ID: 1161014510

View in Genome Browser
Species Human (GRCh38)
Location 19:1977112-1977134
Sequence CTGGATGGTGCCTGAGAGAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 224}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161014505_1161014510 -6 Left 1161014505 19:1977095-1977117 CCAACACGGTGACCCAGCTGGAT 0: 1
1: 0
2: 0
3: 8
4: 74
Right 1161014510 19:1977112-1977134 CTGGATGGTGCCTGAGAGACGGG 0: 1
1: 0
2: 2
3: 19
4: 224
1161014504_1161014510 -5 Left 1161014504 19:1977094-1977116 CCCAACACGGTGACCCAGCTGGA 0: 1
1: 0
2: 1
3: 13
4: 91
Right 1161014510 19:1977112-1977134 CTGGATGGTGCCTGAGAGACGGG 0: 1
1: 0
2: 2
3: 19
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161014510 Original CRISPR CTGGATGGTGCCTGAGAGAC GGG Intronic
900433341 1:2613094-2613116 CTGGATGATGACTGTGAGCCAGG + Intronic
900530745 1:3151863-3151885 CTGGAAGGTGCTCCAGAGACAGG - Intronic
900724537 1:4207328-4207350 CTGGAAGGGGCAAGAGAGACAGG - Intergenic
901154604 1:7127098-7127120 CAGCATGGGGCCTGGGAGACAGG + Intronic
902687931 1:18091038-18091060 CTGGAGGCTGCCTGTGAGAAGGG + Intergenic
902826293 1:18976569-18976591 GTGGATGGTGCCTGAGTGCCTGG - Intergenic
903461024 1:23521185-23521207 CTGGTAGCTCCCTGAGAGACAGG - Intronic
905227338 1:36487932-36487954 GTGGATGGGGCCTGAAAGAGTGG - Intergenic
905770532 1:40635449-40635471 ATGGATGGTGACTCATAGACAGG - Intronic
908041439 1:60118249-60118271 CTAAATGGTGCCTCAGAGATCGG + Intergenic
910303080 1:85729434-85729456 CTGGATGTTGCTTTAAAGACTGG + Exonic
910622267 1:89269305-89269327 CTGGATGGTGACTGTGTGAATGG + Intronic
910646032 1:89516226-89516248 CTGAATGGTGCCTGAGCTGCAGG + Intergenic
911852942 1:102841416-102841438 CTGGATTTTATCTGAGAGACAGG - Intergenic
912796482 1:112696500-112696522 CTGCATGGAGCCTGAGAGTCTGG + Exonic
915323185 1:155067218-155067240 CTGGATGGGGCCTGATACATGGG + Intronic
917808954 1:178638802-178638824 CTGGCTGGTACTTGAGAGAAAGG - Intergenic
917869442 1:179229121-179229143 GTGGAAGGTGCCTGAGAGTGGGG - Intronic
918069782 1:181126471-181126493 CAGCATGGTGCCTGTGAAACAGG + Intergenic
918433532 1:184486976-184486998 CTGAATGGTGCCAGAGGGCCAGG - Intronic
919743841 1:200996385-200996407 CTCCATGGTGCCTGAGAGCAAGG + Exonic
922622956 1:227004955-227004977 CAGGAAGGTGCCTCTGAGACAGG - Intronic
922751951 1:228074150-228074172 CGGGATGGTGGCTCAGAGAGGGG - Exonic
1062825685 10:566786-566808 CCGCATGGTGCCTGTGAGCCAGG - Intronic
1062939584 10:1411242-1411264 CTGCATGGTGGCTGAGGCACAGG + Intronic
1063356093 10:5399735-5399757 CTGGCTGTTGACTGAGAGAGTGG - Intronic
1067724644 10:48760809-48760831 CTGGATGCTGGCTGAGATCCTGG + Intronic
1067776852 10:49170448-49170470 GAGGATGGTGCCTAAGGGACTGG - Intronic
1070555969 10:77527928-77527950 CCCCATGGTGCCTCAGAGACAGG - Intronic
1070810465 10:79295095-79295117 CTGCATGGGGCCTGAGTGCCAGG - Intronic
1071791455 10:88958571-88958593 CTGGGTGGAGCCTGACATACAGG - Intronic
1072083057 10:92052568-92052590 CTGGATGGTGGTTGAGAGCATGG + Intronic
1072609354 10:97006379-97006401 CTGCATGGTGCCTGGGGAACTGG - Intronic
1073304381 10:102491651-102491673 CTGGGTGGTACCTGAGATGCTGG - Intronic
1074876717 10:117619305-117619327 CTAGAGCATGCCTGAGAGACGGG + Intergenic
1074962833 10:118463548-118463570 CTGGATGGAGCCTGGAAGTCAGG - Intergenic
1075721931 10:124592559-124592581 CAGGAGGGTGCCGGAGAGAAGGG - Intronic
1077069364 11:660956-660978 CTGGATGGTGCCTCCGTGCCTGG - Intronic
1077552030 11:3204676-3204698 CAGGATGGTGCCTGGCAGAGGGG - Intergenic
1079307795 11:19339021-19339043 CTGCAGGCTGCCTGAGAAACAGG + Intergenic
1082776651 11:57250296-57250318 GTGGCTGCTGCCTGAGAAACAGG - Intergenic
1083237676 11:61362084-61362106 CTGGATGGGGGATGAGAGGCGGG - Exonic
1083747095 11:64742712-64742734 CTGGACTGTGCCTGGGAGGCAGG + Intronic
1083926828 11:65812403-65812425 GGGGATGGTGCCTGGGAGAAAGG - Intergenic
1084335904 11:68457736-68457758 CTGGCTGGTGCCTGAGAGGGAGG - Intergenic
1084533952 11:69745944-69745966 CTGGGTGGTGGCTGAGGGACTGG + Intergenic
1088909520 11:114180273-114180295 CTGCAGGGTACCTGGGAGACTGG + Intronic
1090333219 11:125947017-125947039 ATGGCTGGTCCCTGATAGACTGG + Intergenic
1090528117 11:127559801-127559823 CTTGATGATGCATGAGAGAGAGG + Intergenic
1090915977 11:131162320-131162342 CTGGATGATCCATGAGAGACAGG + Intergenic
1091407993 12:220914-220936 TTGGATGGTGCCTGTGTGCCTGG - Exonic
1091654961 12:2338613-2338635 CTGGGTGATGTCTGAGAGATAGG + Intronic
1093863906 12:24201709-24201731 CTTGATGGTGCCAGTGAGATGGG - Intergenic
1093895061 12:24565343-24565365 CTGGGTGTTGTCTGAGAGAAAGG - Intergenic
1095942220 12:47734865-47734887 TCGGATGGAGCCTGAGAGAGAGG + Intronic
1098330729 12:69349809-69349831 CTGAATGTTGCCTGAGGGATGGG + Intronic
1100515100 12:95319894-95319916 CTGGATGGTCACAGAGAGAAGGG - Intergenic
1102615721 12:114152385-114152407 CTGGCTTGTCACTGAGAGACAGG + Intergenic
1103215100 12:119195677-119195699 CTGGGGGGTGCCTGGGAGATGGG + Intronic
1104050645 12:125191284-125191306 CTGGATGGTGCCTGCAGCACAGG - Intronic
1104053176 12:125209983-125210005 CTGGATGCTGCCTGACACAGAGG - Intronic
1104152413 12:126096305-126096327 CTGGATGGAGCCTCTGAGAGTGG - Intergenic
1106257891 13:28038286-28038308 TTGGATGGTGCAGGAGAGGCAGG + Intronic
1106555639 13:30805964-30805986 CTGGAGGGTGCATGAAAGGCTGG + Intergenic
1107238241 13:38198849-38198871 CAGGATGGTGCCTGATGGAGAGG + Intergenic
1107402611 13:40084163-40084185 CTGGCTGCTACTTGAGAGACAGG - Intergenic
1110239457 13:73250859-73250881 TTGGATGGTGTTTGAGAGTCAGG + Intergenic
1112868306 13:103936328-103936350 CAGGATGTTAGCTGAGAGACAGG + Intergenic
1113913462 13:113855802-113855824 CTGGCAGCTGCCTGAGGGACAGG + Intronic
1114424787 14:22612419-22612441 CTGTGTGATGCCTGAGAGAAGGG + Exonic
1114846798 14:26332523-26332545 CTGGATATGGCCTGAGAGAGAGG - Intergenic
1120115331 14:80609934-80609956 CTTGAGGGTACCTGAGAGATGGG - Intronic
1120668268 14:87333296-87333318 GGGGTTGGTGCCTGAGAGCCTGG - Intergenic
1121419278 14:93801097-93801119 CTGAGTGCTGGCTGAGAGACTGG + Intergenic
1122810885 14:104287350-104287372 GAGGATGGTGCCTGAGAGCTGGG - Intergenic
1124158940 15:27252168-27252190 AAGGATGATGCCTGAGAGACGGG + Intronic
1125447838 15:39776871-39776893 GTGGATCTTGCTTGAGAGACGGG - Intronic
1125725414 15:41866003-41866025 CTGGGTGGGGGCTGAGAGATGGG - Intronic
1125730586 15:41890698-41890720 CTGGGTGGAGCCTGGGAGTCTGG - Intronic
1125965025 15:43867271-43867293 CTAGATGGCTCCTGAGACACAGG + Exonic
1126683680 15:51228303-51228325 CTGGATGATACCTGGGAGGCTGG - Intronic
1129072709 15:72964328-72964350 TTGGATGGTGGCTGAAAGCCAGG - Intergenic
1129675074 15:77628229-77628251 CTGCATGTTGCCTCAGAGATGGG + Intronic
1129932756 15:79426006-79426028 CTGACTGGTGCATGAGAGATTGG - Intronic
1130871739 15:87977491-87977513 ATGGATGGAGCCTGGGAGGCTGG + Intronic
1130911646 15:88274996-88275018 CAGGATGGGGCCTGAGAAAGAGG + Intergenic
1132237866 15:100235431-100235453 ATGGATGACACCTGAGAGACGGG - Intronic
1134306459 16:13037524-13037546 CAGGATGGTGGATGAGAGAATGG + Intronic
1135587504 16:23682015-23682037 CTGGGTTGTGGCTGGGAGACTGG + Intronic
1137627703 16:49920086-49920108 CTGGAGGCTGCCTGAGAGACTGG - Intergenic
1139429884 16:66905396-66905418 CTGGAAGGGGCCTGGGAGAAGGG + Intergenic
1139732623 16:68959666-68959688 CTGGCTGGTGCCCCAGACACAGG + Intronic
1141029002 16:80571632-80571654 TTGGATGGTGCCAGTGGGACTGG - Intergenic
1141298351 16:82790893-82790915 GTGGATTGTGGGTGAGAGACAGG + Intronic
1141797232 16:86283290-86283312 CTGGTTGGTGTCTGGGAGCCCGG - Intergenic
1142417807 16:89952603-89952625 CTGGGTGCTCCCTGGGAGACTGG + Intronic
1143179847 17:4977700-4977722 CTGGATGCTGCTGTAGAGACTGG + Intronic
1143757994 17:9080425-9080447 CTGGATGCTTCTAGAGAGACTGG - Intronic
1144713355 17:17417625-17417647 TTGGGTGGTGCCTGGAAGACTGG + Intergenic
1148335173 17:46836014-46836036 CTGGATGGGGCCTGCGAGGATGG + Intronic
1149304547 17:55335319-55335341 GGGGATGGGGCCTGAGAGAAGGG - Intergenic
1151189221 17:72385983-72386005 CTTAAAGGGGCCTGAGAGACAGG + Intergenic
1153575945 18:6522113-6522135 CTGGGGGCTGCCTGAGAAACTGG - Intronic
1154192800 18:12244472-12244494 CTGGTTGAGGCCTGAGAGTCTGG + Intergenic
1155003064 18:21704895-21704917 CTGGAAGGTTCCTGAGTGGCTGG - Intergenic
1157483981 18:48073939-48073961 CTGGCTGGGGCCTGAGGGGCAGG - Intronic
1157505000 18:48219857-48219879 AGGGATGGAGGCTGAGAGACAGG + Intronic
1161014510 19:1977112-1977134 CTGGATGGTGCCTGAGAGACGGG + Intronic
1161784143 19:6312566-6312588 CTGGCTGGTGACTGAGTGTCTGG - Intronic
1163452068 19:17384155-17384177 CAGGATGGTGCCCTGGAGACAGG + Intergenic
1163538258 19:17890874-17890896 CTTGGTGGGGCCTGAGAGGCGGG - Exonic
1164724092 19:30453563-30453585 CTGAAATGTGCCTGTGAGACAGG + Intronic
1165006558 19:32812231-32812253 CTGGACAGTGCCTGAGACGCGGG - Intronic
1165277451 19:34767296-34767318 CAGGTTGGTGACTGAGAGTCTGG - Exonic
1166545406 19:43631798-43631820 CTGGAAGGTGCCTGAGTCTCTGG + Intronic
1167298712 19:48666967-48666989 CTGGCAGGTCCCTGAGAGCCCGG + Intronic
1167348728 19:48962441-48962463 CTGGCTGGCGACTGAGAGGCTGG + Intergenic
925923430 2:8653576-8653598 CTAGACCGTGTCTGAGAGACGGG + Intergenic
927875632 2:26653570-26653592 CAGGATGGGGCTGGAGAGACAGG - Intergenic
928986358 2:37186136-37186158 CTGGAAGGTGACTGAGACACTGG - Intronic
929605878 2:43233802-43233824 CTGGAGGGTGTCTGAAACACGGG + Intronic
933849604 2:86355324-86355346 GTGTATGGAGCCTGAGACACAGG + Intergenic
934112567 2:88756847-88756869 CTAGGTGGTGACTGAGGGACAGG + Intergenic
935368004 2:102315087-102315109 CTGCAAGGCTCCTGAGAGACAGG - Intronic
935952666 2:108345204-108345226 CTTGCTGGTGCCTGGGAGACTGG - Intergenic
937997574 2:127706652-127706674 CTGGTGGGTGCCAGGGAGACTGG + Intronic
938244553 2:129766515-129766537 CTGGATGGTGTGTGAGAGCGAGG + Intergenic
938462942 2:131509743-131509765 CTGGCTGGTGCCTGGGGGCCTGG + Intergenic
939297591 2:140289893-140289915 CTTGATGGTCCATGAGAAACTGG - Intronic
947875189 2:233463038-233463060 ATGGAAGGTGCCTGAGAGTGTGG - Intronic
947980836 2:234408266-234408288 ATGAATGGAGCCTGAGCGACTGG - Intergenic
948560850 2:238849827-238849849 CTGGATGGCGGATGAGAGAGGGG - Intronic
948892204 2:240913016-240913038 CTGGATGTGGCCTGGGAGATTGG - Intergenic
948926959 2:241105394-241105416 CTGGAAGCTGCCTGGGAGCCAGG - Intergenic
1170006269 20:11672883-11672905 TTGGATGCTGACTGAGACACTGG - Intergenic
1170059018 20:12240091-12240113 CTGCAGGTTGACTGAGAGACTGG + Intergenic
1174050575 20:47764653-47764675 TTGGATGGAGCCCGAGAGAGAGG + Intronic
1174822304 20:53737260-53737282 CAGGATGCAGCCTGAGAGGCAGG - Intergenic
1177766259 21:25460804-25460826 ATGGATGGTGGGTGAGAGAAGGG - Intergenic
1179420078 21:41228484-41228506 CTGGAAGCAGCCTGAGAGCCTGG - Intronic
1179908823 21:44437505-44437527 CTGGTTGGTGTCTGAGACACGGG - Intronic
1180087447 21:45514324-45514346 GTGGATGGTGCCAGTCAGACAGG - Exonic
1180219917 21:46352073-46352095 TTGGATGGTGCCTGAGGGCAGGG + Intronic
1180632842 22:17241693-17241715 CTGGCTGGTGCCTGGGAGCGTGG + Intergenic
1181112972 22:20612648-20612670 CTGGCTGGTGCCTGGGGGGCTGG - Intergenic
1181636910 22:24178756-24178778 CTGGCTGGTCCCTGAGATGCTGG - Intergenic
1184321059 22:43742597-43742619 CTGCATGGTCCCAGAGAGTCTGG + Intronic
1184414574 22:44344851-44344873 CTGGAAGGGGCCTGGGAGGCGGG - Intergenic
949580776 3:5385451-5385473 GGAGATGGTGTCTGAGAGACAGG - Intergenic
949926335 3:9045225-9045247 ATGGATGGTTCTTGATAGACTGG - Intronic
950995803 3:17494721-17494743 CCCGATGGTGCCAGGGAGACTGG - Intronic
954086562 3:48248955-48248977 CTGGAAGCTGCCCTAGAGACTGG - Intronic
954443916 3:50536461-50536483 CTGGCTGGTGGCAGAGAGAATGG - Intergenic
955295447 3:57730461-57730483 CTGCAGGATGCCTGGGAGACAGG + Intergenic
955361930 3:58283145-58283167 CTGGGTGTTTCCTGAGGGACAGG - Intronic
955536933 3:59933652-59933674 CTGGATGGTTCCAAACAGACTGG - Intronic
958033310 3:88140733-88140755 TTGGAAGGTGCCTGAGATACTGG - Exonic
959943228 3:112101551-112101573 CTGGCTGGTGTCTGAGAACCTGG - Intronic
961366990 3:126406440-126406462 CTGGTCGGTGCCTGAGGGGCAGG - Intronic
961470430 3:127107856-127107878 CTGGCTTGTGCCTTAGAGGCAGG + Intergenic
963706364 3:148693032-148693054 CTGGATTGTGCCTCTGCGACAGG - Intergenic
966083803 3:176041342-176041364 CAGGATGGTGAGTGAGAGAGAGG + Intergenic
967039514 3:185677269-185677291 CTGGAAGGTGCCAGAAAAACTGG + Intronic
967081907 3:186057426-186057448 TTGTGTTGTGCCTGAGAGACTGG - Exonic
970418449 4:15882317-15882339 CCGAATGCTGCCAGAGAGACTGG + Intergenic
975663656 4:76711896-76711918 CTGGCTGGTGTCTGAGAGTCAGG + Intronic
978885610 4:113762505-113762527 CAGGATGGTGGCTGAGACTCTGG + Intergenic
984759354 4:183350459-183350481 GTGGAGGATGCCTGAGAGAAGGG - Intergenic
984777169 4:183491708-183491730 AGGAATGGTGCCTAAGAGACAGG - Intergenic
985277406 4:188251253-188251275 CGAGATGGTGGCTGAGAGAATGG - Intergenic
985315194 4:188651133-188651155 CTGGATGGAGCCTGAGAAGCAGG - Intergenic
985495093 5:199716-199738 CTGGTTGGTGGCTGACAGGCAGG - Exonic
985710175 5:1423439-1423461 CTGGCTGGTGCCTGTGTGCCTGG - Intronic
986623050 5:9695793-9695815 CTGAATGGAGCCTGAGAGGCAGG + Intronic
987212357 5:15695632-15695654 CTGCATGGTGACTGACACACAGG - Intronic
989194843 5:38706765-38706787 CTGGCTGCTGCCTGACACACAGG - Intergenic
989291568 5:39772453-39772475 CTGGATAGGGCCTGAGAGCCGGG + Intergenic
989406605 5:41068101-41068123 CTGGATGATGAAAGAGAGACTGG + Intronic
993421031 5:87701034-87701056 CCTGCTGGTGCCAGAGAGACTGG - Intergenic
993430382 5:87825611-87825633 CTGGAAGGTGACTTAAAGACAGG - Intergenic
996037517 5:118774760-118774782 CTGGATGACTCCTGAGAGCCTGG - Intergenic
997587716 5:135053413-135053435 CTGGGTGCTGCCAGAGAGACAGG - Intronic
997654745 5:135546452-135546474 CTGGCTGGGGCCTGACAGCCAGG + Intergenic
998151211 5:139758595-139758617 CTGGAAGGTAAATGAGAGACTGG + Intergenic
999202876 5:149828748-149828770 CTGGAAGGGCCCTGAGGGACCGG + Intronic
999247619 5:150163631-150163653 CTAGGTGGTGGCTGAGAGATGGG - Intergenic
999280258 5:150360549-150360571 ATGGATAGTGCCAGAGAGGCTGG + Intronic
1000295988 5:159914069-159914091 CTGGAAGATGCATGAGAGAAAGG + Intergenic
1000541795 5:162550003-162550025 GTGGCTGGTGCCTGTGATACGGG + Intergenic
1001052342 5:168423529-168423551 CTGCATGCTGCTTGAGAGACTGG - Exonic
1001687153 5:173602280-173602302 CGGGAGGGTATCTGAGAGACTGG + Intergenic
1001740701 5:174050774-174050796 CTGCCTGGTGCTGGAGAGACTGG + Intronic
1002330608 5:178437821-178437843 CTGGAGGGTGCTTGTGGGACGGG + Intronic
1002367291 5:178723404-178723426 TTGGTTGGTGCTTGAGAGCCAGG - Intronic
1003231537 6:4258094-4258116 GTGGATGGTGTTTGAGAGGCAGG - Intergenic
1004871962 6:19914064-19914086 ATGAATGGTGCATGAGAGAAAGG + Intergenic
1007358248 6:41336083-41336105 TTGGATTGTGCCTGAGAGCCTGG - Exonic
1012466352 6:99520973-99520995 CTGGAGGGCGCCGGAGAGCCTGG + Intronic
1016257826 6:142130102-142130124 CTGGATGGTGCTGCAGAGCCTGG - Intergenic
1018603949 6:165577669-165577691 GTGGATGGTGGCTGGGAGGCAGG - Intronic
1018733303 6:166669277-166669299 ATAGAGGGTGCCAGAGAGACAGG - Intronic
1018915109 6:168128291-168128313 CTGCCTGGTGTCTGAGAGCCCGG + Intergenic
1019479627 7:1260466-1260488 CTGGATGGGGCAGGAGAAACAGG + Intergenic
1022091667 7:27111595-27111617 CTGGGAAGTGCCTGAGAAACAGG - Intronic
1022881161 7:34588756-34588778 CTGCATGGGGTCTGAGAGGCTGG - Intergenic
1023224188 7:37952118-37952140 CTGGGTGGTGGCTGAGGGAGTGG - Intronic
1027175350 7:75899603-75899625 CTGGATGGTGTCACAGGGACAGG + Intronic
1028665636 7:93340831-93340853 CTGGATGGTGCTGAAGAGCCTGG + Intronic
1029274527 7:99396376-99396398 CTGGGGGGTGCCTGGGAGATGGG - Exonic
1029435515 7:100562099-100562121 CTGGGTGGTCCCTGAGAAAATGG + Intronic
1030434101 7:109493198-109493220 GTGGATGGTGCCAGGGAGGCAGG - Intergenic
1033490702 7:141840867-141840889 TTGGATGGAGTCTGAGAGGCAGG + Intronic
1033755491 7:144395811-144395833 GTGGGTGGTGCCTGGGAGAAGGG - Intergenic
1036358243 8:8059880-8059902 CTGGATGCTGTCTGGGAGGCTGG + Intergenic
1036446545 8:8826201-8826223 CTGGAAGGCGCCTGAGAAATGGG - Intronic
1036455413 8:8902433-8902455 CTGTATGGTGCCTCAGTGAAAGG + Intergenic
1036456005 8:8908591-8908613 GGGGATTGAGCCTGAGAGACAGG + Intergenic
1037002900 8:13742530-13742552 TTGGAAGGTGCCTGAGATACTGG - Intergenic
1037700299 8:21267728-21267750 CAGGATGATGCCTGAGAGACAGG + Intergenic
1037742931 8:21621789-21621811 CTGGATGGTGACTGCTATACTGG - Intergenic
1042281815 8:67064113-67064135 CTGGCTGGTGCATGGGAGGCTGG + Intronic
1042506334 8:69564928-69564950 CTGGGTGATGCCTGAGAGCAAGG - Intronic
1045406979 8:101876367-101876389 CTAGTTGCTGCCTGAAAGACTGG + Intronic
1046843306 8:118885621-118885643 CCAGATGCTGCCTGAGGGACTGG + Intergenic
1048586766 8:135781300-135781322 CTGGGTGGAGCCTGAGATAGAGG + Intergenic
1048867057 8:138769008-138769030 CTGGAGGGGGCTGGAGAGACAGG - Intronic
1049625357 8:143617416-143617438 CTGGATGCTCCGTGAGAGTCAGG - Intronic
1050314799 9:4390591-4390613 CTGTATGAGGCCAGAGAGACTGG - Intergenic
1052916046 9:33925105-33925127 CTGGATGGTGAGTGAGGGTCAGG - Intronic
1056492482 9:87121247-87121269 TGGGATGGGGCCTGAGAGTCTGG - Intergenic
1057702017 9:97370203-97370225 TTGGATGGGGGCTGAGGGACAGG + Intronic
1057713540 9:97468780-97468802 CTTGATGGTGCCAGAGAACCAGG + Intronic
1058533907 9:105934815-105934837 ATGGATGCTGGCTGAGACACAGG + Intergenic
1059368559 9:113806606-113806628 ATGGGTGGTGGCTGAGAGGCTGG - Intergenic
1060055881 9:120412530-120412552 CTGGACGCTGTCTGAGAGACTGG + Intronic
1060756774 9:126219560-126219582 CTGGATGGAGGCAGAGAGATAGG - Intergenic
1061223648 9:129267353-129267375 CAGGAAGGTGGCTGAGGGACAGG + Intergenic
1062051829 9:134451398-134451420 CTGGATTGGGCCTGAGGGAGGGG - Intergenic
1062649743 9:137569446-137569468 ATGGATGGTGGGTGAGTGACTGG - Intronic
1187146614 X:16643333-16643355 CTGTATGTTGCCTAAGAGTCTGG - Intronic
1189212255 X:39293482-39293504 CTCGATTTTGCCTGAGAAACAGG + Intergenic
1189736138 X:44071804-44071826 CTAGCAGGTCCCTGAGAGACTGG + Intergenic
1190031632 X:46978626-46978648 GTTGATGAGGCCTGAGAGACTGG + Intronic
1190727342 X:53198224-53198246 CTGGAAGTGGCCTGAGAGAGAGG - Intronic
1198363368 X:135917192-135917214 CTGGATGCTGCCACAGAGCCTGG - Intergenic
1201049887 Y:9922044-9922066 CTGGATGAAGCCAGAGAGAATGG - Intergenic