ID: 1161014511

View in Genome Browser
Species Human (GRCh38)
Location 19:1977113-1977135
Sequence TGGATGGTGCCTGAGAGACG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 148}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161014504_1161014511 -4 Left 1161014504 19:1977094-1977116 CCCAACACGGTGACCCAGCTGGA 0: 1
1: 0
2: 1
3: 13
4: 91
Right 1161014511 19:1977113-1977135 TGGATGGTGCCTGAGAGACGGGG 0: 1
1: 0
2: 1
3: 12
4: 148
1161014505_1161014511 -5 Left 1161014505 19:1977095-1977117 CCAACACGGTGACCCAGCTGGAT 0: 1
1: 0
2: 0
3: 8
4: 74
Right 1161014511 19:1977113-1977135 TGGATGGTGCCTGAGAGACGGGG 0: 1
1: 0
2: 1
3: 12
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161014511 Original CRISPR TGGATGGTGCCTGAGAGACG GGG Intronic
900623878 1:3599389-3599411 TGCAGGGTGGCTGAGAGCCGAGG - Intronic
902669322 1:17961680-17961702 TGGGTGGTGCCTGAGAGCAAAGG - Intergenic
902923378 1:19680393-19680415 GGGAGGGTCCCTGAGAGATGGGG - Intergenic
903602344 1:24551896-24551918 TGGATGAGGCCTCAGAGACAAGG + Intergenic
904180793 1:28665305-28665327 TGGGAGGTGACTGAGAGATGAGG + Intergenic
904999092 1:34654128-34654150 TGCATGGTCCCTGCAAGACGAGG - Intergenic
907479917 1:54738374-54738396 CGGATGGTGCCTGAGTGATATGG - Intronic
908087171 1:60647980-60648002 TGGAAGGTGTCTGAGTCACGGGG - Intergenic
908586534 1:65576204-65576226 TGGACAGTGCCTGAGAGCAGTGG - Intronic
911664466 1:100538348-100538370 TGGATGCTGCTTGGGAGAAGCGG + Exonic
917869441 1:179229120-179229142 TGGAAGGTGCCTGAGAGTGGGGG - Intronic
918212794 1:182366525-182366547 TGGAAGGTGCCAGAGAGATAAGG + Intergenic
920528959 1:206687809-206687831 GGGAAGGTGCCTGAGAAAAGGGG + Intronic
921352357 1:214249221-214249243 TGTATGGTGCTTGAGAAATGGGG - Intergenic
924455634 1:244216945-244216967 GGTGTGGTGCCTGAGAGAGGAGG + Intergenic
924715108 1:246566141-246566163 TGGAGCGGGCCTGAGAGACAAGG - Exonic
1068864843 10:61884010-61884032 TGGTTGGTGTTTTAGAGACGGGG + Intergenic
1070775874 10:79109529-79109551 TGGATGGTGCTGGAGAGGGGAGG + Intronic
1072326409 10:94303033-94303055 TGGCAGGGGCCTGAGAGATGAGG + Intronic
1075721930 10:124592558-124592580 AGGAGGGTGCCGGAGAGAAGGGG - Intronic
1077184098 11:1228791-1228813 GGGATTGTGCCAGAGAGAAGGGG + Intronic
1077248428 11:1550143-1550165 GGAATGGTGCCTGAGAGACCAGG + Intergenic
1077552029 11:3204675-3204697 AGGATGGTGCCTGGCAGAGGGGG - Intergenic
1079129570 11:17739577-17739599 TGGAGAGTGCGTGAGAGTCGAGG + Intronic
1079604225 11:22344374-22344396 AGTATGGGGCCTGAGAGATGAGG - Intronic
1083237675 11:61362083-61362105 TGGATGGGGGATGAGAGGCGGGG - Exonic
1083883845 11:65561183-65561205 GGGAGGGTGCCTGAGAGGTGTGG + Intergenic
1085149136 11:74234078-74234100 TGGATGTTGGGAGAGAGACGGGG + Intronic
1090333220 11:125947018-125947040 TGGCTGGTCCCTGATAGACTGGG + Intergenic
1090405992 11:126476026-126476048 TGGAAAGTGCCTGAGAGCAGAGG + Intronic
1090681273 11:129059877-129059899 TGGAGTGTGCCTGTGAGAAGAGG - Intronic
1091195462 11:133727144-133727166 TGGATGGGGCATGAAAGACATGG - Intergenic
1091303981 11:134525031-134525053 TGAATGGTGCCTCAGAAACACGG + Intergenic
1092259043 12:6942602-6942624 TGGCTTATGCCTGTGAGACGCGG + Intergenic
1093863905 12:24201708-24201730 TTGATGGTGCCAGTGAGATGGGG - Intergenic
1095942221 12:47734866-47734888 CGGATGGAGCCTGAGAGAGAGGG + Intronic
1097224314 12:57468119-57468141 TGGATGGTGCCCGAGGCAGGGGG - Exonic
1097862817 12:64534953-64534975 TAGATGGTGCCTTAGAGATGAGG - Intergenic
1102214540 12:111151126-111151148 TGGTTCCTGCCTGAGAGCCGTGG + Intronic
1103215101 12:119195678-119195700 TGGGGGGTGCCTGGGAGATGGGG + Intronic
1105422662 13:20266694-20266716 TAAATGGTGGCTGAGAGACAAGG + Intergenic
1106257892 13:28038287-28038309 TGGATGGTGCAGGAGAGGCAGGG + Intronic
1111876966 13:93909888-93909910 TGGATGGAACCTGAGAGCAGAGG - Intronic
1113595985 13:111533319-111533341 TAGATTGTGCCTGAGAGAACAGG + Intergenic
1117538235 14:56721785-56721807 TGGAGGGAGCCTGAGAGCAGGGG + Intronic
1117848263 14:59936994-59937016 AGGATGGTGCCTGAGGTAGGAGG - Intronic
1119739342 14:77004096-77004118 TGGAAGGTGCCTGGTAGGCGTGG + Intergenic
1122288749 14:100668194-100668216 TGGATGGAGTCTGAGAGGCAAGG + Intergenic
1124158941 15:27252169-27252191 AGGATGATGCCTGAGAGACGGGG + Intronic
1125725413 15:41866002-41866024 TGGGTGGGGGCTGAGAGATGGGG - Intronic
1129072708 15:72964327-72964349 TGGATGGTGGCTGAAAGCCAGGG - Intergenic
1130059559 15:80559759-80559781 TGGAAGGTGCCTGAGTGGAGAGG - Intronic
1134202968 16:12214071-12214093 TGGAGGTCGCCAGAGAGACGAGG - Intronic
1134608181 16:15587344-15587366 TGGGTGGTGCCCGAGAGACACGG - Exonic
1137627702 16:49920085-49920107 TGGAGGCTGCCTGAGAGACTGGG - Intergenic
1137849335 16:51723161-51723183 TGGATAGTGCTTTAGAGAGGGGG + Intergenic
1139321284 16:66116509-66116531 TGGATAGTTCCTGAGAGCAGGGG - Intergenic
1139429885 16:66905397-66905419 TGGAAGGGGCCTGGGAGAAGGGG + Intergenic
1141791704 16:86241227-86241249 TGGAAGGTAGCTGAGAGGCGGGG + Intergenic
1141900111 16:86985479-86985501 GGGCTGGTTCCTGAGAGAAGGGG + Intergenic
1143299269 17:5897615-5897637 TGAATGCTGCCTGAGTGCCGTGG + Intronic
1144713356 17:17417626-17417648 TGGGTGGTGCCTGGAAGACTGGG + Intergenic
1146487745 17:33257619-33257641 TGGATGATGGCTGAGAGTTGAGG + Intronic
1147210809 17:38871402-38871424 TGGGTGGTGGATGAAAGACGCGG - Intronic
1148085961 17:44994041-44994063 GGGATGGGGCCTGAGAGGCCAGG - Intergenic
1148746141 17:49919630-49919652 AAGAAGGTGCCTGAGAGATGAGG - Intergenic
1148795433 17:50194655-50194677 TGGCTGGTGCCTGTGTGTCGCGG - Intronic
1150715619 17:67570310-67570332 AGGATGGAGCCTGGGACACGTGG + Intronic
1157113864 18:44845284-44845306 TGGATGGTTCCTGAGATTCCAGG - Intronic
1161014511 19:1977113-1977135 TGGATGGTGCCTGAGAGACGGGG + Intronic
1162931630 19:13960517-13960539 TGGCTGGTGCCGGAGAGCAGCGG + Exonic
1163068479 19:14817528-14817550 TGGATGGGGTCTCAGAGAAGAGG - Intronic
1163434577 19:17287755-17287777 TGGATGGAGCCTGCCAGGCGCGG + Intergenic
1163538257 19:17890873-17890895 TTGGTGGGGCCTGAGAGGCGGGG - Exonic
1164826925 19:31290680-31290702 TGGATGGTACCAGGGAGACCAGG + Intronic
1166366054 19:42279094-42279116 TGGGTAGGGCCTCAGAGACGAGG + Intronic
1168670613 19:58238470-58238492 TGCATAGTGCCTGGAAGACGGGG + Intronic
925923431 2:8653577-8653599 TAGACCGTGTCTGAGAGACGGGG + Intergenic
930111778 2:47684956-47684978 TGGATGGTGCCAGGCTGACGTGG - Intergenic
934576278 2:95403418-95403440 TGGCTGTTGCCTCAGGGACGAGG - Intronic
934638463 2:96011251-96011273 TGGCTGTTGCCTCAGGGACGAGG - Intergenic
935952665 2:108345203-108345225 TTGCTGGTGCCTGGGAGACTGGG - Intergenic
937224935 2:120363307-120363329 AGGATGGTCCCTGAGAGAGTAGG + Intergenic
937841369 2:126527812-126527834 TGGAAGGTGCTTGAGTCACGGGG - Intergenic
938003451 2:127766889-127766911 TGGCACGTGCCTGAGAGAGGAGG - Intronic
938565543 2:132515196-132515218 TGGAAGGGGCCTTAGAGATGTGG - Intronic
944741063 2:202613140-202613162 TAGCTCGTGCCTGAGAGATGGGG + Intergenic
1168999277 20:2155376-2155398 TGGATGGGGCCTGGGAGAGGAGG + Intronic
1169409568 20:5356090-5356112 TCAATGGAGCCTGAGAGAGGAGG + Intergenic
1175586158 20:60141822-60141844 TGACTGGAGCCAGAGAGACGGGG - Intergenic
1176108862 20:63402055-63402077 TGGAGGGTGCCCGGCAGACGTGG - Intergenic
1176108900 20:63402230-63402252 TGGAGGGTGCCCGGCAGACGTGG - Intergenic
1179582382 21:42351969-42351991 AGGATGGAGCCTGGGGGACGAGG - Intergenic
1179975197 21:44861497-44861519 TGGAAGAGGCCTGAGTGACGCGG - Intronic
1180087446 21:45514323-45514345 TGGATGGTGCCAGTCAGACAGGG - Exonic
1180219918 21:46352074-46352096 TGGATGGTGCCTGAGGGCAGGGG + Intronic
1183363299 22:37394182-37394204 TGGATGGGAAATGAGAGACGAGG - Intronic
1183378510 22:37479067-37479089 TGGATGCTCCCTGAGTGACCAGG + Intronic
1185054073 22:48568977-48568999 TGGAGGGTGCCTGATAGCCCTGG - Intronic
1185062107 22:48612503-48612525 TGGAGGGTCCAGGAGAGACGAGG - Intronic
949165751 3:938712-938734 TGGATGTTTCCCGAGGGACGAGG - Intergenic
949747029 3:7307109-7307131 ATGCTGGTGCCTGAGAGAGGTGG - Intronic
951323032 3:21270792-21270814 TGAATGGTGCTTGTGAGATGTGG - Intergenic
952507150 3:34017650-34017672 TGTATGGTGCCAGAAAGACCAGG - Intergenic
953040794 3:39253244-39253266 TGGTTGGAGCCTTAGAGACCAGG - Intergenic
954292859 3:49658846-49658868 TGGATGGGGACTGTGAGAAGTGG + Intronic
958524213 3:95232832-95232854 TGCATGGTGCCTGTGAAATGTGG + Intergenic
961369497 3:126420684-126420706 TTGATGGACCCTGAGAGAGGTGG + Intronic
961392766 3:126565199-126565221 TGGAAGGTGAGTGAGAGAAGAGG + Intergenic
961827735 3:129607441-129607463 TGGACAGTGCCTGAGAAAGGTGG - Intergenic
965740122 3:171865449-171865471 TGGCTGGGGTCTGAGAGATGAGG - Intronic
969389011 4:6876855-6876877 TGGCTGGTTCCTGGGAGAGGTGG - Intronic
971461322 4:26901071-26901093 TGTTTGCTGCCTGAGAGATGGGG + Intronic
972359538 4:38314478-38314500 TGGATGGAGCCCAAGACACGTGG + Intergenic
982238584 4:153275825-153275847 TGTATGGTACCTGTGAGAAGTGG + Intronic
982872484 4:160600338-160600360 TGCATGGTGAGTGAGAGAAGAGG - Intergenic
983824895 4:172247350-172247372 TTGATGGTTTCTTAGAGACGTGG + Intronic
984759353 4:183350458-183350480 TGGAGGATGCCTGAGAGAAGGGG - Intergenic
989291569 5:39772454-39772476 TGGATAGGGCCTGAGAGCCGGGG + Intergenic
992620924 5:78592016-78592038 TGGAGAGTGTCTGAAAGACGTGG + Intronic
993661001 5:90634963-90634985 GGGATGGTGAATGAGAGAGGAGG + Intronic
996237548 5:121150514-121150536 CGGATGGTGTCTGGGAGACAAGG + Intergenic
997587715 5:135053412-135053434 TGGGTGCTGCCAGAGAGACAGGG - Intronic
999247618 5:150163630-150163652 TAGGTGGTGGCTGAGAGATGGGG - Intergenic
999280259 5:150360550-150360572 TGGATAGTGCCAGAGAGGCTGGG + Intronic
1001052341 5:168423528-168423550 TGCATGCTGCTTGAGAGACTGGG - Exonic
1001437297 5:171710065-171710087 TGGCCGGTGCCTGAGAGCCTTGG - Intergenic
1001824576 5:174734841-174734863 TGCCTGGTGCCTGGGAGACCTGG - Intergenic
1002759190 6:188826-188848 AGGAGGGTGCCTGAGAGCTGAGG + Intergenic
1003231536 6:4258093-4258115 TGGATGGTGTTTGAGAGGCAGGG - Intergenic
1003270023 6:4600442-4600464 TGGCTGGATCCTGTGAGACGGGG - Intergenic
1004264943 6:14141101-14141123 TGGGTTGTGCCTGAGTGATGTGG + Intergenic
1004871963 6:19914065-19914087 TGAATGGTGCATGAGAGAAAGGG + Intergenic
1006806514 6:36792815-36792837 GGGATGGTGCCTGAAGGAGGGGG - Intronic
1018603948 6:165577668-165577690 TGGATGGTGGCTGGGAGGCAGGG - Intronic
1018895380 6:168013043-168013065 CTGATGGTGGCTGAGAAACGGGG + Intronic
1019022346 6:168929999-168930021 CAGATGGTGCCCGAGAGCCGGGG + Intergenic
1021061926 7:16123641-16123663 TGTATGGTGCCTAAGAGGCATGG + Intronic
1023104689 7:36751932-36751954 TGGATGGAGACTGGGAGAGGTGG + Intergenic
1024145560 7:46513188-46513210 TGGATGGGGCCTGAGAGGAGAGG - Intergenic
1024944645 7:54796597-54796619 TGGGTGCTGCCTGAGAGAGAAGG - Intergenic
1026455720 7:70570927-70570949 TGCATGGGGCCTTAGAGAGGTGG - Intronic
1027262946 7:76478052-76478074 TGTATAGTGCTTGAGAGACGAGG - Intronic
1027314330 7:76976153-76976175 TGTATAGTGCTTGAGAGACGAGG - Intergenic
1029274526 7:99396375-99396397 TGGGGGGTGCCTGGGAGATGGGG - Exonic
1030892812 7:115021315-115021337 TGAATAGTGCCTGAGAGATAAGG + Intergenic
1034588864 7:152121575-152121597 TGGACAGTGCCTGAGAGCAGTGG + Exonic
1041012887 8:53560784-53560806 TGGATGTTTCCAGAGAGCCGAGG - Intergenic
1042149380 8:65765655-65765677 TGGATGTTGGCAGAGAGACCAGG + Intronic
1045676719 8:104615257-104615279 AGGATGGTGCATGAGGGACCAGG + Intronic
1047072011 8:121355720-121355742 TGGATGGTGACTGCCAGAGGCGG - Intergenic
1051560826 9:18438530-18438552 GGGATGGGGCCGGAGAGAGGAGG - Intergenic
1052856273 9:33408462-33408484 GAGATGGAGCCTGAGAGAGGTGG - Intergenic
1055212312 9:73811551-73811573 TGAATGGTGCATGGGAGATGGGG + Intergenic
1056946705 9:91003796-91003818 TGGAAAGTCCCTGAGAGAAGAGG - Intergenic
1060106068 9:120874384-120874406 GGGATGGTGCCTGCAAGACCAGG + Intronic
1186046821 X:5545433-5545455 TGGATGGTGCCTTAAGGACTAGG + Intergenic
1187125480 X:16450446-16450468 TGGAAGGAGCCTTAGAGATGGGG - Intergenic
1190031633 X:46978627-46978649 TTGATGAGGCCTGAGAGACTGGG + Intronic
1191640655 X:63427644-63427666 TGGTTGGAGCCTGAAAGACCAGG + Intergenic
1195853012 X:109303596-109303618 TGAATAGTTCCTCAGAGACGTGG + Intergenic
1200074547 X:153544627-153544649 GGGATGGGGCGGGAGAGACGGGG - Intronic