ID: 1161012510

View in Genome Browser
Species Human (GRCh38)
Location 19:1967495-1967517
Sequence CTGTCTGCACAGATCCTGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 245}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161012510_1161012520 15 Left 1161012510 19:1967495-1967517 CCCGGCAGGATCTGTGCAGACAG 0: 1
1: 0
2: 1
3: 31
4: 245
Right 1161012520 19:1967533-1967555 GGCTCCCGGTGCAGGGTTCTTGG 0: 1
1: 0
2: 0
3: 11
4: 151
1161012510_1161012515 -9 Left 1161012510 19:1967495-1967517 CCCGGCAGGATCTGTGCAGACAG 0: 1
1: 0
2: 1
3: 31
4: 245
Right 1161012515 19:1967509-1967531 TGCAGACAGGCAGGTGGCTGCGG 0: 1
1: 0
2: 8
3: 63
4: 572
1161012510_1161012526 28 Left 1161012510 19:1967495-1967517 CCCGGCAGGATCTGTGCAGACAG 0: 1
1: 0
2: 1
3: 31
4: 245
Right 1161012526 19:1967546-1967568 GGGTTCTTGGCCTCCTGGGCGGG 0: 1
1: 0
2: 1
3: 29
4: 257
1161012510_1161012523 23 Left 1161012510 19:1967495-1967517 CCCGGCAGGATCTGTGCAGACAG 0: 1
1: 0
2: 1
3: 31
4: 245
Right 1161012523 19:1967541-1967563 GTGCAGGGTTCTTGGCCTCCTGG 0: 1
1: 0
2: 0
3: 22
4: 218
1161012510_1161012524 24 Left 1161012510 19:1967495-1967517 CCCGGCAGGATCTGTGCAGACAG 0: 1
1: 0
2: 1
3: 31
4: 245
Right 1161012524 19:1967542-1967564 TGCAGGGTTCTTGGCCTCCTGGG 0: 1
1: 0
2: 0
3: 22
4: 259
1161012510_1161012518 7 Left 1161012510 19:1967495-1967517 CCCGGCAGGATCTGTGCAGACAG 0: 1
1: 0
2: 1
3: 31
4: 245
Right 1161012518 19:1967525-1967547 GCTGCGGTGGCTCCCGGTGCAGG 0: 1
1: 0
2: 1
3: 10
4: 190
1161012510_1161012525 27 Left 1161012510 19:1967495-1967517 CCCGGCAGGATCTGTGCAGACAG 0: 1
1: 0
2: 1
3: 31
4: 245
Right 1161012525 19:1967545-1967567 AGGGTTCTTGGCCTCCTGGGCGG 0: 1
1: 0
2: 1
3: 23
4: 177
1161012510_1161012516 -6 Left 1161012510 19:1967495-1967517 CCCGGCAGGATCTGTGCAGACAG 0: 1
1: 0
2: 1
3: 31
4: 245
Right 1161012516 19:1967512-1967534 AGACAGGCAGGTGGCTGCGGTGG 0: 1
1: 0
2: 0
3: 55
4: 583
1161012510_1161012519 8 Left 1161012510 19:1967495-1967517 CCCGGCAGGATCTGTGCAGACAG 0: 1
1: 0
2: 1
3: 31
4: 245
Right 1161012519 19:1967526-1967548 CTGCGGTGGCTCCCGGTGCAGGG 0: 1
1: 0
2: 0
3: 8
4: 99
1161012510_1161012517 1 Left 1161012510 19:1967495-1967517 CCCGGCAGGATCTGTGCAGACAG 0: 1
1: 0
2: 1
3: 31
4: 245
Right 1161012517 19:1967519-1967541 CAGGTGGCTGCGGTGGCTCCCGG 0: 1
1: 0
2: 7
3: 63
4: 453

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161012510 Original CRISPR CTGTCTGCACAGATCCTGCC GGG (reversed) Intronic
900088871 1:910574-910596 CTGTCTGTTCAGGGCCTGCCGGG - Intergenic
900215317 1:1478556-1478578 GTGTCTGCACAGCTCCGGCACGG - Intronic
900419343 1:2548958-2548980 CAGGCTGCTCAGGTCCTGCCTGG - Intergenic
900568614 1:3347489-3347511 CAGTGTGCACAGAGCCTGCCTGG - Intronic
901190845 1:7408904-7408926 CTGTCTGCTCAGCGCCAGCCAGG + Intronic
901218827 1:7570693-7570715 GTGTCAGCACAGACCCTGCCTGG + Intronic
901661096 1:10798331-10798353 CTGTGTGGACAGATCCTGAATGG - Intergenic
902493004 1:16799099-16799121 CTGTCTGCCTAGATTCTTCCAGG + Intronic
904201583 1:28823149-28823171 CTTTCTGCACACACCCTTCCTGG - Intronic
904404643 1:30278077-30278099 CTGTGTCCACAGATCCTGCGTGG - Intergenic
904782898 1:32964256-32964278 CTGTCCGCACCGCTCGTGCCGGG - Exonic
905295530 1:36952024-36952046 CTGTCAGCACAGGGCCTGCCCGG + Intronic
906114297 1:43346156-43346178 CTGTTTTCACATATCATGCCAGG + Intronic
906693825 1:47810915-47810937 CTGCCTGCCCATCTCCTGCCAGG + Intronic
908308597 1:62852218-62852240 GTGTCTGCACTGATCCGGTCTGG - Intronic
908484388 1:64576287-64576309 CTGTCTGCAGGGATCATGGCAGG + Intronic
910036726 1:82797863-82797885 CTCTCTGCACAAAACCTGCTAGG + Intergenic
910743195 1:90544511-90544533 CTGTCTGCAATGCTCCTCCCTGG - Intergenic
915328518 1:155093782-155093804 CTGTCAGACCAGGTCCTGCCAGG - Intergenic
917478509 1:175389465-175389487 CTGTCTGCCCAGATTCTTCTTGG - Intronic
918182587 1:182097215-182097237 CTGTCTGCATAGAACCTGCTTGG + Intergenic
918369028 1:183840092-183840114 CTGTCTGTTCAGATTCTTCCTGG + Intronic
922160633 1:223077225-223077247 CTGTTTGCATAGAGCCTGCCAGG - Intergenic
922328625 1:224554136-224554158 CTATCTGCTCAGCTCCTGTCTGG + Intronic
922697330 1:227737246-227737268 CTATGTGCACACAGCCTGCCAGG - Intronic
923527442 1:234783429-234783451 CTGTCTGCCTAGATTCTTCCAGG - Intergenic
923685111 1:236148267-236148289 CTGTCTGCCCAGGAGCTGCCTGG - Intronic
924632260 1:245752235-245752257 CTCTCTGCAAAGATCTTTCCAGG - Intronic
1064202836 10:13299502-13299524 CTGCCTGGCCAGCTCCTGCCCGG + Intronic
1064494218 10:15890776-15890798 CAATCTGCACAGAACCTCCCAGG + Intergenic
1064658406 10:17579888-17579910 TGGTCTCCACAGTTCCTGCCGGG - Intergenic
1065250555 10:23807175-23807197 CTGTCTGCACAGGGCCTTTCTGG + Intronic
1069551489 10:69367404-69367426 CTGTCTGCCCATTTCCTGCTGGG - Intronic
1069566719 10:69468272-69468294 CTGGCTGCCCACAGCCTGCCTGG + Intronic
1069987631 10:72295388-72295410 CCCACTGCACAAATCCTGCCTGG + Intergenic
1072763659 10:98079027-98079049 CTGCCAGCACAGTGCCTGCCTGG - Intergenic
1074696636 10:116055721-116055743 CTGTCAGCACAGATGGTGCGGGG - Intergenic
1075172005 10:120124289-120124311 CTGACTCCACAGATTCTGCTTGG + Intergenic
1076294001 10:129369826-129369848 CTGGCTGGGCAGAGCCTGCCTGG - Intergenic
1077083928 11:738171-738193 CTGTCTGTGCAGATTCTTCCCGG + Intergenic
1077128614 11:957393-957415 CTGTCTGTGCAGATTCTTCCCGG + Intronic
1077216997 11:1399083-1399105 CTGCCTGCCCAGCTCCTTCCTGG - Intronic
1077220297 11:1412774-1412796 CTGGCTGCACAGATCAACCCAGG + Intronic
1077573503 11:3358182-3358204 CTGTCTGCACAGTTACTGGAGGG + Intronic
1077781407 11:5333963-5333985 CTGTATCTACAGATTCTGCCGGG - Intronic
1080715297 11:34794353-34794375 CTGTCTGGAGAGATCTTGCCTGG + Intergenic
1081495679 11:43607967-43607989 CTGAGTGCACAGCTCCTGTCTGG + Intronic
1081532183 11:43969661-43969683 CTGACTTCGCAGAGCCTGCCAGG + Intergenic
1082760110 11:57119148-57119170 TTGGCTGCTCAGATCCAGCCTGG - Intergenic
1085557606 11:77439466-77439488 CTCTCTTCAAAGTTCCTGCCAGG - Intronic
1086392046 11:86375186-86375208 CTGCCTGCCCAGGTCCTGCAGGG - Exonic
1086740865 11:90367268-90367290 CTGTCAAAATAGATCCTGCCAGG - Intergenic
1088482771 11:110310917-110310939 CTGTCTGTTCAGATCCTTCTTGG + Intergenic
1089701343 11:120245932-120245954 CTTTCTTCCCAGGTCCTGCCTGG - Intronic
1089861757 11:121596362-121596384 CTCACTGCAAAGATCCTCCCTGG - Intronic
1090835990 11:130454230-130454252 AAGACTGCAAAGATCCTGCCTGG - Intronic
1091305024 11:134531317-134531339 CTCTCTGCCGAGAGCCTGCCTGG + Intergenic
1091897590 12:4117641-4117663 CTGCCTGGACACACCCTGCCAGG + Intergenic
1093562042 12:20552867-20552889 CTGCCTGGACAGATCCTTTCGGG + Intronic
1094569215 12:31627197-31627219 TTGTCTGCCCAGAACCTGGCAGG + Intergenic
1095964731 12:47859055-47859077 GTGTCTGCACAGACCCTACCAGG + Intronic
1096070207 12:48771149-48771171 CTGTATGCCCAAGTCCTGCCTGG - Intronic
1096789483 12:54035954-54035976 CAGTCTGAACATTTCCTGCCAGG - Intronic
1097870267 12:64596076-64596098 CTGTCTGCCTAGATTCTTCCTGG - Intergenic
1098291972 12:68965053-68965075 CTGACTGAACAGATCCTTCTTGG + Intronic
1100647256 12:96544656-96544678 CTGTCTGTTCAGATTCTTCCTGG - Intronic
1100710660 12:97252742-97252764 CTGTATGCAAGGACCCTGCCAGG + Intergenic
1101363851 12:104053350-104053372 CTGTATGCACAGATTTTCCCTGG + Intronic
1104371170 12:128225168-128225190 CTGTTTGCTCAGTTCCTGCCTGG - Intergenic
1105295961 13:19088131-19088153 CTGTCTACACATATGCAGCCAGG - Intergenic
1106039811 13:26079094-26079116 CAGTCAGCTGAGATCCTGCCAGG + Intergenic
1106074072 13:26442187-26442209 CTCTATACACAGATCATGCCTGG + Intergenic
1113601758 13:111574345-111574367 CTGCCCGAACAGAGCCTGCCAGG - Intergenic
1113825396 13:113248819-113248841 CTGTCTGTTCAGATTCTTCCTGG + Intronic
1114482506 14:23044477-23044499 CTGTCTGCCCAGCTCCTGCCTGG - Intergenic
1114750021 14:25193548-25193570 CTGTCTGCACAGCATCTACCTGG - Intergenic
1118930470 14:70235510-70235532 ATGTCTACACAGATCTGGCCAGG + Intergenic
1118954390 14:70466661-70466683 ATGTCTACACAGATCTGGCCAGG - Intergenic
1121337259 14:93085016-93085038 GTGTTTGCAGAGAGCCTGCCAGG - Intronic
1126128525 15:45318153-45318175 CTGTCTGCCCATGTCCTGCCTGG - Intergenic
1126778809 15:52120753-52120775 GTGTCTGGCCAGCTCCTGCCAGG - Exonic
1127600541 15:60531812-60531834 TTGTCTCCACAGATCTTGCATGG + Exonic
1128958196 15:71972065-71972087 CTGTCTGTCCAGATTCTTCCTGG - Intronic
1128986081 15:72222559-72222581 CTGCCTGGACAGTGCCTGCCAGG + Intronic
1129311034 15:74709238-74709260 CAGTCTTCACAGATCCCACCAGG + Intergenic
1129909295 15:79212869-79212891 CTGTCTACAGAGACCCAGCCGGG + Intergenic
1130106538 15:80932647-80932669 CTGTTTGCCCAGTTCCTGGCAGG + Intronic
1130388731 15:83436073-83436095 CAGTGTGCACAGAACGTGCCAGG - Intergenic
1130854528 15:87829878-87829900 CTGGCAGCACAGTTCCTGCTTGG + Intergenic
1131092422 15:89632789-89632811 CTGCCAGGAGAGATCCTGCCAGG - Intronic
1131486578 15:92825843-92825865 CTGTCTGTTCAGATCCTTCTTGG + Intergenic
1132559231 16:585631-585653 CTTGCTGCACAGCCCCTGCCTGG + Intergenic
1132921631 16:2398752-2398774 CTGTCTGTTCAGATCCTTCCTGG + Intergenic
1133059423 16:3164752-3164774 CTGGGTGCACAGTCCCTGCCGGG - Intergenic
1134221544 16:12358685-12358707 CTGTCTGTCCAGATGCTTCCTGG - Intronic
1134807859 16:17140968-17140990 CAGTCTGCACAGAGGCTGCGTGG - Intronic
1134852644 16:17493753-17493775 CTGGCTGCACAGAAACTGCTTGG - Intergenic
1135276622 16:21118849-21118871 CAGGCTGCAAAGTTCCTGCCTGG + Intronic
1135941610 16:26826873-26826895 CTGTCTGATCAGAACCTGCATGG + Intergenic
1137719406 16:50619121-50619143 CTCTCTGCAGAGGTCCTGGCTGG - Intronic
1138550363 16:57744382-57744404 CTCTCTCCACAGAGCCTGACGGG + Exonic
1138970995 16:62142435-62142457 CTGTCTGCTCATGTCCTCCCTGG + Intergenic
1139349219 16:66324914-66324936 CTGTCTAAGCAGATCCTGGCTGG + Intergenic
1141253877 16:82383078-82383100 CTGTCTGAGCATTTCCTGCCTGG + Intergenic
1141655911 16:85416472-85416494 CTTTCTGCCCAGCTCCTTCCCGG + Intergenic
1141854453 16:86671709-86671731 GTGTCTGCACACACCCTCCCCGG + Intergenic
1143378676 17:6482218-6482240 CTGTCTGCTCAGATTCTTCTTGG - Intronic
1144370369 17:14584605-14584627 CTGTCTGCTCAGATTCTTCCTGG + Intergenic
1146623662 17:34419655-34419677 CTGTTTGCCCGGAGCCTGCCGGG + Intergenic
1147533550 17:41302455-41302477 CTGCCAGCAAAGCTCCTGCCAGG - Exonic
1148216439 17:45836171-45836193 CAATCAGCACAGCTCCTGCCTGG - Intergenic
1149655490 17:58307752-58307774 CTGTCTCCACAGTCCCTGCGAGG - Exonic
1151336285 17:73441531-73441553 CTGTCTTCACAGAGTCTTCCAGG - Intronic
1151465387 17:74281734-74281756 CTATCTCCACAGGTCCTGCCAGG - Exonic
1152742193 17:82023247-82023269 CTGCCTGCGCAGAGCCTGCTAGG + Intronic
1152921864 17:83069891-83069913 CTGTGGGCACAGAACCTGCCAGG + Intergenic
1153209566 18:2745927-2745949 CTCTCTGCACAGATCCTATCAGG - Intronic
1153254124 18:3153076-3153098 CTGTCTCCAGAGATTCTGCCAGG + Intronic
1156516758 18:37686765-37686787 CTGTCATCACAGATCCTCCCAGG + Intergenic
1157417997 18:47521876-47521898 CTGTCTGCTCAGGCCCTGACAGG + Intergenic
1160410730 18:78673815-78673837 CCCTTTGCACAGACCCTGCCTGG - Intergenic
1160800678 19:966648-966670 CTGCTTGCACAGCTGCTGCCTGG - Exonic
1161012510 19:1967495-1967517 CTGTCTGCACAGATCCTGCCGGG - Intronic
1161559042 19:4960659-4960681 CTGCCTGGACAGATCCTTTCGGG + Exonic
1162304485 19:9863440-9863462 GTGACTGCACAGATCCAGACAGG + Intronic
1162497616 19:11032164-11032186 CTGTCAGCACACTTCCTGGCAGG - Intronic
1162523512 19:11195005-11195027 CTGTCTCCTCAGATCCTTGCAGG - Intronic
1162997150 19:14343414-14343436 CTGTGTTCACAGAGCCAGCCAGG + Intergenic
1164807547 19:31128518-31128540 CAACCTGCACAAATCCTGCCGGG + Intergenic
1164837943 19:31370192-31370214 CTGACTGTGCAGAGCCTGCCTGG - Intergenic
1165097808 19:33419259-33419281 CTGACTACTCAGCTCCTGCCAGG + Intronic
1165123495 19:33578550-33578572 CTGTCTGCACAGATATTCCAGGG + Intergenic
1166037387 19:40178793-40178815 CTGTCAGCAAAGATCATGTCAGG - Intergenic
1167572555 19:50298179-50298201 CTGTCTGTTCAGATTCTTCCTGG + Intronic
1168121639 19:54255230-54255252 GGCTCTGCACAGGTCCTGCCGGG - Intronic
1168337767 19:55605886-55605908 CTATCTGCAGTGATCCTACCGGG - Intronic
925262822 2:2542955-2542977 CTGTGGGCACAGATCCTCCCAGG + Intergenic
926213853 2:10891451-10891473 CTGTCTGCCCAGTTCCCACCTGG + Intergenic
928179530 2:29058278-29058300 CTGTGTGCACAGATGCTCCCTGG + Exonic
928318771 2:30266789-30266811 CTTTCTGCACAGGCCCTGCCTGG - Intronic
930733183 2:54748341-54748363 CTGTCTTCTAAGATCCTACCTGG + Intronic
931089225 2:58867663-58867685 CTGTCTGCTCAGATTCTTCCTGG - Intergenic
933115886 2:78470638-78470660 TTTTCAGCACAGATCCTGCATGG - Intergenic
935177586 2:100663391-100663413 GTCTCTGCCCAGCTCCTGCCAGG + Intergenic
935184390 2:100718430-100718452 CTGTCTGTTCAGATTCTTCCTGG + Intergenic
940619601 2:156094477-156094499 CTGTGTGCACAGAATCTACCTGG - Intergenic
941895040 2:170620677-170620699 CTGTGTGCACAGATCTACCCGGG - Intronic
942706345 2:178776983-178777005 CTGTCAGCCAAGATTCTGCCTGG - Exonic
947752773 2:232541351-232541373 CTGTATGCACAGAACAGGCCAGG - Intronic
948054093 2:234998446-234998468 CTGCCTGCACACCTCCTGCCTGG + Intronic
948284022 2:236770066-236770088 CTGTCTGCAGATGCCCTGCCTGG + Intergenic
948843957 2:240674407-240674429 GCCTCTGCACAGATCCTTCCAGG - Intergenic
948849854 2:240700228-240700250 GCCTCTGCACAGATCCTTCCAGG + Intergenic
948906924 2:240984023-240984045 CTGTCTGCCCAGGCCCTACCGGG - Intronic
1169219995 20:3816610-3816632 CTGTCTGCACAGAGCCTGATGGG + Intergenic
1170798389 20:19569960-19569982 CTTTCTGCCCAGACCCTGACAGG + Intronic
1171337259 20:24395513-24395535 CTGTCTCCAGAGAGGCTGCCAGG - Intergenic
1173079172 20:39849778-39849800 CTGTCAGCACAGATTCCACCAGG + Intergenic
1174079097 20:47958305-47958327 CTGTCTGCAAAGATTCCACCTGG + Intergenic
1174238944 20:49117390-49117412 CTGTCAGCCCAGAACCTTCCAGG + Intronic
1175492938 20:59391050-59391072 TCTTCTGCACAGATTCTGCCAGG - Intergenic
1175545082 20:59772911-59772933 GTGGCTGCACAGATTCTTCCGGG + Intronic
1176101639 20:63367096-63367118 CTGTCTACAAAGAGCCTGGCAGG - Intronic
1176299125 21:5090338-5090360 CTGTCTGCAGGGAACCAGCCAGG + Intergenic
1179022710 21:37654804-37654826 CTGTCTGCACAGCCCCTGGCTGG + Intronic
1179155600 21:38848438-38848460 CTATCTGCTCACATCCTGCTTGG + Intergenic
1179857901 21:44171610-44171632 CTGTCTGCAGGGAACCAGCCAGG - Intergenic
1179943419 21:44654413-44654435 CTGTGTGCCCAGCCCCTGCCAGG - Exonic
1179944936 21:44666793-44666815 TTGTGTGCCCAGCTCCTGCCAGG - Exonic
1181437507 22:22919180-22919202 CTGTCTGAACATCCCCTGCCAGG - Intergenic
1182668752 22:31978160-31978182 CTGTCTGCTCTGATGCTACCTGG - Intergenic
1182688044 22:32135874-32135896 CTCTCTGCAGAGCTCCTTCCCGG - Intergenic
1183694786 22:39415579-39415601 CTGTCCGCAGAGCTCCTGCTGGG + Exonic
1183748528 22:39705951-39705973 CTGTGTGTGCAGACCCTGCCTGG + Intergenic
949552040 3:5119692-5119714 CTGACTAAACAGATCCTTCCTGG + Intergenic
949630348 3:5919503-5919525 CTGACTAAACAGATCCTTCCTGG - Intergenic
949759512 3:7453829-7453851 CTGTCTGTCCAGATCCTTCTTGG + Intronic
950441012 3:13010450-13010472 CTGTCAGAACAGTTTCTGCCTGG + Intronic
952988419 3:38809126-38809148 CTGTCTGCATGGAACCTGCCTGG - Intergenic
953201249 3:40780447-40780469 CTGTCTTCACTGGCCCTGCCAGG + Intergenic
953930086 3:47001578-47001600 CTGTGTGCACAAACCCTACCTGG + Intronic
957260420 3:77895296-77895318 CTGTCTGGAAAGATTCTGTCTGG + Intergenic
960000967 3:112731477-112731499 CTGTCTGCTCAGATTCTTCTTGG + Intergenic
960006125 3:112782878-112782900 CTGTCTGCTCAGATTCTTTCTGG - Intronic
960829439 3:121830883-121830905 CTGTCTGCTCAGATTCTTCTTGG - Intronic
960982731 3:123246406-123246428 CTGTCTGATCAGATCTTTCCAGG - Intronic
961454485 3:127017312-127017334 CTCCCTGCACAGATGATGCCAGG - Intronic
962837093 3:139199088-139199110 CTGTCTTCTCAGCTTCTGCCTGG + Intronic
963983464 3:151566021-151566043 CTTTCTGCACTGATTCTCCCAGG - Intergenic
965602583 3:170469646-170469668 AGGTGTGCACAGGTCCTGCCTGG - Intronic
967495026 3:190133619-190133641 TCTTCTTCACAGATCCTGCCTGG - Intergenic
968126553 3:196164294-196164316 CTGTCTTCCCAGACCCCGCCTGG + Intergenic
968481191 4:833766-833788 CTCTGTGTACAGAGCCTGCCTGG - Intergenic
969253075 4:5982765-5982787 ATCTCTGCACAGAACCAGCCTGG + Intronic
969524587 4:7697722-7697744 CTGTGTCCACAGCCCCTGCCAGG - Intronic
969924521 4:10573831-10573853 CTGTGGGTACAGACCCTGCCTGG + Intronic
971174390 4:24266717-24266739 CAGGCTGCAAAGATCCTGCAGGG + Intergenic
972440529 4:39085987-39086009 ATGTCTTCTCAGATCCTCCCTGG - Intronic
976514476 4:85949203-85949225 CTGGCTGCGCAGACTCTGCCTGG + Intronic
977730239 4:100342280-100342302 CTGTTTGCACACATCAGGCCAGG + Intergenic
978387881 4:108193921-108193943 TTGCCTGCATAGATCCGGCCTGG + Intergenic
979286182 4:118927197-118927219 CTCTCTGCCCAGAACCTGCTAGG - Intronic
981580779 4:146246556-146246578 CAGGCTGCACAGATCCTGAGAGG - Intergenic
983178473 4:164618931-164618953 CTGTCTCCCCAGCTCCTTCCTGG - Intergenic
985988238 5:3535291-3535313 CCGTCTGCACAGACCTTGCAAGG + Intergenic
986201306 5:5581358-5581380 CTGTATGCCCAAATCCTTCCTGG + Intergenic
986212857 5:5690517-5690539 CTGTCTGCTCAGATTCTTCTTGG + Intergenic
986276937 5:6283989-6284011 CTTCCTGCACAGACCCTGGCAGG - Intergenic
987661919 5:20888940-20888962 CTGTCTGCCCAGATTCTTCTTGG + Intergenic
988761668 5:34316379-34316401 CTGTCTGCCCAGATTCTTCTTGG - Intergenic
989539658 5:42604357-42604379 CTGTCTGTTCAGATTCTTCCTGG + Intronic
992396154 5:76371369-76371391 CTGTCTGTTCAGATTCTTCCTGG + Intergenic
992889248 5:81188825-81188847 CTGGCTGCACAGTTTTTGCCGGG + Intronic
993112372 5:83674277-83674299 CTGACTGCAGAGACCCTACCTGG - Intronic
996903502 5:128571724-128571746 CTTGCTCCACAGATCCTGCTAGG + Intronic
997206216 5:132051679-132051701 CTGTCTGAACAGTTTCTTCCTGG + Intergenic
997296522 5:132772209-132772231 CTTTCTGCACACAGCCAGCCAGG + Intronic
997710686 5:136001523-136001545 CTGGCTGCAGGCATCCTGCCGGG + Intergenic
997738568 5:136233574-136233596 CAGTTTTCACTGATCCTGCCAGG - Intronic
997755625 5:136396423-136396445 GTGTGTGCACAGATTCTACCTGG + Intronic
999449509 5:151667621-151667643 CGGTCAGCACAGACCCTGCCTGG + Intronic
999839800 5:155412912-155412934 CTGTCTGCTGAGGTTCTGCCTGG - Intergenic
1004201817 6:13555508-13555530 CTGTTTGCACATATCCTCACAGG - Intergenic
1004321698 6:14636303-14636325 ATCTCTGTACAGATCCTACCAGG + Intergenic
1004436541 6:15600642-15600664 CTGTCTTCACTGATCCTTTCCGG - Intronic
1004734025 6:18387047-18387069 CTGTCTGTACATATCCTCACAGG - Intergenic
1005841215 6:29745668-29745690 CTGACTGCACAGATCCATCCTGG + Intergenic
1005870691 6:29972404-29972426 CTGACTGCACAGATCCATCCCGG + Intergenic
1006072095 6:31505654-31505676 CTGACTGCACAGATCCATCCTGG - Exonic
1009032779 6:58080833-58080855 CAGTCTGCACAGAGCCTGGAGGG + Intergenic
1009208394 6:60832607-60832629 CAGTCTGCACAGACCCTGGAGGG + Intergenic
1011489254 6:87874035-87874057 CTGTCTGCTCAGATGCTTCTTGG + Intergenic
1017719231 6:157233373-157233395 CAGTCTGCACCTGTCCTGCCTGG - Intergenic
1019710523 7:2516333-2516355 ATGTCTCCACAGATCTTCCCAGG + Intronic
1019739481 7:2665650-2665672 CTGTCTGGACAAGTACTGCCAGG + Intergenic
1020074446 7:5248531-5248553 CTGTCTGCATCGATCCGGCCTGG - Intergenic
1022048511 7:26643164-26643186 CTGTCTGTCCAGATCCTTCTTGG - Intronic
1023489796 7:40726771-40726793 CTGACTGCACAGGTGCTGCTTGG + Intronic
1023994121 7:45148458-45148480 GTTTCTGCACAGGTCCAGCCCGG + Intergenic
1024136213 7:46411923-46411945 CTGTCTGCCCAGATTCTTCTCGG + Intergenic
1024976711 7:55120176-55120198 CTGTCTGCAGTCCTCCTGCCAGG - Intronic
1025204651 7:56985276-56985298 CTGTCTGCATCGATCCACCCTGG + Intergenic
1025667286 7:63591659-63591681 CTGTCTGCATCGATCCACCCTGG - Intergenic
1031479125 7:122257190-122257212 CTGTCTGTACAGATTCTTCTTGG - Intergenic
1032137622 7:129295244-129295266 CTGGCTTCACAGAACCAGCCTGG - Intronic
1033410508 7:141113510-141113532 CTGTCTGAAAGGATCCTCCCAGG - Intronic
1033595280 7:142854776-142854798 CTGTCTGTAAAGCCCCTGCCTGG - Intergenic
1034505323 7:151484619-151484641 CTGTCTGCACACAACCTGAGGGG + Intronic
1034737243 7:153440582-153440604 CTGTGTGGTCAGATCCTCCCTGG - Intergenic
1037715220 8:21391785-21391807 CTGTCTGTCTAGATCCTTCCTGG - Intergenic
1037813431 8:22099659-22099681 CTGTCTGCACACACCGGGCCTGG + Intronic
1038514633 8:28176336-28176358 GTGTCTGCACTGGTCCTTCCAGG + Intronic
1040277528 8:46021648-46021670 CACGCTGCACAGTTCCTGCCAGG + Intergenic
1040825792 8:51619400-51619422 CTGTCTGCTCAGATTCTTCTTGG - Intronic
1041461816 8:58119706-58119728 CTGTCTGCAGAGATTCTTCAGGG + Intronic
1041880456 8:62743825-62743847 CTGTCTGCTCAGATTCTTCTTGG + Intronic
1047456400 8:125017159-125017181 CAGTCAGCACAAATCCAGCCAGG + Intronic
1048731272 8:137443345-137443367 CTGTCTGCACAGTACCTTCAAGG - Intergenic
1049685767 8:143938775-143938797 CTGGCTGGCCAGGTCCTGCCTGG + Intronic
1049799721 8:144512154-144512176 CCGTCTGCGCAGAACCTTCCAGG - Exonic
1049812536 8:144581937-144581959 CTCTCAGCAAAGATGCTGCCAGG + Intronic
1049953820 9:673153-673175 CTCTTTGCACAGACACTGCCAGG + Intronic
1049966547 9:785248-785270 CTGTCTGTTCAGATTCTTCCTGG + Intergenic
1053424848 9:38004040-38004062 CTGCCTGCCCTGCTCCTGCCTGG + Intronic
1055150747 9:72996279-72996301 CTGTCTCAATAGATCATGCCAGG - Intronic
1055677206 9:78676138-78676160 CTGTCTGGAGAAATCCTGTCTGG + Intergenic
1057263836 9:93601239-93601261 CTGTCTGCACATATACAGCCAGG + Intronic
1057444244 9:95102916-95102938 CTGGCTGCACTGACCCTGGCGGG - Intronic
1057546953 9:96026148-96026170 CTGCCTGCCCACATCCCGCCCGG - Intergenic
1059902640 9:118945346-118945368 CTGTGTGCACAGAGCCAGCACGG + Intergenic
1060196873 9:121629498-121629520 CTGTCTGCCCGGCGCCTGCCCGG - Intronic
1062336650 9:136073842-136073864 CTGTCTGCTAAAATGCTGCCTGG + Intronic
1185942599 X:4338413-4338435 CTTGGTGCTCAGATCCTGCCAGG - Intergenic
1187143386 X:16615620-16615642 CTGTCTGCTCAGATTCTTCTTGG - Intronic
1187397859 X:18933658-18933680 CTGTGTGCAGAAATCCTTCCTGG + Intronic
1191090427 X:56615485-56615507 CTGCATGCTCAGATCCTGGCAGG + Intergenic
1197752254 X:129973277-129973299 CGGTCTGCGCAAATGCTGCCAGG + Intergenic
1201274959 Y:12287998-12288020 CTGTCTGCACAGTTACTGGAAGG + Intergenic