ID: 1161014505

View in Genome Browser
Species Human (GRCh38)
Location 19:1977095-1977117
Sequence ATCCAGCTGGGTCACCGTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 74}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161014505_1161014510 -6 Left 1161014505 19:1977095-1977117 CCAACACGGTGACCCAGCTGGAT 0: 1
1: 0
2: 0
3: 8
4: 74
Right 1161014510 19:1977112-1977134 CTGGATGGTGCCTGAGAGACGGG 0: 1
1: 0
2: 2
3: 19
4: 224
1161014505_1161014513 8 Left 1161014505 19:1977095-1977117 CCAACACGGTGACCCAGCTGGAT 0: 1
1: 0
2: 0
3: 8
4: 74
Right 1161014513 19:1977126-1977148 AGAGACGGGGCTGCCCCACATGG 0: 1
1: 0
2: 0
3: 36
4: 454
1161014505_1161014509 -7 Left 1161014505 19:1977095-1977117 CCAACACGGTGACCCAGCTGGAT 0: 1
1: 0
2: 0
3: 8
4: 74
Right 1161014509 19:1977111-1977133 GCTGGATGGTGCCTGAGAGACGG 0: 1
1: 0
2: 1
3: 29
4: 278
1161014505_1161014518 27 Left 1161014505 19:1977095-1977117 CCAACACGGTGACCCAGCTGGAT 0: 1
1: 0
2: 0
3: 8
4: 74
Right 1161014518 19:1977145-1977167 ATGGTGCCCTGTCATGCCGCGGG 0: 1
1: 0
2: 0
3: 1
4: 71
1161014505_1161014511 -5 Left 1161014505 19:1977095-1977117 CCAACACGGTGACCCAGCTGGAT 0: 1
1: 0
2: 0
3: 8
4: 74
Right 1161014511 19:1977113-1977135 TGGATGGTGCCTGAGAGACGGGG 0: 1
1: 0
2: 1
3: 12
4: 148
1161014505_1161014517 26 Left 1161014505 19:1977095-1977117 CCAACACGGTGACCCAGCTGGAT 0: 1
1: 0
2: 0
3: 8
4: 74
Right 1161014517 19:1977144-1977166 CATGGTGCCCTGTCATGCCGCGG 0: 1
1: 0
2: 0
3: 13
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161014505 Original CRISPR ATCCAGCTGGGTCACCGTGT TGG (reversed) Intronic
912511809 1:110194883-110194905 CTCCAGCTGTGTCCCAGTGTGGG - Intronic
916779601 1:168010389-168010411 ATCTAGAGGGGTCACAGTGTTGG + Intronic
1064066039 10:12182266-12182288 CTCCAGCTGGGGCATCATGTTGG + Intronic
1067051930 10:43026611-43026633 AGCAAGCTGGGTCACCCTGAGGG - Intergenic
1069275741 10:66588277-66588299 TTCCATCTGGTTCACAGTGTAGG + Intronic
1081257834 11:40919232-40919254 TTCCAGCTGTATCACAGTGTAGG + Intronic
1081400394 11:42636172-42636194 CTCCAGTAGGGACACCGTGTGGG - Intergenic
1084004971 11:66317813-66317835 TTCCAGCTGGGCCAGCGTGTGGG + Intergenic
1086391739 11:86371900-86371922 GACCTGCTGGCTCACCGTGTAGG - Intergenic
1087364686 11:97203106-97203128 TTCCACCTGGCTCACAGTGTAGG + Intergenic
1089480807 11:118803495-118803517 ATCCAGCTGTGTCACCTATTGGG + Intergenic
1091233693 11:134004965-134004987 ATCCAGCTCTGTCATCGTGCAGG - Intergenic
1091274655 11:134342217-134342239 CTCTAGCTGGGTCACCTCGTGGG + Intronic
1101409633 12:104457679-104457701 ATCTACCCGGGTCACCGCGTCGG + Intronic
1102082850 12:110112416-110112438 ATCCAGCTGGAGGTCCGTGTGGG - Intergenic
1110209497 13:72954717-72954739 TTCCATCTGGTTCACAGTGTAGG + Intronic
1114350655 14:21846939-21846961 GTCAAGCTGGGTCACCGACTGGG - Intergenic
1114374794 14:22132746-22132768 ATCAAGCTGGGTCACCGACTGGG - Intergenic
1115753122 14:36509552-36509574 ATATAGCTGGGTCACAGTGATGG - Intronic
1117147723 14:52852061-52852083 TTCCAAATGGGTCACAGTGTTGG - Intergenic
1118383677 14:65238103-65238125 ATCCATATAGGTCACCGTGTGGG - Intergenic
1121282115 14:92706468-92706490 AGCCTGCTGGCTCACCGTGGGGG + Exonic
1121535112 14:94685836-94685858 ATCCAGCTGGGCCCCCCTGTAGG - Intergenic
1122154887 14:99744284-99744306 ATCACACTGGGTCACCGTGTAGG - Intronic
1123724520 15:23088698-23088720 ATCCAGCCGGGTCTCCATGTTGG - Intergenic
1125364039 15:38894793-38894815 ATCCAACTTAGTCACAGTGTGGG + Intergenic
1125682061 15:41537160-41537182 CTCCAGCAGTGTCTCCGTGTGGG + Exonic
1139664110 16:68444266-68444288 AGCCAGCTGGATCACTGTGGAGG - Intronic
1139968460 16:70758713-70758735 ATCCTGCTGGGTCCCTGTTTGGG - Intronic
1141688890 16:85585543-85585565 GCCCAGCTGGGTCTCCATGTGGG + Intergenic
1143402866 17:6657298-6657320 CTGCAGCTGGATCTCCGTGTAGG + Intergenic
1145177508 17:20713707-20713729 AGGCAGGTGGGTCACCATGTTGG - Intergenic
1150484790 17:65536367-65536389 CTCCAGCTGAGCCAGCGTGTTGG + Exonic
1151702542 17:75751013-75751035 GCTCAGCTGGGTCACCGTGGAGG - Exonic
1151822019 17:76501579-76501601 ACCCAGCTGGGTCCCCGCCTGGG + Intronic
1152642834 17:81456352-81456374 TTTCAGCTGGGCCACCCTGTGGG - Exonic
1160555318 18:79720862-79720884 GTCCAGCTTGGCCACAGTGTTGG + Intronic
1160782639 19:884600-884622 AGCCAGCGGGGACACCGTGAGGG - Intronic
1161014505 19:1977095-1977117 ATCCAGCTGGGTCACCGTGTTGG - Intronic
1162329218 19:10017129-10017151 GTCCAGCTGGGCCACGGTGAGGG - Exonic
1162411459 19:10508514-10508536 AGACAGCTGTTTCACCGTGTTGG + Intergenic
1165461119 19:35944955-35944977 GTCCAGCTGGACCACGGTGTGGG - Exonic
1165670400 19:37673677-37673699 ATCCAGGTGGGTAAGGGTGTTGG - Intronic
1167793296 19:51693519-51693541 AGCCAGCAGGGCCATCGTGTGGG - Intergenic
934725664 2:96616770-96616792 ATGCTGCTGGGCCACGGTGTGGG - Intronic
948429696 2:237911713-237911735 CACCAGCAGGGTCACCGTGATGG - Exonic
1170621063 20:17996499-17996521 ATGCATCTGGGTCACCGGTTCGG + Intronic
1173878087 20:46389158-46389180 ATCCAGCCGGGTCTCCATGTTGG + Exonic
1179320160 21:40283849-40283871 ATCCAGAGGGGTCCCCTTGTAGG + Intronic
1180595230 22:16968586-16968608 ATCCAGGAGGGACACTGTGTGGG - Intronic
1180859925 22:19072344-19072366 ATCCAGCTGGTTCACCCTCCAGG + Intronic
1181066345 22:20307813-20307835 ATGGAGCTGGCTCACCGTGAGGG + Intergenic
1183206969 22:36426344-36426366 GGCCAGCTGGGTCCCTGTGTGGG - Intergenic
1184299713 22:43550246-43550268 ATCCAGCTGTGTGACCCTGGAGG - Intronic
1184602339 22:45551079-45551101 GTCCAGCCTGGTGACCGTGTGGG + Intronic
949177852 3:1088105-1088127 ATCCAACTGGGTGACAGTGGGGG - Intergenic
950519131 3:13485882-13485904 ATGCAGCTGGATCACCATCTTGG - Intronic
957127226 3:76177543-76177565 ATCCTGCTGGGTCATCTGGTGGG + Intronic
965652448 3:170947672-170947694 AGCCAGCTGGGCTACTGTGTCGG + Intergenic
985629356 5:1006758-1006780 CTCCAGCTTGGGCACCCTGTAGG + Intergenic
987917217 5:24229266-24229288 TTCCACCTGGCTCACCATGTGGG + Intergenic
992476542 5:77107944-77107966 ATGCTGCTGGGTCAGTGTGTGGG - Intergenic
997904330 5:137800123-137800145 ATCCTGCTGGGTCACTGGCTGGG - Intergenic
1007230376 6:40343926-40343948 GTCCAGCTGGGTCAGCCTGTGGG - Intergenic
1013304925 6:108838954-108838976 GTCCATCTGGGTCACGGAGTGGG - Intergenic
1020450609 7:8316574-8316596 TTCCATCTGGTTCACAGTGTAGG + Intergenic
1022781787 7:33592650-33592672 GTCCAGCTGGGTCACTGGCTTGG - Intronic
1028891544 7:95993384-95993406 ACCCAGCTGGGTCTCATTGTTGG - Intronic
1029338344 7:99921404-99921426 AATCAGCTGGTTCACCTTGTTGG - Intergenic
1029459064 7:100685110-100685132 ATCCAGCTGAGTCCCGGGGTGGG - Exonic
1035063656 7:156089702-156089724 TTCAAGCTGTGTCACTGTGTTGG - Intergenic
1036239896 8:7072795-7072817 ACACGGCTGGGTCACCGTTTTGG - Intergenic
1036918405 8:12828042-12828064 TTCCAGCTGTGTAACAGTGTGGG + Intergenic
1041449671 8:57994204-57994226 ATCCAGCGGTATCACCGGGTGGG + Intergenic
1045096305 8:98801036-98801058 AGCCAGCTGGGTTCCTGTGTTGG + Intronic
1049749602 8:144276949-144276971 ATCCCGCCGGGTCACAGAGTGGG + Intronic
1056021297 9:82440964-82440986 CACCAGCTGGGACACTGTGTGGG - Intergenic
1190500735 X:51075540-51075562 CTCCCACTGGGTCACTGTGTGGG - Intergenic
1191894763 X:65980352-65980374 TTCCATCTGAGTCTCCGTGTAGG - Intergenic
1194400618 X:93434926-93434948 ACACCGCTGGGTCACCGTTTTGG - Intergenic
1194448818 X:94017207-94017229 ATCCAGATGGGTCCACGTGCTGG + Intergenic
1196748236 X:119090854-119090876 TTCCATCTGGTTCACAGTGTAGG - Intronic
1200154910 X:153970229-153970251 AGCCCGCTGGGTAACGGTGTGGG + Intronic