ID: 1161014509

View in Genome Browser
Species Human (GRCh38)
Location 19:1977111-1977133
Sequence GCTGGATGGTGCCTGAGAGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 309
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 278}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161014505_1161014509 -7 Left 1161014505 19:1977095-1977117 CCAACACGGTGACCCAGCTGGAT 0: 1
1: 0
2: 0
3: 8
4: 74
Right 1161014509 19:1977111-1977133 GCTGGATGGTGCCTGAGAGACGG 0: 1
1: 0
2: 1
3: 29
4: 278
1161014504_1161014509 -6 Left 1161014504 19:1977094-1977116 CCCAACACGGTGACCCAGCTGGA 0: 1
1: 0
2: 1
3: 13
4: 91
Right 1161014509 19:1977111-1977133 GCTGGATGGTGCCTGAGAGACGG 0: 1
1: 0
2: 1
3: 29
4: 278

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161014509 Original CRISPR GCTGGATGGTGCCTGAGAGA CGG Intronic
900090358 1:917624-917646 GCTGGGGAGTGCCTGAGGGAGGG + Intergenic
900149849 1:1173612-1173634 CATGGGTGGGGCCTGAGAGACGG + Intergenic
900187383 1:1338761-1338783 GCTGGACGGTGCGTGACAGCAGG + Intronic
900226277 1:1534943-1534965 GCTGGCTGGGGCCAGACAGACGG + Intergenic
900357404 1:2271465-2271487 GCTGGAGGCCGTCTGAGAGAGGG - Intronic
900518081 1:3092662-3092684 GCTGGATGGCGCCTGGGTGCGGG + Intronic
900687195 1:3956144-3956166 GCTGGAGCGTGCCTGTGAGCAGG - Intergenic
901220553 1:7581174-7581196 GCTGGTTGGTGCCAGGGAAAGGG - Intronic
901384940 1:8901858-8901880 TCTGGAGGCTGCCTGAGACATGG + Intergenic
901529759 1:9845542-9845564 ACTGGATGGTACCTGTGTGAAGG - Intergenic
902236899 1:15063451-15063473 GCAGGGTGGCCCCTGAGAGATGG + Intronic
902687930 1:18091037-18091059 ACTGGAGGCTGCCTGTGAGAAGG + Intergenic
902787949 1:18745264-18745286 GGAGGATGGTGCCTGAGAGGAGG + Intronic
903226075 1:21894837-21894859 GCTGGGTGGGGCTTGGGAGAGGG - Intronic
905482749 1:38272675-38272697 GCTGGGGGCTGCCTGAGAGCTGG + Intergenic
906143998 1:43549400-43549422 GCTGGGTGGGACATGAGAGAGGG + Intronic
907272361 1:53298492-53298514 GCTGGCTGGAGCCTGGGAGAGGG - Intronic
907705520 1:56829088-56829110 GCTGCAGGGTGGCTGAAAGAGGG + Intergenic
907836426 1:58113281-58113303 GTTGGAGGGTGCGTGGGAGAGGG + Intronic
909093229 1:71253361-71253383 AAAGGAGGGTGCCTGAGAGAAGG - Intergenic
909268535 1:73593376-73593398 CCTGGATGCTGCCTGATAGAGGG + Intergenic
910597322 1:88993283-88993305 TTTGGAAGGTGCCTGAGAGAGGG + Intergenic
910654218 1:89603620-89603642 GCTGGAGGATGTCTGACAGAGGG + Intergenic
912450353 1:109764352-109764374 CCTGGGTGGTGCCTGTGAGCAGG + Intronic
915034220 1:152909077-152909099 GCTGGAAGGTTGCTGAGAGTTGG - Intronic
915323184 1:155067217-155067239 ACTGGATGGGGCCTGATACATGG + Intronic
915366516 1:155319921-155319943 TCCTGAAGGTGCCTGAGAGAGGG + Exonic
917869443 1:179229122-179229144 GGTGGAAGGTGCCTGAGAGTGGG - Intronic
920546217 1:206820877-206820899 ACTGGATGGAGCCCTAGAGATGG - Intronic
921352359 1:214249223-214249245 GGTGTATGGTGCTTGAGAAATGG - Intergenic
922751952 1:228074151-228074173 ACGGGATGGTGGCTCAGAGAGGG - Exonic
1063375354 10:5551311-5551333 GCAGGAGGGTCCCTGAGAGATGG + Intergenic
1067580420 10:47442070-47442092 GAGGGAGGGTGCCTGAGACATGG - Intergenic
1070533890 10:77361041-77361063 GCTGGATGGTGACTGAGCTGAGG - Intronic
1071505213 10:86227867-86227889 CCTGCATGGTGCCTGACACATGG + Intronic
1074021989 10:109593819-109593841 GCTGGAATCTGCCTGAGACAGGG + Intergenic
1075366851 10:121897952-121897974 GCTGCATGTTCCCTGAGAAAGGG - Intronic
1075721932 10:124592560-124592582 TCAGGAGGGTGCCGGAGAGAAGG - Intronic
1075734548 10:124655877-124655899 GATGGAAGCTGCCAGAGAGAAGG + Intronic
1075764981 10:124885936-124885958 GATGGATTGAGCCTGGGAGATGG + Intergenic
1076031309 10:127161405-127161427 GTTGGATGCTGGCTGACAGATGG - Intronic
1076543125 10:131227008-131227030 GCTGGAGAGTGCCTGCGAGGGGG - Intronic
1076850388 10:133089489-133089511 GCTTGCTGGTGCCTCAGGGAGGG - Intronic
1077552031 11:3204677-3204699 TCAGGATGGTGCCTGGCAGAGGG - Intergenic
1079706869 11:23632367-23632389 GCTGGATGGGTGCTGAGGGAGGG + Intergenic
1080055303 11:27900643-27900665 TCTGCAGGGGGCCTGAGAGATGG + Intergenic
1083116594 11:60465701-60465723 GATGGATGGTGAATGAGATAGGG + Intronic
1084972504 11:72779618-72779640 GCTGGTTGTTCCCTGAGAGCAGG - Intronic
1085302133 11:75464942-75464964 GCTGGAGGGTGGTGGAGAGACGG - Intronic
1087268690 11:96088753-96088775 GGTAAATGATGCCTGAGAGATGG - Intronic
1088952815 11:114588181-114588203 GCTGGAGGGGGCCCCAGAGAGGG - Intronic
1089361159 11:117887630-117887652 GATGGCCGGTGACTGAGAGAGGG - Intergenic
1089574601 11:119432468-119432490 GTTGCAGGGTGGCTGAGAGACGG + Intergenic
1089698550 11:120230534-120230556 TCTGGATGGTTCCAGAGCGAGGG + Intergenic
1090027832 11:123182838-123182860 GCTGGAGGGTGCGTGAGTGCTGG - Intronic
1090635086 11:128686109-128686131 GCTGGATGCTGGCAGAGAAAGGG + Intergenic
1090677807 11:129019175-129019197 AGTGGGTGGTGCCAGAGAGAGGG - Intronic
1091219479 11:133921463-133921485 GCTGGGTGGTTGCCGAGAGAGGG - Intronic
1091448427 12:558097-558119 CCTGGATGGGGCCTGCGAGATGG + Intronic
1093863907 12:24201710-24201732 GCTTGATGGTGCCAGTGAGATGG - Intergenic
1094076593 12:26482973-26482995 GCTCCATGATGCCTGAGAGGAGG + Intronic
1095949763 12:47775494-47775516 GGTGGATGGTGGCAGGGAGAGGG + Intronic
1097170686 12:57111014-57111036 GGTGGATGGTCCCCAAGAGATGG - Intronic
1098330728 12:69349808-69349830 GCTGAATGTTGCCTGAGGGATGG + Intronic
1099932212 12:89087606-89087628 GCTTGATGGGGCTTGAGACAAGG - Intergenic
1100388856 12:94129553-94129575 GCTGGGTGGAACCTGACAGAGGG + Intergenic
1100515101 12:95319895-95319917 GCTGGATGGTCACAGAGAGAAGG - Intergenic
1101529389 12:105560257-105560279 GCTGGCTGCTGCCTGGCAGATGG - Intergenic
1103215099 12:119195676-119195698 GCTGGGGGGTGCCTGGGAGATGG + Intronic
1103484360 12:121273162-121273184 GCTGGAGGGTGCTTTAGGGATGG + Intronic
1105509289 13:21037889-21037911 TCAGGATGGTGCCTGGGAGTTGG - Intronic
1106183194 13:27385698-27385720 GCCTGATGGTGCTTGAGAGGTGG + Intergenic
1106520704 13:30495192-30495214 GCTAGAAGGTGCGTGAGAAAAGG - Intronic
1110682085 13:78326017-78326039 GGTGAATGGTACCTAAGAGAAGG + Intergenic
1112660718 13:101504306-101504328 GCTGGATCGTGACTCTGAGAGGG - Intronic
1113290739 13:108902956-108902978 GCTGGATGGAGCCAGAGGGCAGG - Intronic
1114064902 14:19052790-19052812 GCTGCATGGTGCCAGAGCCAGGG - Intergenic
1114097359 14:19347212-19347234 GCTGCATGGTGCCAGAGCCAGGG + Intergenic
1114396100 14:22363105-22363127 GCTTGGTGGTGCCTGAGTGGGGG - Intergenic
1114424786 14:22612418-22612440 CCTGTGTGATGCCTGAGAGAAGG + Exonic
1115305877 14:31932999-31933021 GCAAGGTGGTCCCTGAGAGAGGG - Intergenic
1118400356 14:65373882-65373904 GCAGGATTCTGCCTGGGAGAGGG - Intergenic
1119761810 14:77157173-77157195 GATGGCTGGAGCCTGAGAGCTGG - Intronic
1120115332 14:80609935-80609957 TCTTGAGGGTACCTGAGAGATGG - Intronic
1121040626 14:90743863-90743885 GCTGGATGGGGCCAGGGAGGTGG - Intronic
1121667570 14:95684901-95684923 GATGGATTCTGCCTGGGAGAGGG + Intergenic
1121693379 14:95893521-95893543 CCTGGATGCTCCCTGAGAGCAGG + Intergenic
1121700867 14:95953182-95953204 GCTGGAGGGTGAGTGAGAGGTGG - Intergenic
1122217060 14:100211663-100211685 GCTGCCTGGTGCCTCAGAGCTGG - Intergenic
1122601026 14:102922081-102922103 GGTGGATGGTGAGTGATAGAGGG - Intergenic
1122723263 14:103734257-103734279 GCTGTTTGGTGCCTGAAGGATGG - Exonic
1122810886 14:104287351-104287373 GGAGGATGGTGCCTGAGAGCTGG - Intergenic
1124158939 15:27252167-27252189 TAAGGATGATGCCTGAGAGACGG + Intronic
1125163693 15:36677940-36677962 GCTGCAAGTTGCCTGAGACAAGG + Intronic
1125301768 15:38262393-38262415 GCAGGATGGTGACTGTGTGAAGG + Intronic
1125685959 15:41563418-41563440 GCTGGAAGGTGCCAGGGAAATGG + Intronic
1125725415 15:41866004-41866026 GCTGGGTGGGGGCTGAGAGATGG - Intronic
1126664113 15:51060567-51060589 GCAGGTTGGTGCCTGAGGGCAGG + Intronic
1128608168 15:69053865-69053887 GCTGGATGGTGTGGGAGGGAGGG - Intronic
1128905822 15:71466819-71466841 GCTGGATGGGGCATGAGGGGAGG - Intronic
1129675073 15:77628228-77628250 ACTGCATGTTGCCTCAGAGATGG + Intronic
1130474317 15:84250092-84250114 GCTTGCTGGTGCTTGAGATAGGG + Intergenic
1130481731 15:84364154-84364176 GCTTGCTGGTGCTTGAGATAGGG + Intergenic
1133033764 16:3023654-3023676 GCTGGATGGTCCAGGAGAGCGGG - Intronic
1133280302 16:4661362-4661384 GCTGGAGGGTGCAGGAGAAAAGG - Intronic
1136922589 16:34344832-34344854 GCTGGAGGGTTTCTGAGAGGAGG - Intergenic
1136981984 16:35066974-35066996 GCTGGAGGGTTTCTGAGAGGAGG + Intergenic
1137027457 16:35492284-35492306 GGTGGAGGGATCCTGAGAGAGGG - Intergenic
1139380558 16:66527943-66527965 GATGGCTTGAGCCTGAGAGACGG + Intronic
1139429883 16:66905395-66905417 TCTGGAAGGGGCCTGGGAGAAGG + Intergenic
1141410522 16:83829884-83829906 GCTGCAGGGGTCCTGAGAGAGGG + Intergenic
1141900109 16:86985477-86985499 GTGGGCTGGTTCCTGAGAGAAGG + Intergenic
1142010748 16:87712599-87712621 GCTGGAAAGTGACTGAAAGAAGG + Intronic
1142323723 16:89400914-89400936 GCAGGGTGGAGCCTGTGAGAGGG - Intronic
1143227402 17:5317967-5317989 GGTGGGTGGTGCCCCAGAGAGGG + Intronic
1143557698 17:7672492-7672514 GATGGATGGAGCCTGGGAGGTGG + Intronic
1144723044 17:17485530-17485552 GCAGGATGGTGGCTGGAAGAAGG + Intronic
1144837810 17:18166398-18166420 CCTGGATGTGGCCTCAGAGATGG + Exonic
1144960416 17:19041374-19041396 CCTGGGTGGTGGCTGGGAGAGGG - Intronic
1146269148 17:31473101-31473123 GCTGTTTGGTGGCTGAGTGATGG + Intronic
1148694356 17:49550099-49550121 GCTGGAGGCTCCCTCAGAGAGGG + Intergenic
1148861490 17:50606694-50606716 GCTGGAGGGGCCCTGAGAGATGG - Intronic
1149304548 17:55335320-55335342 GGGGGATGGGGCCTGAGAGAAGG - Intergenic
1150305207 17:64078917-64078939 GCTGGCTTGAGCCTGTGAGACGG + Intronic
1150411003 17:64940572-64940594 GCTGGAAGCAGCCTGGGAGATGG - Intergenic
1151033258 17:70766956-70766978 TCTGTTTGGTGCCTGATAGAGGG + Intergenic
1151041911 17:70872635-70872657 GCTGGAGGGTGCCTGTTAGCTGG - Intergenic
1154108234 18:11543313-11543335 GATGGAAGGGTCCTGAGAGATGG + Intergenic
1154457088 18:14539872-14539894 GGTGGAAGGATCCTGAGAGATGG + Intronic
1156947730 18:42855587-42855609 GCTGGATGGTGACTTTTAGAAGG - Intronic
1157300437 18:46475015-46475037 GCTGGAGTGTGTCAGAGAGAAGG + Intergenic
1159456276 18:68663314-68663336 GCCAGGTGGTGCCTGATAGAAGG - Intergenic
1160551619 18:79697151-79697173 GCTGGCAGGTGCCAGAAAGATGG - Intronic
1161014509 19:1977111-1977133 GCTGGATGGTGCCTGAGAGACGG + Intronic
1161347943 19:3777403-3777425 GATGGCTGGGGCCTGAGAAAGGG + Intergenic
1162049036 19:8021048-8021070 GCTGGAGGGTTCTGGAGAGAAGG + Intronic
1162448936 19:10742685-10742707 CCGGGATGGTGCCTGGCAGATGG + Intronic
1163538259 19:17890875-17890897 GCTTGGTGGGGCCTGAGAGGCGG - Exonic
1163649011 19:18506251-18506273 GCTGGAGGGTGCGGGAGACAGGG - Intronic
1163653098 19:18530202-18530224 TCTGGATGCAGCCTGTGAGAAGG - Intergenic
1164610655 19:29629339-29629361 GCAGGATGGTGCTTCTGAGAAGG + Intergenic
1165282939 19:34813793-34813815 CCTGGATTGTGCCAGAGTGAGGG - Intergenic
1165845574 19:38815958-38815980 GCTGGATGCTGCCTTAGCGCTGG - Exonic
1166133996 19:40764243-40764265 GTTGGAGGGTGTCTGGGAGAAGG + Intronic
1166318544 19:42002598-42002620 GCTGGAGGCTGACAGAGAGAGGG + Intronic
1166898510 19:46040027-46040049 GTTGCATGGTTACTGAGAGATGG + Intronic
1166966733 19:46533617-46533639 GCAGGAGGGAGCCTGAGATAGGG - Intronic
925510853 2:4623406-4623428 ACTGGATGGAGCCTGGCAGAGGG + Intergenic
925817668 2:7769104-7769126 GGTGGACTGTGCCTGGGAGATGG - Intergenic
925867884 2:8244828-8244850 TCTGGCTGGGGCCTGAGAGTGGG - Intergenic
925898195 2:8489134-8489156 GCTGGAGGCTGCATGTGAGAAGG + Intergenic
926292249 2:11540389-11540411 CCTGGTTGGTTCCAGAGAGAAGG + Intronic
926599673 2:14828684-14828706 ACATGATGGTGCCTGAGTGAGGG + Intergenic
928497702 2:31850917-31850939 CCAGCATGGTGCCAGAGAGATGG + Intergenic
929531529 2:42756002-42756024 CCTGGGTGGGCCCTGAGAGATGG - Exonic
929779823 2:44950293-44950315 GCAGGTAGGTGCCTGAGGGAAGG - Intergenic
931689776 2:64825649-64825671 GCTGGAAGGTGAGTGAGTGATGG - Intergenic
931789615 2:65652846-65652868 GCTAGAAGCTTCCTGAGAGAAGG + Intergenic
933556089 2:83832421-83832443 GCTGGATGGAGATTGAGAGGTGG - Intergenic
933739194 2:85519985-85520007 TCTGAGTGGTGCCTGTGAGATGG + Intergenic
933941848 2:87251691-87251713 GCTTGATGCTGCCTGGGAGTGGG + Intergenic
934500263 2:94855025-94855047 GATGGACGGGTCCTGAGAGATGG + Intergenic
936117388 2:109712963-109712985 GGGGGATGGTACCTGAGACAAGG + Intergenic
936338375 2:111609878-111609900 GCTTGATGCTGCCTGGGAGTGGG - Intergenic
936488533 2:112948206-112948228 ACTGGCTGGTGGCTGAGTGAGGG + Intergenic
936515688 2:113180071-113180093 TCTGGAGGGCACCTGAGAGAAGG - Intronic
936633217 2:114227079-114227101 GCTGGATGCTGCCTGAGTCCAGG + Intergenic
939519362 2:143210202-143210224 GTTGGGTGGTGCATGAGGGAGGG + Intronic
941443024 2:165562319-165562341 GATGATTGGTGCTTGAGAGAAGG + Intronic
941552231 2:166931400-166931422 GCTGGAAGGAGCTTGAGGGAAGG - Intronic
944359789 2:198840267-198840289 GCTGGAAGGGGCCTTAGAAAGGG - Intergenic
944545464 2:200795140-200795162 GCTGGGTGTTGGGTGAGAGAAGG + Intergenic
948560851 2:238849828-238849850 CCTGGATGGCGGATGAGAGAGGG - Intronic
948830478 2:240596162-240596184 TCTAGCTGGTCCCTGAGAGAGGG + Intronic
948900472 2:240954301-240954323 TGTGGATGGTGTCTGAGACAGGG - Intronic
948900846 2:240956219-240956241 GCTGGCAGGGGCCAGAGAGAGGG + Intronic
948964825 2:241370858-241370880 GCTGGATGCTCCTTGAGGGAAGG - Intronic
949077912 2:242073155-242073177 GCTGCAGTGTCCCTGAGAGAAGG - Intergenic
1169315010 20:4583154-4583176 GCTGGGTGGTTGCTTAGAGATGG + Intergenic
1170954347 20:20964677-20964699 TCTGGATGGAGCCAGAGAGCAGG + Intergenic
1172042467 20:32055137-32055159 GCTGGATGGCTCCCCAGAGAGGG + Intronic
1172271230 20:33656872-33656894 GCTGGGTCCTGCCTGAGGGAGGG - Intergenic
1172599176 20:36171814-36171836 GATGGATGGTGCAGGGGAGAGGG + Intronic
1172762460 20:37332144-37332166 GCTGGCGGGGCCCTGAGAGAAGG + Intergenic
1173733333 20:45343255-45343277 ACTGCATGGTGCCCTAGAGAGGG - Intronic
1173849985 20:46211583-46211605 GCAGGAGGGGGCCTGAGAGCTGG + Intronic
1174040149 20:47693928-47693950 GCTGAATGGTGGCAGAGAGCTGG - Intronic
1175206869 20:57317825-57317847 GCAGGATGGAACCTGCGAGAAGG + Intergenic
1175262396 20:57682774-57682796 GCTAGATGCTGCCTGGGAGCTGG + Intronic
1175354569 20:58354021-58354043 GCTGGATGGGCCCTGAGACATGG - Intronic
1175807059 20:61835550-61835572 GCTGGGAGGTGCCTGGGAGGAGG + Intronic
1176230049 20:64027964-64027986 GATGGAGGGCGCCTGGGAGAGGG + Intronic
1176368142 21:6045912-6045934 GGTGGCTGGAGCCTGAGGGACGG - Intergenic
1177766260 21:25460805-25460827 GATGGATGGTGGGTGAGAGAAGG - Intergenic
1179755377 21:43492630-43492652 GGTGGCTGGAGCCTGAGGGACGG + Intergenic
1179908824 21:44437506-44437528 GCTGGTTGGTGTCTGAGACACGG - Intronic
1180172095 21:46064909-46064931 ACTGGGGGGTGCTTGAGAGATGG + Intergenic
1180219916 21:46352072-46352094 CTTGGATGGTGCCTGAGGGCAGG + Intronic
1180483391 22:15775410-15775432 GCTGCATGGTGCCAGAGCCAGGG - Intergenic
1181627227 22:24130229-24130251 GTTGCATGAGGCCTGAGAGAGGG + Intronic
1182124305 22:27805080-27805102 GCTGGATGGGGCCCCAGAGCTGG + Intergenic
1182747633 22:32617743-32617765 TCTGGCTGGTGCCTGGAAGATGG + Intronic
1183087202 22:35493717-35493739 GCTGGAAGGGACTTGAGAGATGG - Intergenic
1183276044 22:36898822-36898844 GCTGGATGGCTCTTGGGAGATGG + Intergenic
1183474065 22:38026347-38026369 GCTGGCTGGTGGCAGAGAAAGGG - Intronic
1184725251 22:46340820-46340842 GCTTGATAGGGACTGAGAGAAGG + Intronic
1185421813 22:50738995-50739017 GCTGCATGGGCCCTGAGGGATGG - Intronic
949857718 3:8477326-8477348 GTTGGATGGTGACTGAGATAGGG + Intergenic
950024819 3:9813029-9813051 GCAGGGTGGGGCCTGAGCGATGG - Exonic
950376522 3:12576853-12576875 CCAGCATGGTGCCTGAGAGAAGG - Intronic
951939992 3:28067121-28067143 GCTGGCTGTTGCCTGGGACAAGG - Intergenic
952405818 3:33004232-33004254 GCTGGATGATGAAAGAGAGATGG + Intronic
952983192 3:38755114-38755136 GCTGGATTGTGTCACAGAGATGG + Intronic
955352149 3:58201588-58201610 GCTGGAATGTGCCTGCGAGCTGG - Intronic
956834295 3:73083168-73083190 GCAAGATGGTGGCTCAGAGAGGG + Intergenic
957694111 3:83611516-83611538 GTTGGAGGGTCCCTGAAAGAAGG + Intergenic
959072025 3:101711442-101711464 GCTTCATGGTACCTTAGAGATGG + Intergenic
966548554 3:181179475-181179497 GCTGGGTGGAGCATGAAAGAAGG - Intergenic
967267880 3:187707060-187707082 GGTTGATGCTGCCTGTGAGATGG + Intronic
969608001 4:8211866-8211888 GCTGGATGGTGCCACAGGGATGG + Intronic
970406915 4:15772830-15772852 GCTGGTTGGGGACAGAGAGAAGG + Intergenic
970508261 4:16754937-16754959 GCTGGATGGTGCAGGAGAAAGGG - Intronic
970968752 4:21957364-21957386 TCTGGATGGTGACAGAGACATGG - Intergenic
971461320 4:26901069-26901091 GGTGTTTGCTGCCTGAGAGATGG + Intronic
972679849 4:41294859-41294881 GCTCGCTTGTGCCAGAGAGAGGG + Intergenic
976549816 4:86381325-86381347 GGTTGATGGAGCCAGAGAGAAGG - Intronic
980458154 4:133071781-133071803 TCTCAATGGTGCCTGACAGAAGG + Intergenic
984759355 4:183350460-183350482 AGTGGAGGATGCCTGAGAGAAGG - Intergenic
985574167 5:665890-665912 GGTGGGTGGTGCCTGGGGGAGGG - Intronic
987141276 5:14949045-14949067 GATGGCTTGAGCCTGAGAGATGG - Intergenic
987221665 5:15796717-15796739 CCTGGATGGTGCCAAAGAGAGGG - Intronic
988927257 5:36002247-36002269 GATGGCTTGTGCCTGGGAGAGGG - Intergenic
989291567 5:39772452-39772474 ACTGGATAGGGCCTGAGAGCCGG + Intergenic
992112726 5:73511413-73511435 ACTGGAAGGTGCCTGGGAGAGGG + Intergenic
993673763 5:90793879-90793901 CCTGGAATGTGCCAGAGAGAAGG - Intronic
993707648 5:91189581-91189603 TCTGGATGGAGCCTGAGAACAGG + Intergenic
995707833 5:115003341-115003363 GCTGAATGGGGCCTGATAAATGG - Intergenic
995980752 5:118100202-118100224 GATAGATAGTGTCTGAGAGACGG - Intergenic
998371640 5:141665696-141665718 GCTGGTTGGGTCCTGGGAGAGGG - Intronic
999247620 5:150163632-150163654 ACTAGGTGGTGGCTGAGAGATGG - Intergenic
1001194269 5:169657222-169657244 GCTGGAGGGGGTCTGAGAGCAGG + Intronic
1001980182 5:176032888-176032910 GCTGGATGGTGCTACAAAGAAGG + Intronic
1002101697 5:176861081-176861103 GCTGGCAGGTGCCTTAGGGATGG - Intronic
1002237200 5:177810775-177810797 GCTGGATGGTGCTACAAAGAAGG - Intergenic
1002519459 5:179783186-179783208 GCAGGAGTGTGCCTGAGACAAGG + Intronic
1003075823 6:2982971-2982993 GCTGGATGGTGTGTCAGGGATGG + Intergenic
1003875387 6:10431634-10431656 GCTGGAAAGGGCCTCAGAGATGG - Intergenic
1004312356 6:14556627-14556649 TCTGGAGGGTGCCTGTGAGCTGG - Intergenic
1004856301 6:19754047-19754069 GCCAGATGGTGCCTGTCAGAAGG + Intergenic
1005256808 6:24012028-24012050 GCTGCATGGTGGCTGTGAAATGG - Intergenic
1005991245 6:30903807-30903829 CCAGGATGCTGCCTGAGAGGAGG + Intergenic
1006149846 6:31981109-31981131 GCATGATGGTGGCTGAGACAGGG + Exonic
1006156147 6:32013847-32013869 GCATGATGGTGGCTGAGACAGGG + Intergenic
1007615634 6:43178429-43178451 GGTGGATGGTGCCTGGGAGAAGG - Exonic
1008182949 6:48355891-48355913 CCTTGGTGGTGCCTGAGATATGG - Intergenic
1011371770 6:86644634-86644656 GCTGCATGGAGACTGAGAGGTGG - Intergenic
1011418561 6:87148822-87148844 GCTGGATGGAGCCAGAAGGAAGG + Intergenic
1013793184 6:113858382-113858404 GCTGGCTGGGGCCAGACAGAGGG + Intronic
1015700584 6:136031874-136031896 GCTGGAAAATGCCTGAGTGAGGG - Intronic
1017689166 6:156945920-156945942 GATGGCTTGAGCCTGAGAGATGG + Intronic
1019578285 7:1748137-1748159 GCTGGAGCGTGTCTGAGAGCCGG + Intergenic
1020005738 7:4783081-4783103 GCTGGAGGGGGCCTGGGTGAGGG - Intronic
1020066462 7:5191550-5191572 GTTGGATGCTGCCTGGGAGGAGG + Intronic
1022848662 7:34237173-34237195 TCTGGAAGGTGACTGAGAGATGG + Intergenic
1023581642 7:41690246-41690268 GCTGGATGCTGCTGGAGACAGGG + Exonic
1025606591 7:63044156-63044178 GCTAGCTGGTGGCCGAGAGATGG - Intergenic
1029274528 7:99396377-99396399 GCTGGGGGGTGCCTGGGAGATGG - Exonic
1029460525 7:100691672-100691694 GCTGGAAGGGGCCTGTGAGAAGG - Intergenic
1030669979 7:112325366-112325388 GCTGGAAGGAGACTGAGTGAAGG - Intronic
1030899595 7:115105923-115105945 TCTGGTTAGAGCCTGAGAGAGGG + Intergenic
1030909524 7:115229294-115229316 GGTGGATGGGGCGCGAGAGAGGG + Intergenic
1031344981 7:120653459-120653481 CCTGGATTGGACCTGAGAGATGG + Intronic
1032269168 7:130388037-130388059 CCTGGATGGGGCCAGAGAGGAGG - Exonic
1033755492 7:144395812-144395834 AGTGGGTGGTGCCTGGGAGAAGG - Intergenic
1035629891 8:1098942-1098964 GCTAAATGGTGCCTGGGAGGTGG + Intergenic
1035950801 8:4018522-4018544 ACTGGCTGGTCCCAGAGAGAGGG - Intronic
1036227974 8:6975885-6975907 AATGGATGTTGCCAGAGAGAAGG - Intergenic
1036230427 8:6995002-6995024 AATGGATGTTGCCAGAGAGAAGG - Intergenic
1036232879 8:7014105-7014127 AATGGATGTTGCCAGAGAGAAGG - Intronic
1036446546 8:8826202-8826224 TCTGGAAGGCGCCTGAGAAATGG - Intronic
1036448536 8:8844649-8844671 GATGGGTGGTGCATGAGAGATGG - Intronic
1037946208 8:22991127-22991149 GCTGATGGGAGCCTGAGAGAGGG + Intronic
1038503401 8:28063840-28063862 GCTGGAAGGGGACTGGGAGAGGG - Intronic
1042008174 8:64206234-64206256 GCTGGAAGGTACCTGAGTGTGGG + Intergenic
1042667147 8:71219853-71219875 GATAGATGGTGTCTGAGAAATGG - Intronic
1047170014 8:122483608-122483630 GCTGGATGGTGACTGTGGCATGG - Intergenic
1048514552 8:135094128-135094150 GATAGAGGGTGCCTGAAAGATGG + Intergenic
1048812492 8:138301620-138301642 GCTGGCTGGTGCCTAGCAGAGGG - Intronic
1050006869 9:1141170-1141192 ACTGGATGGGGCCTTAGAGTAGG + Intergenic
1050703149 9:8364450-8364472 GCTGGCTGGAGCCTGAGATGAGG + Intronic
1052970447 9:34374029-34374051 GATGGATGATGGCTGAGAGCAGG - Intronic
1053907270 9:42854798-42854820 GATGGACGGGTCCTGAGAGATGG - Intergenic
1054916655 9:70500750-70500772 GCTGGATGCTTCCTAAGAAAAGG - Intergenic
1055897214 9:81192020-81192042 GCTGAATGGTGGCAGAGACATGG + Intergenic
1059239963 9:112796065-112796087 GCTGGGTGGTTCCTGAGAACTGG + Intronic
1059757105 9:117303960-117303982 GCTTGATGGAGGCAGAGAGAAGG + Intronic
1061046102 9:128165991-128166013 GCTGGGTGCTGGCTGAGAGTTGG + Intergenic
1061133350 9:128720411-128720433 GCTGGATGGTGCGGGCGAGCAGG - Exonic
1061188868 9:129070465-129070487 GCTGGGGGGTGGCAGAGAGAAGG + Exonic
1062051830 9:134451399-134451421 GCTGGATTGGGCCTGAGGGAGGG - Intergenic
1062461703 9:136665160-136665182 GGTGCCTGATGCCTGAGAGAGGG + Intronic
1186405709 X:9300475-9300497 TCTGTATGGTTCCTGGGAGAAGG + Intergenic
1186445136 X:9620826-9620848 GCTGGCTGCTGGCTGAGGGACGG + Intronic
1187125482 X:16450448-16450470 GGTGGAAGGAGCCTTAGAGATGG - Intergenic
1187415167 X:19086932-19086954 TCGGGATGGGGCCAGAGAGAAGG + Intronic
1189761813 X:44329687-44329709 GATGGCTTGAGCCTGAGAGATGG - Intronic
1195214166 X:102681064-102681086 ACTGGAAGGTTCCTGAGTGAAGG + Intergenic
1200090093 X:153631589-153631611 GCAGGTTGGTGCATGGGAGAGGG + Intergenic
1202067962 Y:20960324-20960346 GAAGGATGGTGCCTGGGTGAGGG - Intergenic