG - Intergenic
910884141 1:91948281-91948303 GAAAAATCTGAAAGAAGTCAAGG - Intergenic
910989944 1:93045354-93045376 AGAAATTTTAATAGTAGCCAAGG + Intergenic
912892930 1:113554522-113554544 GGTAAATCTAGTACTAGTTATGG - Intronic
918430978 1:184460440-184460462 GAAAAATCTATTAGTATTGATGG - Intronic
918809364 1:189095247-189095269 GCAACATTTAATAGTAATCATGG + Intergenic
1063800847 10:9575685-9575707 GGAAAAAGTTATATTAGTCAGGG - Intergenic
1063822226 10:9849696-9849718 GGAAAATCTAATAATTGTTATGG - Intergenic
1065914523 10:30342463-30342485 GGCAGTTTTAATAGTAGTCATGG - Intronic
1068804138 10:61175605-61175627 GAAAAAGCTATTAGTAGGCAGGG + Intergenic
1069094585 10:64243334-64243356 GGAAAATATATTAGTCATCAGGG - Intergenic
1069652900 10:70063992-70064014 GGAAACTCTTCTAGTAGTAAAGG - Intronic
1070446795 10:76512994-76513016 GGAAAGTGTACCAGTAGTCAAGG + Intronic
1073007201 10:100333670-100333692 GAAAAATCTAAAAGAAGTCTGGG - Intergenic
1073027960 10:100502121-100502143 GGAAAAACTAATGGGAGTTAAGG + Intronic
1074587851 10:114786182-114786204 GGAAAATCCAAGAGTATTTATGG + Intergenic
1075341550 10:121650294-121650316 GAAAAATAAAATAGTAGACAAGG - Intergenic
1080148018 11:29012074-29012096 AAAAAATCTAATAGTAATAAAGG - Intergenic
1081278497 11:41180069-41180091 GGAAAATCTAATAGTTGAGTAGG + Intronic
1082902350 11:58268540-58268562 AGAAAAACCAATAGTAGACAGGG - Intergenic
1083762368 11:64825674-64825696 GGAAAACCTAAGAGAAGCCAGGG - Intronic
1084567008 11:69935642-69935664 AGAAAATCTAAGAGTAGGCTAGG + Intergenic
1085660304 11:78358578-78358600 TGAAGATCTAAAAGTAGTCCAGG + Intronic
1087042154 11:93812050-93812072 GGAAAAAATCATAGTAGACAAGG - Exonic
1090330257 11:125925958-125925980 GGAAAATCTTAGAGGAGTGATGG + Intergenic
1094771604 12:33668924-33668946 TTAAAATATAAGAGTAGTCAAGG - Intergenic
1095161824 12:38926764-38926786 GGAAAATACAACAGTTGTCATGG + Intergenic
1095855507 12:46856122-46856144 GGAAAAACTTTTAGTACTCATGG - Intergenic
1095909539 12:47412078-47412100 AGAAAAACTGAAAGTAGTCAGGG + Intergenic
1097121002 12:56732320-56732342 GGAAAATGTTATAGAAGCCAGGG - Intronic
1098033817 12:66281870-66281892 GGAAAAGGTCATAGAAGTCAAGG - Intergenic
1098072287 12:66688884-66688906 GGAAAAGATAAAAGAAGTCAGGG + Intronic
1099333155 12:81317647-81317669 AGAAAATGTAATAGGAGTTAGGG - Intronic
1101458632 12:104864900-104864922 GGAAAAAAAAATAGTACTCAAGG - Intronic
1101609013 12:106273506-106273528 AGAAAATATAATAGTAAACAAGG - Intronic
1101712935 12:107285511-107285533 AGACAGTCTAATAGTAGTTAAGG - Intergenic
1104163372 12:126202463-126202485 TGAAAGTCTAATGGTATTCATGG + Intergenic
1105645989 13:22317906-22317928 GGAAGATTTAATAGTGGTGATGG - Intergenic
1106001173 13:25724724-25724746 GGAATATCTTATGGTAGGCATGG + Intronic
1106058869 13:26265940-26265962 GGAGAATGTAATAGTAATCCAGG + Intronic
1106608846 13:31258473-31258495 GGAGGATCTAATAATGGTCAAGG - Intronic
1107445235 13:40464856-40464878 GGAAAATCTCATCATAGACAGGG - Intergenic
1107510983 13:41084706-41084728 GGAAAACCCCATAGTGGTCATGG - Intergenic
1109987414 13:70007596-70007618 GGAAATGCTAAAAATAGTCATGG + Intronic
1110793990 13:79616390-79616412 GAAAAATATAATAGTAGGTAAGG - Intergenic
1111371277 13:87320843-87320865 CAAAAATCTCATAGAAGTCAAGG + Intergenic
1111402950 13:87764958-87764980 AAAAAATATAATAGTATTCATGG + Intergenic
1113157599 13:107341526-107341548 GGCAAAAATAATAGTACTCATGG + Intronic
1120621572 14:86771973-86771995 GGAGAAACTACTAGTAGTCCAGG + Intergenic
1122200836 14:100121630-100121652 GGAAAGTCTAATAGGAGCCCTGG - Intronic
1123697149 15:22886918-22886940 GGAAAGACTAATAGAAGTAAAGG - Intronic
1124936869 15:34181019-34181041 GGAAAATCAAATAATTGTTATGG - Intronic
1125374248 15:39011894-39011916 TAAAAATCTAGAAGTAGTCAGGG + Intergenic
1126082801 15:44982312-44982334 GGAAAATCAAATAGCAGGCTGGG - Intergenic
1126214598 15:46140382-46140404 GCAATATCTAAAAGTTGTCATGG + Intergenic
1126492178 15:49249553-49249575 GGAAAATAAATTAGTAGTCAGGG + Intronic
1127024409 15:54787336-54787358 GGAAAATATTCTAGTAGTCAAGG + Intergenic
1130970434 15:88727957-88727979 GGAAAATCTGATAATAATGAGGG + Intergenic
1131353425 15:91722279-91722301 CTAAAATCCAATAGTGGTCAGGG + Intergenic
1133571557 16:7045464-7045486 GCAAAATCCAACAGTAGCCAAGG - Intronic
1137939729 16:52672300-52672322 GGTAATTTTAATACTAGTCAGGG + Intergenic
1144114334 17:12072011-12072033 GAAGAATCAAATAGTAGGCAAGG + Intronic
1145771803 17:27498674-27498696 GGAAATTCTAATGGCAGCCAGGG - Intronic
1149596731 17:57868628-57868650 GGAAAATCTCGGATTAGTCATGG - Intronic
1150953413 17:69827384-69827406 GGAAAATCTATTGGAAGTCTTGG + Intergenic
1153957426 18:10109807-10109829 GCAAAATCTCATAATAGTCAAGG - Intergenic
1157014645 18:43697472-43697494 TGAAAATTTAATAGCAGCCAAGG + Intergenic
1161011316 19:1960590-1960612 GGAAAATCTAATAGTAGTCAGGG + Intronic
1167007011 19:46782696-46782718 GGGAAATATATTAGTCGTCAGGG + Intronic
930350120 2:50241456-50241478 AGTAAATCCATTAGTAGTCATGG - Intronic
930933870 2:56922470-56922492 AGAAAATGTAATAGTGGTGAAGG + Intergenic
931080914 2:58769446-58769468 AGGAAATATAATAGTAGGCATGG - Intergenic
931217306 2:60258326-60258348 TTAAACTTTAATAGTAGTCATGG + Intergenic
931915756 2:66953760-66953782 GGTAAAAATAGTAGTAGTCATGG + Intergenic
936234134 2:110729167-110729189 GGAAAATAATATAGTGGTCAAGG + Intergenic
937683307 2:124667772-124667794 TGAAAATCTAATGGTAGCAATGG + Intronic
938597544 2:132803308-132803330 GGCAAGTCTAAAAGTTGTCAGGG - Intronic
938725440 2:134104677-134104699 TGAAGTTCTAGTAGTAGTCATGG - Intergenic
939366991 2:141246583-141246605 GGAAACTATCATAGTAGTCCAGG + Intronic
939530852 2:143359805-143359827 TGTAAATATAATTGTAGTCAAGG - Intronic
940960340 2:159778495-159778517 TGTAAAACTAACAGTAGTCAAGG + Intronic
944084016 2:195823101-195823123 GGAATATCCAGTAGTAGTTAAGG - Intronic
945014732 2:205503089-205503111 TTAAAATGTAATAGGAGTCAGGG - Intronic
947521769 2:230851165-230851187 GGAAAGTCTAATTATGGTCAAGG + Intergenic
1170026804 20:11897726-11897748 GGAAAATCAAAGAGAAGCCAGGG - Intronic
1170303199 20:14908711-14908733 GGAGAATCTATTAGAAGGCATGG + Intronic
1170376228 20:15703265-15703287 GGAAGATATAGTAGTGGTCATGG - Intronic
1170641732 20:18160235-18160257 AGAAAATCAAATAGTACTTAAGG + Intronic
1177498192 21:21916212-21916234 GGAATAACTAAGAGTTGTCAAGG + Intergenic
1177554324 21:22670403-22670425 AGAAAATCTAATAGGAGAGAAGG + Intergenic
1178179980 21:30148677-30148699 GGAAAAGCTGATAGAACTCAAGG - Intergenic
1179165207 21:38930199-38930221 GGAAAACCTAATGGTAGATAAGG + Intergenic
1181394791 22:22613418-22613440 GGAAATTCTGATAAAAGTCATGG - Intergenic
1182265514 22:29111809-29111831 AGAAAACATAATAATAGTCAGGG + Intronic
1183541832 22:38433873-38433895 GGAAAACCTAAAAGTTGACAGGG - Intronic
1184375680 22:44111031-44111053 GAAAAATCCAATAGAAGGCAGGG + Intronic
1184705796 22:46212350-46212372 TGAAAATCTAACAGTGGTCTGGG - Intronic
951114275 3:18841434-18841456 GAAAATGCTAATAGTAGTCATGG + Intergenic
951264395 3:20549011-20549033 AGAAAATCTGATAGTATACATGG + Intergenic
952847095 3:37697012-37697034 GGAAAATCTCAAAATGGTCAGGG + Intronic
953285890 3:41608819-41608841 GGAAAATGAAATAGTAGGAAGGG - Intronic
953551328 3:43906118-43906140 TGATAATATAATAGTAGTTATGG + Intergenic
955949657 3:64229668-64229690 GGAAATTCTAATTGTTGTAAGGG + Intronic
956159794 3:66337871-66337893 AAAAAATATAATAGTAGTCAAGG - Intronic
957938152 3:86970067-86970089 GGAAATTCAAGTAGAAGTCATGG + Intronic
958663822 3:97107705-97107727 GTAAATTCTAATAGAAGACATGG - Intronic
958830359 3:99080279-99080301 GGAAATTCTTAGAGTAGTCTAGG + Intergenic
959922856 3:111888320-111888342 GGAAAACCTAAAAGTAGTTCAGG + Intronic
960172505 3:114478496-114478518 GGAAAAACTAATAGCTATCATGG + Intronic
960206154 3:114901954-114901976 GGAAAAAATAATAGTAGGTAGGG + Intronic
963145158 3:141986390-141986412 GAAAACTATAATAGAAGTCATGG - Intronic
963160625 3:142148273-142148295 GGAAAAGATAAAAGTATTCATGG + Intronic
963372287 3:144416041-144416063 GAAATATCTAATAGTATTCAAGG - Intergenic
963431169 3:145205582-145205604 GAATAAACAAATAGTAGTCAAGG - Intergenic
965828655 3:172757051-172757073 TGAAAATGTATTTGTAGTCACGG + Exonic
974195727 4:58572103-58572125 GGAAAATAAAATAGTTGTAAAGG + Intergenic
974921527 4:68246734-68246756 GGAAAATTTAATAGTTGCAATGG - Intergenic
975324981 4:73049425-73049447 GGAAAAACAAATAGCAGGCAAGG - Intergenic
976743552 4:88381460-88381482 GGAAAATCTAATGGAAGATAAGG + Intronic
977017677 4:91713387-91713409 AGAAAATTTAAAAATAGTCAAGG + Intergenic
977749355 4:100590121-100590143 GGAAATTTTAATCCTAGTCAAGG - Intronic
979144348 4:117222376-117222398 GGACAATGTAATATTAGTGAAGG - Intergenic
979817308 4:125125738-125125760 TGAAAATGAAAAAGTAGTCAAGG + Intergenic
980294340 4:130891348-130891370 GGAAAATATAAAATCAGTCATGG + Intergenic
980581136 4:134752857-134752879 TGAAAATCTAATGGTAATGAGGG + Intergenic
981073376 4:140568359-140568381 GGAGAATTTGGTAGTAGTCATGG + Intronic
981123932 4:141084197-141084219 GGAAAATGTAATAGTACTCAAGG - Intronic
981746449 4:148056878-148056900 GAAATATGTAATAGTAGTGAGGG + Intronic
983395163 4:167184879-167184901 GGTAAGTCTAGTAGTAGTGAAGG + Intronic
983721240 4:170854529-170854551 GGAAAATTTAATAAAAGGCAAGG - Intergenic
985512650 5:321265-321287 CGAAAATGTAAAAGGAGTCATGG - Intronic
986093431 5:4533666-4533688 GGAAATTCCCATAGTAGTCTGGG - Intergenic
989505407 5:42221125-42221147 CTAGATTCTAATAGTAGTCATGG - Intergenic
995376620 5:111481333-111481355 TAAAAATCTGATAGTAGTCATGG - Intronic
996691103 5:126340942-126340964 AGAAAATCTAAAAGAAGTTATGG + Intergenic
997386838 5:133480353-133480375 AGAAACTCAAATAGTAGTAATGG - Intronic
997391688 5:133522303-133522325 GGGAAATTTAATAGGAGTCATGG - Intronic
1000198572 5:158985481-158985503 GGAAATTCTAATATAAGTCCAGG + Intronic
1004831468 6:19481581-19481603 GTAAAATGTAATAGTAGGCAGGG + Intergenic
1005272910 6:24185293-24185315 GGAAAGTCTAATAGAAATAATGG - Intronic
1005284589 6:24311823-24311845 AGAATATTTGATAGTAGTCAAGG - Intronic
1009302517 6:62043612-62043634 GTAAAATATAATAATATTCAAGG - Intronic
1010292857 6:74159637-74159659 GGAAAAACAATTAGTAATCATGG + Intergenic
1010415406 6:75605863-75605885 GGATAATATTGTAGTAGTCAAGG + Intronic
1011575407 6:88791863-88791885 GAAAAATATAATAATAGTTATGG - Intronic
1012811120 6:103959588-103959610 GTAAAGTATAATAGTAGTAATGG + Intergenic
1013436442 6:110114640-110114662 GGAAAATTTAATGGCAGTAAAGG + Intronic
1014825022 6:126040032-126040054 GGGAAATCTAAAAGTATTCAAGG + Intergenic
1015881049 6:137870083-137870105 TGAAAATCTAGAAGTAGACAAGG - Intronic
1015991748 6:138952123-138952145 GTAAAATAAAATAGTAGTTAAGG + Intronic
1016659359 6:146558311-146558333 GGAATAAATAATAGTTGTCAGGG + Intergenic
1018152315 6:160951745-160951767 GGAGACTCTTCTAGTAGTCAAGG + Intergenic
1018878044 6:167843334-167843356 GGGAAATCTACTAAAAGTCAAGG + Intronic
1023319557 7:38978579-38978601 GGTAAATGTAGTAGTAGTCTTGG + Intronic
1025872843 7:65450952-65450974 GAAAAACACAATAGTAGTCATGG - Intergenic
1027519882 7:79192918-79192940 GGAAGCTCTTATAGTAGTCTGGG + Intronic
1028633684 7:92963347-92963369 GGAAAAACTAGGAGTAGTGACGG - Intergenic
1030935322 7:115578735-115578757 GGAAAATATGATAGTAGCCTAGG - Intergenic
1031297570 7:120022228-120022250 GGAAAATAAAGTAGCAGTCATGG + Intergenic
1031828592 7:126598284-126598306 GGGCAATCTACTAGTATTCAGGG - Intronic
1031960443 7:127984784-127984806 TGAAAATCTAATAGGAGCCTAGG + Intronic
1032276613 7:130462075-130462097 TGAATATTTAATAGAAGTCAGGG + Intergenic
1035435682 7:158857445-158857467 GGAAAAAATAATAGGAGTGAAGG - Intronic
1037060238 8:14499157-14499179 GAAAAATCTAATTATAGCCATGG + Intronic
1040581824 8:48704561-48704583 AGAAAATCAAATAGCAGTCTGGG - Intergenic
1040883912 8:52238822-52238844 GGAAAGTTTAATAATAGACATGG + Intronic
1041123696 8:54612860-54612882 AAGAAATCTAAAAGTAGTCAGGG - Intergenic
1041856412 8:62460483-62460505 GTAAAGTCTTATAGAAGTCAAGG + Intronic
1042377980 8:68077681-68077703 GAAAAATAGGATAGTAGTCATGG - Intronic
1044568432 8:93691055-93691077 GGAAAGTATAAAAGTAGACATGG + Intergenic
1050050207 9:1592134-1592156 GGAAAATCTGAGAGTAGACAAGG - Intergenic
1051119854 9:13740459-13740481 AGAAAATTAAAAAGTAGTCAAGG + Intergenic
1051391382 9:16568179-16568201 GGAAATTCAAATAGTAGTCTAGG - Intronic
1053082649 9:35190340-35190362 GGAATGGCTAATAGTAGTTATGG - Intronic
1055021369 9:71674026-71674048 GGAAACTCTATTAGTATTCAGGG - Intergenic
1187689362 X:21849169-21849191 GTCAAATCTATTAGTATTCATGG - Intronic
1188324893 X:28789171-28789193 GGAAAATATAATAGAAATCCTGG + Intronic
1192349085 X:70340834-70340856 GGAAAAATGAATAGTTGTCAAGG - Intronic
1193625207 X:83811609-83811631 AGAAAATTTAAGAGTAGGCAAGG - Intergenic
1194754017 X:97715740-97715762 GGAAGACCTAATAATATTCAGGG + Intergenic
1195497757 X:105557353-105557375 GGAGAATCTAAAAGAAGTAATGG + Intronic
1196755889 X:119156650-119156672 GAAAATTCTAATGGTAGACAAGG + Intergenic
1197400611 X:125984524-125984546 GGAAAATATAATAGTACCAAAGG + Intergenic
1197538995 X:127730509-127730531 AGAAAATCTAATTGCAGGCAGGG - Intergenic
1198160341 X:134001800-134001822 GGAGAAAACAATAGTAGTCATGG + Intergenic
1198769818 X:140118503-140118525 GGAAAATTTAAACGTAGACAGGG - Intergenic
1199180443 X:144848095-144848117 GGAAACACTAAAAGTAATCAAGG + Intergenic