ID: 1161011810

View in Genome Browser
Species Human (GRCh38)
Location 19:1963081-1963103
Sequence CACGGCATGTCCTCTGTGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 3, 3: 11, 4: 120}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161011810_1161011813 6 Left 1161011810 19:1963081-1963103 CCAGACACAGAGGACATGCCGTG 0: 1
1: 0
2: 3
3: 11
4: 120
Right 1161011813 19:1963110-1963132 CCCATTTCTATGAAATGTCCAGG 0: 13
1: 32
2: 38
3: 134
4: 324
1161011810_1161011815 7 Left 1161011810 19:1963081-1963103 CCAGACACAGAGGACATGCCGTG 0: 1
1: 0
2: 3
3: 11
4: 120
Right 1161011815 19:1963111-1963133 CCATTTCTATGAAATGTCCAGGG 0: 2
1: 3
2: 7
3: 46
4: 274
1161011810_1161011819 30 Left 1161011810 19:1963081-1963103 CCAGACACAGAGGACATGCCGTG 0: 1
1: 0
2: 3
3: 11
4: 120
Right 1161011819 19:1963134-1963156 CAGGCCCAGCCACAGAGACAGGG 0: 1
1: 5
2: 7
3: 56
4: 511
1161011810_1161011816 11 Left 1161011810 19:1963081-1963103 CCAGACACAGAGGACATGCCGTG 0: 1
1: 0
2: 3
3: 11
4: 120
Right 1161011816 19:1963115-1963137 TTCTATGAAATGTCCAGGGCAGG 0: 2
1: 14
2: 46
3: 305
4: 1237
1161011810_1161011818 29 Left 1161011810 19:1963081-1963103 CCAGACACAGAGGACATGCCGTG 0: 1
1: 0
2: 3
3: 11
4: 120
Right 1161011818 19:1963133-1963155 GCAGGCCCAGCCACAGAGACAGG 0: 1
1: 0
2: 11
3: 77
4: 431

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161011810 Original CRISPR CACGGCATGTCCTCTGTGTC TGG (reversed) Intronic
900457585 1:2785044-2785066 CAGGGCATGCTCTCTGTGCCAGG + Intronic
903818995 1:26086683-26086705 CCCAGCATGTTCTCTGTGCCGGG - Intergenic
905204805 1:36337336-36337358 CACCGCACGGCCTCTGTGTAAGG - Intergenic
907920194 1:58904310-58904332 CACGGGACATCCTCTGTGTGGGG + Intergenic
907966062 1:59331026-59331048 CAGGATATGTTCTCTGTGTCTGG + Intronic
915338190 1:155160289-155160311 CCCTGCATGTCCCCTGTGCCAGG - Intergenic
916888600 1:169095074-169095096 CATGCTATTTCCTCTGTGTCTGG - Intergenic
922999869 1:229998317-229998339 TATGGCATTTACTCTGTGTCAGG - Intergenic
1067714574 10:48679781-48679803 CAGAGCATCTCCTCTGTGCCAGG - Intergenic
1070779085 10:79127166-79127188 CATGGCATTTCCTCTGCATCAGG - Intronic
1070986358 10:80693237-80693259 CACAGCATGTCCTGTGAGGCTGG + Intergenic
1072696436 10:97607219-97607241 CACTGCATTGCCTGTGTGTCTGG + Intronic
1073351496 10:102823055-102823077 CACTGCACGGCCTCTGTGACTGG + Intergenic
1074782662 10:116813075-116813097 CAGGGCATCTCCCCTGTGGCAGG - Intergenic
1076010814 10:126986540-126986562 CTGGGCATGTGCTCTGGGTCAGG - Intronic
1076603491 10:131674443-131674465 CTAGGCTTGTCCTCTGTGCCAGG - Intergenic
1077709052 11:4517506-4517528 CCTGACATGTCCTCTGTCTCAGG + Intergenic
1077948629 11:6929789-6929811 CACAGCATTTCCTCTTTGGCAGG + Intronic
1077976278 11:7251920-7251942 CACCGCCTCTCCTCGGTGTCTGG + Intronic
1080448455 11:32358795-32358817 CAGGGCTTGTTCTCTGTTTCTGG - Intergenic
1081933631 11:46889689-46889711 CAGGGCATCTCCTCTGTGCCGGG - Intronic
1083058421 11:59845372-59845394 CACAGCATGAACTCTGGGTCTGG + Exonic
1090422071 11:126582231-126582253 CATGGCCTGTCCTCTCAGTCAGG + Intronic
1090761835 11:129844192-129844214 CACAGCATTTTTTCTGTGTCTGG - Intronic
1093213470 12:16334974-16334996 CAGGGCTTGTCCTCAATGTCTGG - Intergenic
1094640797 12:32273449-32273471 CACTGGATGTGCTCTGTGTTTGG + Intronic
1100014210 12:89989228-89989250 CACAGCATGTCCTGTGGGACTGG + Intergenic
1100235331 12:92655003-92655025 CAGGGCTTGTCATCTGTTTCTGG - Intergenic
1101008408 12:100425406-100425428 CAAGGCATGTACTGTGTGGCTGG - Intergenic
1102149257 12:110677498-110677520 CACAGCATGACCTCTGTGCCTGG + Intronic
1104782876 12:131432942-131432964 CGCGTCCTCTCCTCTGTGTCCGG + Intergenic
1106584119 13:31042655-31042677 CGACACATGTCCTCTGTGTCAGG - Intergenic
1111634594 13:90887708-90887730 CACATCATGTTCTCTGTGTCAGG - Intergenic
1118861522 14:69668024-69668046 CATGGCTTGTCCTCTGTGTGAGG + Intronic
1122151039 14:99726384-99726406 CACAGCCAGTCCTCTGGGTCTGG - Intronic
1122987891 14:105221044-105221066 CAGGGCCTGGCCTCTGTGTGAGG - Intronic
1124394595 15:29290305-29290327 CACGGGTTGTCCTCTCTGCCTGG + Intronic
1125547124 15:40513956-40513978 CACAGCATGTCCTCAGTGATGGG - Intergenic
1126148399 15:45499611-45499633 AATGGCATTTCCTCTTTGTCTGG + Intronic
1128575415 15:68771072-68771094 CACTGCAAGTGCTCTGTGGCTGG + Intergenic
1128886198 15:71290225-71290247 CACAGCAGGTCCTCTGTTCCTGG + Intronic
1130905824 15:88240375-88240397 CACAGAATGTCCCCTGCGTCAGG - Intronic
1131627216 15:94134021-94134043 CAGGGCCTGCCTTCTGTGTCAGG - Intergenic
1132924293 16:2420322-2420344 CACAGCATATGATCTGTGTCTGG - Intergenic
1133001544 16:2853902-2853924 CACAGCATGTCCTCAGTGATGGG + Exonic
1135848009 16:25936646-25936668 CACAGCATTTTCTCTGTGTCAGG + Intronic
1136748654 16:32614137-32614159 CCCAGCTTGTTCTCTGTGTCAGG + Intergenic
1139656162 16:68388320-68388342 CCCGGCCTGTCCTCTGTCCCTGG + Intronic
1141927883 16:87181238-87181260 CACTGCATGGCCTTTGTGACTGG - Intronic
1142172412 16:88629839-88629861 CCCTGCCTGTTCTCTGTGTCTGG - Intronic
1203050787 16_KI270728v1_random:873351-873373 CCCAGCTTGTTCTCTGTGTCAGG + Intergenic
1144946264 17:18971138-18971160 CACGGCAGGTCCCCTGTGTGGGG - Exonic
1145016464 17:19401821-19401843 CACGTGCTGTCCCCTGTGTCTGG + Intergenic
1145266099 17:21380259-21380281 CACAGCAAGGCCTCTGTGGCTGG - Intronic
1147161192 17:38570319-38570341 CACCTCTTGTCCTCTGTGACTGG - Intronic
1148355680 17:46974137-46974159 CACATCCTGTCCTCTGAGTCGGG - Intronic
1149035747 17:52132843-52132865 CACGAGATGTCACCTGTGTCTGG - Intronic
1151992704 17:77587835-77587857 CATTGCTTTTCCTCTGTGTCTGG + Intergenic
1152245892 17:79184343-79184365 CACGTCAAGTCCAGTGTGTCTGG - Intronic
1154132472 18:11749529-11749551 CAGCGCATCTCCTCTGGGTCAGG + Intronic
1157213700 18:45764542-45764564 TACAGCATGTCCTGTTTGTCAGG - Intergenic
1158165443 18:54534583-54534605 CACGGAATTTCTTCTGTGACTGG + Intergenic
1161011810 19:1963081-1963103 CACGGCATGTCCTCTGTGTCTGG - Intronic
1161113718 19:2484933-2484955 CAGGGCACGACCTCTGTGGCTGG + Intergenic
1161683936 19:5693989-5694011 CTGGGCGTGTCCTCTGTGGCTGG - Intronic
1162066480 19:8128718-8128740 CACGGCATGTGCAGCGTGTCTGG + Intronic
1163005787 19:14396009-14396031 CACGGCATGTCCCCTGCATTTGG + Intronic
1168136421 19:54355336-54355358 CCCGGGCTGTCCTCTGTGTGAGG + Exonic
926881238 2:17545933-17545955 CACAGCAGGTCGTCTGTGTTAGG - Intronic
930965444 2:57318397-57318419 CACGGCATGGCATATGTGTCAGG + Intergenic
932226287 2:70043643-70043665 CAGGGCATTTCCTTTGTGGCTGG - Intergenic
933170218 2:79116705-79116727 CATTGCATGCTCTCTGTGTCAGG - Intergenic
934727251 2:96631365-96631387 AACGGCATGTCATCTTTGCCAGG - Exonic
935127382 2:100236253-100236275 CACGGCATTCCCTCTGTATGTGG - Intergenic
937091714 2:119210943-119210965 CAGGGCAGCTCCTCTGTGCCAGG - Intergenic
937326703 2:120993730-120993752 CGAGCCATCTCCTCTGTGTCAGG + Intergenic
938401395 2:130994954-130994976 CACAGCATTTTATCTGTGTCTGG + Intronic
948869277 2:240790145-240790167 GACTGCATGTCCTCAGTGGCCGG + Intronic
1171289450 20:23973270-23973292 TGGGGCATGTCCTGTGTGTCGGG - Intergenic
1171545503 20:25997628-25997650 CACGGCAACTCCTCAGCGTCTGG - Intergenic
1174823155 20:53744825-53744847 CACAGCATGTACTCAGTGACTGG - Intergenic
1176028324 20:62997727-62997749 GACGGCCTGTCCTCAGTGTGGGG - Intergenic
1181898310 22:26130649-26130671 CACTGCATGTCCTTTGTGACTGG + Intergenic
1182352950 22:29709143-29709165 CACGGCATGGCTTTGGTGTCTGG + Intergenic
1182800842 22:33031023-33031045 CAGGGCCTGTTCTCTGTGCCTGG - Intronic
1183108908 22:35634164-35634186 GAGGGCGTGTCCTTTGTGTCAGG - Intronic
1183269238 22:36850330-36850352 CACCGCTTCTCCTCTGTGACTGG - Intergenic
1185217680 22:49611451-49611473 CACAGCATGTCCTCTGTGTTTGG + Intronic
953641620 3:44712955-44712977 CTAGGCATCTCCTCTGTGCCGGG - Intronic
955468901 3:59265459-59265481 CATGTCATGTCCTGTGTGTATGG + Intergenic
956816728 3:72914801-72914823 CAGGGCATGACCCCTGAGTCTGG + Intronic
963429264 3:145176655-145176677 CCAGGCATTTCCTCTGTCTCTGG - Intergenic
964372237 3:156012480-156012502 CACTGCACATTCTCTGTGTCAGG - Intergenic
967051763 3:185791518-185791540 CTGGGCGTGTCCTCTGTGCCAGG + Intronic
985628811 5:1004527-1004549 CGAGGCATGTCCGCTGTGTGAGG - Intergenic
986014451 5:3745985-3746007 AATGGCCGGTCCTCTGTGTCAGG + Intergenic
989215909 5:38904404-38904426 CGCGCCATGTACTCTGTGGCAGG - Exonic
997444153 5:133929222-133929244 CAGTGCATATCCTCTGTGTGAGG - Intergenic
1000870685 5:166573404-166573426 GACGGCATGTCTCCTCTGTCAGG - Intergenic
1001308688 5:170595037-170595059 CACACCATTTCCTCTGTGGCAGG + Intronic
1001433237 5:171680016-171680038 CACTGCAGGACTTCTGTGTCAGG + Intergenic
1001570868 5:172729773-172729795 GAGGGAGTGTCCTCTGTGTCAGG - Intergenic
1001990526 5:176112513-176112535 CCCAGCTTGTTCTCTGTGTCAGG + Intronic
1002433191 5:179216127-179216149 CAGGCCATGTCTTCTGTGTTGGG - Intronic
1002592215 5:180298775-180298797 CAGGCCATGTCTTCTGTGTTGGG - Intergenic
1007481230 6:42151443-42151465 CACAGCATCTCCTCTGTGTCAGG + Intergenic
1007728744 6:43932990-43933012 CTCGGCATTTCCTCTGTGTGGGG + Intergenic
1015121796 6:129708317-129708339 CACGGCAAGTGCCCTGTGTGGGG - Intronic
1018090239 6:160340373-160340395 CACGGAATGGGCTCTGTGCCAGG - Intergenic
1019103312 6:169649623-169649645 TAAGGCATGTCATCAGTGTCAGG - Intronic
1021856189 7:24858857-24858879 CAGGACATTTCCTCTGTGTAGGG + Intronic
1025020500 7:55476163-55476185 CTTGGCATGTCATCTGTCTCTGG + Intronic
1025296909 7:57782682-57782704 CACGGCAACTCCTCAGCGTCTGG - Intergenic
1028874167 7:95801952-95801974 CAGGGCATTTCCTCTCTGGCTGG + Intronic
1030134315 7:106232024-106232046 CACAGCATGAGCTCTGTGTCAGG - Intergenic
1030828538 7:114191349-114191371 CAGGGCATGTCCTCTCTCTTGGG - Intronic
1033445365 7:141416820-141416842 CTCGTTATGTACTCTGTGTCTGG - Intronic
1035040943 7:155926722-155926744 ACTGGCAGGTCCTCTGTGTCTGG + Intergenic
1035336730 7:158134059-158134081 CACGGAATGTCCTCTCTGTCAGG - Exonic
1036910061 8:12750920-12750942 CTGGGCATTTACTCTGTGTCAGG + Intronic
1038671017 8:29583082-29583104 CATGGCCTTCCCTCTGTGTCTGG - Intergenic
1039257370 8:35734156-35734178 CATGCCATGGCCTTTGTGTCAGG - Intronic
1049427322 8:142543259-142543281 CCAGGCATGTCCCCTGGGTCTGG + Intronic
1051366449 9:16324658-16324680 GACGGCGTGTCCTCTCTGTTAGG - Intergenic
1053428342 9:38025711-38025733 CACAGCAAGTGCTCAGTGTCAGG + Intronic
1053463067 9:38285449-38285471 CACCTGCTGTCCTCTGTGTCTGG + Intergenic
1057976383 9:99609947-99609969 CATGGCATGCCCTCTGTATGGGG + Intergenic
1059564419 9:115369145-115369167 CCTGGCTTGTCCACTGTGTCAGG - Intronic
1060769297 9:126319612-126319634 CGGGGTATTTCCTCTGTGTCAGG - Intergenic
1061404698 9:130386957-130386979 CATGGCAGGTCCACTGTGCCTGG - Intronic
1062412654 9:136432766-136432788 CACGGCACGCCCTCGGTGCCGGG + Intronic
1187062248 X:15797967-15797989 CAGGCCATATCCTCTGTGCCAGG + Intronic
1195394525 X:104397000-104397022 CCTGGCATGTCCTCTCTGTCAGG + Intergenic
1196032416 X:111104878-111104900 CACAGCATGTCTTCTGTTACAGG - Intronic
1198691773 X:139292661-139292683 CAGGGCGTGTCTTCTGTGCCTGG - Intergenic