ID: 1161013568

View in Genome Browser
Species Human (GRCh38)
Location 19:1971629-1971651
Sequence CCCCGCAGGCTGCAGGTCAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161013568_1161013574 -10 Left 1161013568 19:1971629-1971651 CCCGTGACCTGCAGCCTGCGGGG No data
Right 1161013574 19:1971642-1971664 GCCTGCGGGGTATGGCTTTTGGG 0: 1
1: 0
2: 0
3: 5
4: 56
1161013568_1161013582 23 Left 1161013568 19:1971629-1971651 CCCGTGACCTGCAGCCTGCGGGG No data
Right 1161013582 19:1971675-1971697 GCTATGTGGGTCCTGTCCTTGGG 0: 1
1: 0
2: 0
3: 8
4: 108
1161013568_1161013583 26 Left 1161013568 19:1971629-1971651 CCCGTGACCTGCAGCCTGCGGGG No data
Right 1161013583 19:1971678-1971700 ATGTGGGTCCTGTCCTTGGGCGG 0: 1
1: 0
2: 0
3: 16
4: 184
1161013568_1161013577 9 Left 1161013568 19:1971629-1971651 CCCGTGACCTGCAGCCTGCGGGG No data
Right 1161013577 19:1971661-1971683 TGGGAACCCAGATGGCTATGTGG 0: 1
1: 0
2: 0
3: 15
4: 151
1161013568_1161013584 29 Left 1161013568 19:1971629-1971651 CCCGTGACCTGCAGCCTGCGGGG No data
Right 1161013584 19:1971681-1971703 TGGGTCCTGTCCTTGGGCGGCGG 0: 1
1: 0
2: 1
3: 57
4: 1052
1161013568_1161013578 10 Left 1161013568 19:1971629-1971651 CCCGTGACCTGCAGCCTGCGGGG No data
Right 1161013578 19:1971662-1971684 GGGAACCCAGATGGCTATGTGGG 0: 1
1: 0
2: 2
3: 7
4: 131
1161013568_1161013576 1 Left 1161013568 19:1971629-1971651 CCCGTGACCTGCAGCCTGCGGGG No data
Right 1161013576 19:1971653-1971675 ATGGCTTTTGGGAACCCAGATGG 0: 1
1: 0
2: 0
3: 29
4: 266
1161013568_1161013581 22 Left 1161013568 19:1971629-1971651 CCCGTGACCTGCAGCCTGCGGGG No data
Right 1161013581 19:1971674-1971696 GGCTATGTGGGTCCTGTCCTTGG 0: 1
1: 0
2: 3
3: 12
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161013568 Original CRISPR CCCCGCAGGCTGCAGGTCAC GGG (reversed) Intronic
No off target data available for this crispr