ID: 1161014513

View in Genome Browser
Species Human (GRCh38)
Location 19:1977126-1977148
Sequence AGAGACGGGGCTGCCCCACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 491
Summary {0: 1, 1: 0, 2: 0, 3: 36, 4: 454}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161014508_1161014513 -5 Left 1161014508 19:1977108-1977130 CCAGCTGGATGGTGCCTGAGAGA 0: 1
1: 0
2: 2
3: 15
4: 165
Right 1161014513 19:1977126-1977148 AGAGACGGGGCTGCCCCACATGG 0: 1
1: 0
2: 0
3: 36
4: 454
1161014504_1161014513 9 Left 1161014504 19:1977094-1977116 CCCAACACGGTGACCCAGCTGGA 0: 1
1: 0
2: 1
3: 13
4: 91
Right 1161014513 19:1977126-1977148 AGAGACGGGGCTGCCCCACATGG 0: 1
1: 0
2: 0
3: 36
4: 454
1161014505_1161014513 8 Left 1161014505 19:1977095-1977117 CCAACACGGTGACCCAGCTGGAT 0: 1
1: 0
2: 0
3: 8
4: 74
Right 1161014513 19:1977126-1977148 AGAGACGGGGCTGCCCCACATGG 0: 1
1: 0
2: 0
3: 36
4: 454
1161014507_1161014513 -4 Left 1161014507 19:1977107-1977129 CCCAGCTGGATGGTGCCTGAGAG 0: 1
1: 0
2: 0
3: 14
4: 173
Right 1161014513 19:1977126-1977148 AGAGACGGGGCTGCCCCACATGG 0: 1
1: 0
2: 0
3: 36
4: 454

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161014513 Original CRISPR AGAGACGGGGCTGCCCCACA TGG Intronic
900267260 1:1764248-1764270 AGAGCCGGCGCTGCCTAACAAGG - Intronic
900360834 1:2288170-2288192 AGAGATGGGGTTTCTCCACATGG + Intronic
900360858 1:2288305-2288327 AGAGACAGGGTTTCTCCACATGG + Intronic
900483706 1:2911422-2911444 AGAGACAGGGCTGCCTCTCGGGG - Intergenic
900991257 1:6099410-6099432 ACAGAGGGGCCTGCCCCACTGGG - Exonic
901357872 1:8667473-8667495 TGAGACGAGCCTGGCCCACATGG + Intronic
901399937 1:9008780-9008802 AGAGACGGGGTTTCACCACGTGG + Intronic
901684071 1:10934075-10934097 AGAGATGGGCCTGGCCAACATGG + Intergenic
901923162 1:12550095-12550117 GGAGCCGGGGCTGCCCCGCGCGG - Intergenic
902879992 1:19365643-19365665 AGAGACGGGGCTTCTCCATGTGG - Intronic
903212603 1:21827005-21827027 AGAGACAGGCCTGGCCAACATGG + Intronic
903755270 1:25656296-25656318 CGAGACCGGGCTGCCCAACATGG - Intronic
904819515 1:33232447-33232469 AGAGACGGGGCTTCACCATGTGG + Intergenic
905435645 1:37953464-37953486 AGAGACGGGGTTCCACCATATGG - Intergenic
906283508 1:44570018-44570040 AGAGAAGGCGCTGCCCCTAAAGG + Intronic
906305916 1:44719095-44719117 AGGAAAGGGTCTGCCCCACAAGG + Intronic
906347817 1:45030997-45031019 AGAGACAAGGCTGGCCAACATGG - Intronic
906521142 1:46467590-46467612 AGGGAAGGGGCTGGCCCAGAGGG - Intergenic
907002194 1:50872694-50872716 CGAGACCAGGCTGCCCAACATGG + Intronic
907142548 1:52201967-52201989 AGAGACAGGGTTTCGCCACATGG + Intronic
907142663 1:52202869-52202891 AGAGACAGGGTTTCGCCACATGG + Intronic
907277934 1:53327356-53327378 AGAGAGGGGGCTGCCTGCCAGGG - Intronic
907284759 1:53372531-53372553 TGGGACAGGGCTGCTCCACACGG + Intergenic
911017664 1:93351634-93351656 AGAGACAAGCCTGGCCCACATGG - Intronic
913238109 1:116802701-116802723 CGAGACGAGGCTGGCCAACATGG + Intergenic
914729592 1:150358918-150358940 AGAGACGGGGTTTCACCATATGG - Intergenic
914910534 1:151782259-151782281 AGAGACGGGGTTTCACCACCAGG - Intronic
915022325 1:152792461-152792483 AGAGACCAGGCTGGCCAACATGG + Intronic
915249940 1:154580702-154580724 TGAGACTGGGCTGGCCAACATGG + Intergenic
916185182 1:162124721-162124743 CGAGACCAGGCTGCCCAACATGG - Intronic
916271914 1:162952505-162952527 TGAGACCAGCCTGCCCCACAGGG + Intergenic
916527586 1:165626141-165626163 AGAGACCAGCCTGCCCAACATGG + Intergenic
916617778 1:166460417-166460439 AGAGACTGGCCTGGCCAACATGG - Intergenic
917404575 1:174691030-174691052 CGAGACCAGGCTGGCCCACATGG - Intronic
918812773 1:189141480-189141502 AGGGATGAGGCTGCCCCAGATGG - Intergenic
919307979 1:195868718-195868740 AGAGACCAGCCTGCCCAACATGG + Intergenic
920101408 1:203519294-203519316 AGAGAAGGGGCAGCTCCAGAGGG - Intergenic
923855089 1:237837798-237837820 AGAGACTGGGCAGCCCCAGGCGG + Intergenic
924045940 1:240030708-240030730 GGAGACGAGGCTGGCCAACATGG + Intronic
924438969 1:244070995-244071017 AGAGACGGGGTTTCTCCACGGGG + Intergenic
1062770991 10:100740-100762 AGAGACGGGGTTTCACCACGTGG + Intergenic
1064225588 10:13481588-13481610 AGATACGGGGCTAACCCAGAAGG + Intronic
1064254999 10:13735951-13735973 TGAGACAGGCCTGGCCCACATGG + Intronic
1064698989 10:17999108-17999130 AGAGACGGGGTTTCACCACATGG - Intronic
1065326380 10:24553709-24553731 CGAGACCAGGCTGCCCAACATGG + Intergenic
1065859907 10:29863783-29863805 AGAGACGGGGTTTCACCATATGG - Intergenic
1065929770 10:30469333-30469355 AGAGACGAGGCTTCACCATATGG - Intergenic
1065938563 10:30543519-30543541 AGAGACAGGGTTTCTCCACATGG + Intergenic
1067019944 10:42786608-42786630 AGAGATGGGGTTTCCCCATATGG + Intronic
1067857008 10:49803214-49803236 AGAGACGGGGTTTCACCATATGG + Intergenic
1069005393 10:63312306-63312328 AGAGACCAGGCTGACCAACATGG - Intronic
1069523833 10:69149942-69149964 AGAGACCAGCCTGGCCCACATGG - Intronic
1070042875 10:72799110-72799132 AGAGACGGGGTTTCACCATATGG + Intronic
1070085019 10:73228794-73228816 CGAGACGGGCCTGGCCAACATGG - Intronic
1070174751 10:73960503-73960525 TGAGACGAGCCTGGCCCACATGG - Intergenic
1070735695 10:78862160-78862182 AGAGCCCAGGCTGCCCCACATGG - Intergenic
1070801300 10:79245880-79245902 AGAGTCTGAGCTGCCCAACAAGG - Intronic
1070890613 10:79940239-79940261 AGATAAGGGGCTACCCAACACGG - Intronic
1071120076 10:82266742-82266764 AGAGATGTGGCATCCCCACAGGG + Intronic
1072510591 10:96119943-96119965 AGAGACGGGGTTTCACCACATGG + Intergenic
1074095280 10:110305951-110305973 AGAGACGGGGTTTCTCCACGTGG - Intergenic
1074967848 10:118508150-118508172 AGAGCCTGGGCTGAACCACATGG + Intergenic
1075700006 10:124463067-124463089 AGAGACCAGCCTGCCCAACATGG - Intronic
1076406667 10:130216814-130216836 CGAGACCAGCCTGCCCCACATGG - Intergenic
1076510811 10:131012518-131012540 AGAGGCCGGGCAGCCTCACAGGG - Intergenic
1076860904 10:133138454-133138476 AGAGACCAGGCCCCCCCACAGGG - Intergenic
1076861280 10:133139457-133139479 AGAGACCAGGCCCCCCCACAGGG - Intergenic
1076861321 10:133139565-133139587 AGAGACCAGACTCCCCCACAGGG - Intergenic
1076925737 10:133484440-133484462 CAAGACGGAGCTGCCTCACATGG + Intergenic
1077182447 11:1222822-1222844 AGAGAAGGGCCTACCCCACCTGG - Intergenic
1077632654 11:3821556-3821578 TGAGACGAGCCTGCCCAACATGG + Intronic
1080514372 11:33006491-33006513 AGAGATGGGGCTTCCCCATGTGG + Intergenic
1081328958 11:41780681-41780703 AGAGACGGGGTTTCACCATATGG + Intergenic
1081531268 11:43961019-43961041 CGAGACTGGCCTGCCCAACATGG - Intergenic
1081893626 11:46566216-46566238 CGAGACTGGTCTGCCCAACACGG + Intronic
1083573733 11:63774213-63774235 TGAGACGAGGCTGACCAACATGG + Intergenic
1084327206 11:68407653-68407675 AGAGACGGGGTTTCTCCACGTGG - Intronic
1084385422 11:68840796-68840818 CGAGAAGGGGCTGCCCCGCGTGG + Intronic
1084401755 11:68948091-68948113 AGAGAAGACGCAGCCCCACAGGG - Intergenic
1084621268 11:70271325-70271347 TGAGAGGGGGATGCCCCAGACGG - Intronic
1085007327 11:73104752-73104774 AGAGACGGGGTTTCACCACCAGG + Intronic
1085638212 11:78174308-78174330 GGAGATGGGGCTGCTCCGCAGGG - Exonic
1088347757 11:108848309-108848331 AGAGACTGGTCTGGCTCACATGG + Intronic
1088912039 11:114199241-114199263 AGGGACGGGGATGCCGGACATGG + Intronic
1088912052 11:114199278-114199300 AGGGACGGGGATGCCGGACATGG + Intronic
1089332433 11:117699309-117699331 AGGGACGGGGCTGTAGCACACGG + Intronic
1089736384 11:120552797-120552819 AGAGACCGGCCTGGCCAACATGG + Intronic
1089845629 11:121455805-121455827 AGAGACGGGGTTTCCCCATGTGG - Intronic
1091421231 12:342660-342682 AGAGACCAGGCTGGCCAACATGG - Intronic
1091526972 12:1312557-1312579 TGAGACGAGCCTGACCCACATGG - Intronic
1092835183 12:12480917-12480939 AGAGACCAGCCTGCCCAACATGG - Intronic
1093448832 12:19292203-19292225 CGAGACGAGGCTGGCCAACATGG + Intronic
1093965081 12:25315861-25315883 CGAGACGAGGCTGCCCAACATGG + Intergenic
1094576711 12:31693424-31693446 AGAGACGAGCCTGACCAACATGG - Intronic
1095441416 12:42242000-42242022 AGAGACAGGGTTTCCCCATATGG - Intronic
1096096985 12:48941929-48941951 AAGGAGGGGGCTGTCCCACATGG + Intronic
1096120240 12:49084070-49084092 AGAGACCGGCCTGGCCAACATGG + Intergenic
1096465773 12:51847290-51847312 AGAGACTGGGCGGCTCCACAGGG + Intergenic
1096770933 12:53935681-53935703 AGAGCCGGGGCTTCCCGACGAGG + Intergenic
1096786029 12:54017894-54017916 AGGGAGGGGGCTGCCAGACAGGG - Intronic
1097069932 12:56347374-56347396 AGAGACGGGGTTTCACCACGTGG + Intronic
1099229825 12:80010398-80010420 AGAGATGGGGTTTCCCTACATGG + Intergenic
1100445944 12:94660064-94660086 AGAGACGGGGCTTCACCATATGG - Intergenic
1100475880 12:94934935-94934957 AGAGACCAGGCTGACCAACATGG + Intronic
1100830346 12:98511548-98511570 AGAGACGGGGTTTCTCCACATGG + Intergenic
1101075936 12:101129930-101129952 CGAGACTGGCCTGCCCAACATGG + Intergenic
1102091349 12:110191369-110191391 AGAGACCAGCCTGCCCAACATGG - Intronic
1102239215 12:111313437-111313459 AGAGACAAGCCTGCCCAACATGG + Intronic
1102362465 12:112300112-112300134 TGAGACGAGGCTGGCCAACATGG + Intronic
1103472592 12:121193670-121193692 AGAGACGGGGTTTCACCACATGG - Intergenic
1103534228 12:121623838-121623860 AGAGACGGGGTTTCACCATATGG - Intergenic
1103569795 12:121837308-121837330 AGAGACCAGCCTGCCCAACAGGG - Intergenic
1103599214 12:122043570-122043592 CGAGACGGGTCTGGCCAACATGG + Intronic
1104353273 12:128063444-128063466 AGAGACTGGCCTGACCAACATGG - Intergenic
1104452426 12:128881343-128881365 AGAGACGGGGCTTCACCATGCGG - Intronic
1105053678 12:133078440-133078462 AGAGACTGGGCCGCTCCATAAGG + Intergenic
1105499530 13:20959487-20959509 AGAGACCAGCCTGCCCAACATGG + Intergenic
1105735986 13:23271024-23271046 AGAGACGGGGTTTCTCCATATGG - Intronic
1106176087 13:27333129-27333151 CGAGACGAGGCTGACCAACATGG + Intergenic
1106789573 13:33140956-33140978 AGAGACCAGCCTGACCCACATGG - Intronic
1107793641 13:44028357-44028379 AGAGAGGGAGAGGCCCCACAGGG - Intergenic
1107898335 13:44988216-44988238 AGAGACAGGCCTGTCCAACACGG + Intronic
1108455024 13:50604651-50604673 AGAGATGGGAGGGCCCCACATGG + Intronic
1108688807 13:52845272-52845294 GGATACGGGCCTGCCTCACACGG - Intronic
1109303654 13:60615562-60615584 AGAGATGGGGTTTCACCACATGG + Intergenic
1109755734 13:66757035-66757057 CGAGACTAGGCTGCCCAACATGG - Intronic
1110294728 13:73850694-73850716 AGAGATGGGGCTGACATACATGG + Intronic
1110705207 13:78596559-78596581 GGAGAGGGAGCTGCCCCACGAGG + Intergenic
1111295798 13:86276294-86276316 AGAGACAGGGTTTCGCCACATGG - Intergenic
1113428775 13:110231184-110231206 TGAGACTGGGGAGCCCCACATGG + Intronic
1113497274 13:110741369-110741391 AGAGACCAGCCTGCCCAACATGG - Intergenic
1114283420 14:21216505-21216527 GGAGACGGGCCTGACCAACATGG + Intronic
1114303995 14:21404210-21404232 AGAGACAGGGTTTCGCCACATGG - Intronic
1114792885 14:25679647-25679669 AGAGACGAGGTTTCGCCACATGG - Intergenic
1115188234 14:30717288-30717310 AGAGACAGGGTTTCACCACATGG - Intronic
1115194064 14:30777506-30777528 AGAGACGGGGTTTCACCACGTGG + Intergenic
1116134734 14:40907941-40907963 AGAGACCAGGCTGGCCAACATGG - Intergenic
1117043021 14:51785233-51785255 AGAGACAGGACTGGTCCACAGGG + Intergenic
1118762950 14:68891847-68891869 GCAGAGGGGGCTGCCCCACATGG + Intronic
1118799625 14:69177666-69177688 AGAGACAAGGCTGGCCAACATGG + Intergenic
1118908462 14:70041307-70041329 TGGGAAGTGGCTGCCCCACAAGG + Intergenic
1119039538 14:71260715-71260737 AGAGACGGGGTTTCACCATATGG - Intergenic
1119824616 14:77647148-77647170 AGAGCTGTGGCTGCCCCAGATGG - Intergenic
1121004330 14:90478909-90478931 AGAGACCGGCCTGACCAACATGG - Intergenic
1121077281 14:91079537-91079559 AGAGACGGGGTTTCGCCATATGG + Intronic
1122126023 14:99579268-99579290 AGTGGCGGGGCTGCCCCAACAGG + Intronic
1122209412 14:100165406-100165428 AGAGCAGGGGCTGCGCCACACGG - Intergenic
1122270301 14:100565999-100566021 AGTGTCGGGGCTGCCCCAGTGGG - Intronic
1122411816 14:101529474-101529496 AGAGATGAGGCTGCCAGACATGG - Intergenic
1122468652 14:101951045-101951067 AGCTCCGAGGCTGCCCCACAAGG + Intergenic
1122671590 14:103376924-103376946 CGAGACCAGCCTGCCCCACATGG - Intergenic
1124273363 15:28303978-28304000 AGAGACAGGGTTTCACCACATGG - Intronic
1124709053 15:31990025-31990047 AGGAGCAGGGCTGCCCCACAAGG - Intergenic
1125590504 15:40851833-40851855 AGAGATGGGGTTTCACCACATGG - Intronic
1125696859 15:41645399-41645421 AGAGACAGGGTTTCACCACATGG - Intronic
1126625812 15:50685261-50685283 AGAGACGAGCCTGCCAAACATGG + Intronic
1127271492 15:57405982-57406004 AGAGTAGGGCCTGACCCACAGGG - Intronic
1128656604 15:69467290-69467312 AGAGACGGGGTTTCACCACGAGG + Intergenic
1128884338 15:71272673-71272695 AGAGACGGGGCTTCACTACGTGG - Intronic
1129036401 15:72651979-72652001 TGAGACGGGCCTGACCAACATGG - Intergenic
1129158999 15:73736706-73736728 AGAGATGGGGTTTCACCACATGG - Exonic
1129213488 15:74085246-74085268 TGAGACGGGCCTGACCAACATGG + Intergenic
1129352475 15:74964427-74964449 TGAGACGGGTCTGGCCAACATGG + Intronic
1129396914 15:75255840-75255862 TGAGACGGGCCTGACCAACATGG - Intergenic
1129400526 15:75280117-75280139 TGAGACGGGCCTGACCAACATGG - Intronic
1129448624 15:75636645-75636667 ACAGACGGGGTTTCGCCACATGG + Intergenic
1129509648 15:76111606-76111628 AGAGACCAGCCTGCCCAACATGG - Intronic
1129730618 15:77929560-77929582 TGAGACGGGCCTGACCAACATGG + Intergenic
1131913700 15:97238018-97238040 AGAGACGAGCCTGGCCAACATGG + Intergenic
1132149715 15:99450981-99451003 AGAGACGGGGCTTAGACACAGGG - Intergenic
1132581716 16:687767-687789 AGTGACGGGGCTGGCCCATGAGG + Intronic
1132735998 16:1386350-1386372 CGAGACCAGGCTGCCCAACATGG + Intronic
1132756924 16:1490016-1490038 AGAGACGGGGTTGCCCCATGTGG + Intergenic
1133339099 16:5025345-5025367 AGGAACTTGGCTGCCCCACAGGG + Exonic
1133344699 16:5062108-5062130 AGAGGCTGGGCTGTCCCAGAGGG - Intronic
1133792187 16:9017585-9017607 AGAGACGGGGCTTCGCCATGTGG + Intergenic
1133797275 16:9056361-9056383 AGAGACCAGACTGGCCCACACGG + Intergenic
1134072957 16:11272102-11272124 AGAGCCGTGGCCTCCCCACAGGG + Intronic
1134079139 16:11312983-11313005 AGAGGTGGGACTGCCCCACCTGG - Intronic
1134527512 16:14955700-14955722 GGAGACGAGCCTGGCCCACATGG - Intergenic
1135245346 16:20851696-20851718 AGAGATGGGCCTGCACTACAAGG + Intronic
1136222307 16:28836274-28836296 GGAGGCAGGGCTGTCCCACAGGG + Intronic
1136255235 16:29034503-29034525 AGAGACGGGGTTACACCACGTGG - Intergenic
1136636251 16:31525370-31525392 AGAGATGGTGCTGCCTCAGATGG - Intergenic
1137033310 16:35544711-35544733 AGAGACGGGGTTTCCCCATGTGG - Intergenic
1137523691 16:49215134-49215156 GGAGACCAGCCTGCCCCACATGG - Intergenic
1137733406 16:50706593-50706615 AGAGACCTGGCTGGTCCACATGG + Intronic
1138529866 16:57629231-57629253 AGAGTGGGGGCGGACCCACAAGG + Intronic
1138643020 16:58401013-58401035 CGAGACGGGCCTGACCAACATGG - Intronic
1139101343 16:63771222-63771244 AGAGACCAGGCTTGCCCACATGG - Intergenic
1139737136 16:69000776-69000798 AGAGACGGGGCTTCACCATGTGG + Intronic
1140596440 16:76420510-76420532 AGAGATGGGACAGCCCCGCACGG - Intronic
1141631260 16:85289324-85289346 AAAGAAGCAGCTGCCCCACAAGG + Intergenic
1141699995 16:85638008-85638030 AGAGGCTGTGCTGCCCCACGCGG + Intronic
1142208956 16:88798575-88798597 TGAGACGAGGCTGGCCAACATGG + Intergenic
1142615642 17:1133040-1133062 CGAGACCAGGCTGACCCACACGG + Intronic
1142982953 17:3681837-3681859 AGCCACGGGGGTGCTCCACAGGG + Intronic
1143248094 17:5502473-5502495 AGAGACAGGGTTTCACCACATGG + Intronic
1143294334 17:5859509-5859531 AGAGAAGAGGCTGCCCCAGGAGG + Intronic
1143620879 17:8079703-8079725 AGAGACGGGGATGCCCGCGAGGG + Intronic
1143661635 17:8327939-8327961 AGAGACGGGGCTTCACCATATGG + Intergenic
1144575869 17:16428986-16429008 AGAGAAGGGGGTGGCCCACCGGG + Intronic
1145056715 17:19707931-19707953 AGAGCCATGCCTGCCCCACACGG - Intronic
1145093793 17:20008325-20008347 AAGGACAGGACTGCCCCACAAGG - Intergenic
1145184602 17:20783596-20783618 AGAGACCGGCCTGGCCAACATGG + Intergenic
1146352898 17:32110901-32110923 AGAGACGGGGATGCCACGCAAGG + Intergenic
1147532268 17:41290638-41290660 AGAGACAGGGTTTCACCACATGG + Intergenic
1147550148 17:41435895-41435917 AGTGCAGGGGCTGACCCACATGG - Intergenic
1147615320 17:41823904-41823926 AGAGACGTGACTGCTCCCCACGG + Intergenic
1148942596 17:51227762-51227784 AGAGACGGGATTTCCCCACGTGG - Intronic
1149447727 17:56726441-56726463 TCAGAAGGGGCTGCCCCACCAGG + Intergenic
1149550682 17:57537280-57537302 AGAGGCGGGTGTGCCCCTCACGG - Intronic
1149837168 17:59923389-59923411 TGAGACCAGCCTGCCCCACATGG - Intronic
1150342318 17:64378439-64378461 AGAGACTGGCCTGGCCAACATGG + Intronic
1150497362 17:65618256-65618278 AGAGATGGGGTTTCGCCACATGG + Intronic
1150610735 17:66731148-66731170 CGAGACCAGGCTGCCCAACATGG + Intronic
1151450164 17:74193928-74193950 AGGGACGGGGTTTCACCACATGG - Intergenic
1152141225 17:78537951-78537973 AGAGACGGGGCTTCGCCATGTGG - Intronic
1152228897 17:79104998-79105020 AGAGACAGGGCTGCCCCATGGGG - Intronic
1152230517 17:79112054-79112076 AGAGACGCCCCTGCCCCACCAGG + Intronic
1152452566 17:80391456-80391478 AGAGACGGGGTTTCTCCACGTGG + Intronic
1153442771 18:5139339-5139361 AGAGAAGGGGCTGCACACCAGGG + Intergenic
1153953562 18:10076844-10076866 AGAGAGGGTGCCGCCCTACATGG - Intergenic
1156495465 18:37522787-37522809 AGATTTGGTGCTGCCCCACAGGG - Intronic
1157727767 18:49978107-49978129 AGAGAAAGGGCTGCCACACCAGG + Intronic
1158315600 18:56208668-56208690 AGAGATGGGGTTTCACCACATGG + Intergenic
1158672603 18:59490183-59490205 CGAGACGAGCCTGCCCAACATGG - Intronic
1159249051 18:65849976-65849998 AAAGACAGGGCTTCACCACATGG - Intronic
1160781673 19:880234-880256 AGAGCCGGGGCTGCCCATCCAGG + Intronic
1161014513 19:1977126-1977148 AGAGACGGGGCTGCCCCACATGG + Intronic
1161062449 19:2222012-2222034 AGAGGCCGGGCTGCCCGCCAAGG - Exonic
1161724027 19:5918218-5918240 AGAGAGGTGACCGCCCCACAGGG + Intronic
1162324931 19:9993400-9993422 GGGGACCGGGTTGCCCCACATGG + Exonic
1162541917 19:11302007-11302029 AGAGACGGGGTTTCACCATATGG + Intronic
1162607351 19:11719871-11719893 AGAGAAGGGGCTGCCACTCAAGG + Intergenic
1162678002 19:12314842-12314864 AAAGAAGGGGCTGCCACTCAAGG + Intergenic
1162686445 19:12388917-12388939 AGAGAAGGGACTGCCACTCAAGG + Intronic
1162690765 19:12428426-12428448 AGAGAAGGGACTGCCACTCAAGG + Intronic
1163227084 19:15970831-15970853 AGAGACTAGCCTGCCCAACATGG + Intergenic
1163368431 19:16888974-16888996 GGAGACCGGGCTGCCCCACGTGG - Exonic
1163663165 19:18590404-18590426 AGAGACGGGGTTGTGCCATATGG + Intronic
1163853635 19:19682108-19682130 AGAGACGGGGCTTCACCATGTGG + Exonic
1164770350 19:30803614-30803636 CAAGAAGGGGCTGCCCCACTGGG + Intergenic
1164842813 19:31406239-31406261 AGAGGAGGAGCTGCCCCAGAAGG + Intergenic
1165152835 19:33771081-33771103 AGAGTCCTGGCTGCTCCACAGGG + Intronic
1165383408 19:35496197-35496219 AGAGACTGTGCTTCTCCACATGG - Intergenic
1165572078 19:36783734-36783756 TGAGACCGGCCTGCCCAACATGG - Intergenic
1165586448 19:36920420-36920442 AGAGACCAGGCTGACCAACATGG + Intronic
1165619298 19:37231321-37231343 AGAGACTGGGCTGGCCAACATGG + Intronic
1166048271 19:40242406-40242428 AGAGACAAGGCTGCCCTGCAGGG - Intronic
1166755633 19:45189218-45189240 TGAGACGAGGCTGGCCAACATGG - Intronic
1166775964 19:45312605-45312627 AGAGACGGGGTTTCTCCACTTGG + Intronic
1167886598 19:52505085-52505107 AGAGACGAGCCTGACCAACATGG - Intronic
1167892022 19:52547937-52547959 AGAGACGAGCCTGACCAACATGG - Intronic
1167912268 19:52713689-52713711 AGAGACGAGCCTGACCAACATGG + Intronic
1168198655 19:54796640-54796662 AGAGAGGGGCCTGGCCCACATGG + Intronic
1168433340 19:56298463-56298485 AGAGACGGGGTTTCACCAGACGG - Intronic
1168692555 19:58385802-58385824 AGAGACAGGGCGGCCCCAGGTGG + Intergenic
924961335 2:37243-37265 AGAGACGGGGTTTCTCCACATGG - Intergenic
925280456 2:2680866-2680888 AGAGACAGGCCTGGCCAACATGG + Intergenic
925822190 2:7810485-7810507 AGAGACCAGCCTGCCCAACATGG - Intergenic
926016665 2:9458910-9458932 AGAGACCAGGCTGACCAACATGG + Intronic
926185771 2:10689724-10689746 AGAGGGGCGGCTGCCCCACGAGG + Intronic
926221904 2:10941972-10941994 AGAGACGGGGTTTCGCCATATGG + Intergenic
926754459 2:16224132-16224154 AGGGACGGGGCTCCTCAACAGGG - Intergenic
926939249 2:18117737-18117759 AGAGCCAGGGCTGCCCCATATGG + Intronic
927830514 2:26346120-26346142 AAAGACTGGGCTGCCCGAGAAGG - Exonic
927909248 2:26884997-26885019 AGAGACCAGCCTGACCCACATGG + Intronic
928504489 2:31936147-31936169 AGAGACGGGGTTTCACCATATGG + Intronic
929108111 2:38383543-38383565 TGAGACGGGCCTGACCAACATGG + Intergenic
929612324 2:43280444-43280466 AGAGACGGGGTTTCACCATATGG - Intronic
930086845 2:47503706-47503728 AGGAACGGGGCTGACCAACAGGG - Intronic
930133282 2:47874733-47874755 AGAGACCAGGCTGGCCAACATGG - Intronic
931073043 2:58675956-58675978 AAACACTGTGCTGCCCCACATGG + Intergenic
931405886 2:61977799-61977821 AGAGATGGGGTTTCACCACATGG - Intronic
932157629 2:69432947-69432969 CGAGACGAGCCTGCCCAACATGG + Intronic
932237759 2:70134751-70134773 CGAGACGAGGCTGACCAACATGG - Intergenic
932423642 2:71615524-71615546 AGAAAAGGGGCTTCCCCAGAGGG - Intronic
934884118 2:98009376-98009398 AGAGACGGGGTTGCCCACCTCGG + Intergenic
936580905 2:113699737-113699759 AGAGACGGGGTTTCCCCATTTGG - Intergenic
937039997 2:118813765-118813787 ATAGACGGAGCTGCCCCATGCGG + Intergenic
937473348 2:122192130-122192152 AGAGAGAGTGCTTCCCCACATGG + Intergenic
937884290 2:126889494-126889516 ATAGACGTGCCTGCCACACATGG + Intergenic
938066753 2:128285642-128285664 AGAGACAGGGGTGCCACAGACGG - Intronic
938551905 2:132390428-132390450 CGAGACCGGCCTGCCCAACATGG + Intergenic
938744707 2:134266419-134266441 AGAGACCGGCCTGACCAACATGG - Intronic
939330769 2:140757678-140757700 AGAGACGAGCCTGGCCAACATGG + Intronic
939779418 2:146426846-146426868 AGAGACGGGGTTTCACCACGTGG - Intergenic
940576029 2:155505375-155505397 GGAGACCAGGCTGCCCAACATGG + Intergenic
941097448 2:161255051-161255073 AGAGACGAGCCTGACCAACATGG - Intergenic
944804375 2:203266778-203266800 AAAGACCAGCCTGCCCCACATGG + Intronic
945433116 2:209788214-209788236 AGAGACCAGCCTGACCCACACGG + Intronic
946372640 2:219290191-219290213 AGAGGCTGGGCTGCCCGCCAAGG + Exonic
946537976 2:220651937-220651959 AGAGACAGGGCTGTCCCAGGAGG - Intergenic
946673622 2:222133291-222133313 AGAGGCAGGGCTGTCCCACTGGG - Intergenic
947221820 2:227801159-227801181 AGAGACGGGGTTTCACCACGTGG - Intergenic
947227200 2:227852189-227852211 AGAGCCAGGGCTGGCCCCCAGGG + Intergenic
947810876 2:233003260-233003282 GGAGACTGGGCAGCCCCACCTGG - Intronic
948199388 2:236119122-236119144 TGAGATGGGGCTGCCCGACCTGG - Intronic
948313362 2:237007256-237007278 AGAGACCGGCCTGGCCAACATGG + Intergenic
948603509 2:239120670-239120692 TGGGATGGGGCAGCCCCACAGGG - Intronic
948797574 2:240412665-240412687 AGAGCTGGGCCAGCCCCACATGG - Intergenic
1169047681 20:2548436-2548458 CGAGACGAGGCTGACCAACATGG + Intronic
1170996461 20:21364619-21364641 AGAGATGGGGTTTCCCCACATGG - Intronic
1171388149 20:24784048-24784070 AGAGAGGGGGCTGCCTGGCAGGG - Intergenic
1172027409 20:31958262-31958284 AGAGACCAGGCTGGCCAACATGG + Intergenic
1172491667 20:35343930-35343952 AGATAGGGTGCTGCCCCATAAGG - Intronic
1173125344 20:40331566-40331588 AGAGACAGGGATACCACACAGGG - Intergenic
1175882153 20:62266284-62266306 AGGGGTGGAGCTGCCCCACAAGG - Intronic
1176377992 21:6096171-6096193 AGAGACAGGTATGGCCCACAGGG - Intergenic
1177157018 21:17510780-17510802 AGAGACGGGGTTTCACCATATGG - Intergenic
1178337653 21:31758090-31758112 AGAGACGGGGCTTCACCATGTGG + Intergenic
1179745481 21:43442077-43442099 AGAGACAGGTATGGCCCACAGGG + Intergenic
1180135184 21:45857876-45857898 GGAAACAGGGCTGCCCCCCAGGG + Intronic
1180300044 22:11030166-11030188 CGAGACGAGGCTGACCAACACGG - Intergenic
1180677998 22:17601805-17601827 AGAGACGAGCCTGGCCAACATGG - Intronic
1181031407 22:20150267-20150289 AGAGAGGGGGCTGCCTGTCATGG + Intronic
1181540288 22:23569348-23569370 AGAGAAGCAGCTGCCCCAGAAGG + Intergenic
1181614780 22:24046188-24046210 AGAGACTGCTGTGCCCCACATGG - Intronic
1181776937 22:25166537-25166559 AGAGAGGGGGATCCCCCTCAGGG - Intronic
1181836278 22:25612016-25612038 AGAGACGGGTTTTCACCACATGG + Intronic
1182042022 22:27245486-27245508 AGGCAGGGGGCTGTCCCACATGG + Intergenic
1182386888 22:29950963-29950985 AGAGACGGGGTTTCACCACGTGG - Intronic
1183220617 22:36510220-36510242 AGAGACGGGGTTTCGCCATATGG - Intergenic
1183391536 22:37548001-37548023 CGAGACCAGGCTGGCCCACATGG - Intergenic
1183392874 22:37555742-37555764 AGAGACCAGCCTGGCCCACATGG + Intergenic
1183622597 22:38983129-38983151 AGAGACGGGGTTTCACCATATGG - Intronic
1183733720 22:39632028-39632050 AGGGACGGGGCTGCCATTCAGGG + Intronic
1184720285 22:46308709-46308731 AGAGCCGAGGCTCACCCACAGGG - Exonic
1185040849 22:48503462-48503484 AGAGACGAGGGCTCCCCACATGG + Intronic
950344226 3:12277368-12277390 AGAGACGGGGTTTCACGACATGG + Intergenic
950502328 3:13372384-13372406 AGAGACGGGGCTGGCAACCATGG + Intronic
953645140 3:44746850-44746872 AGAGACCAGCCTGCCCAACATGG - Intronic
953730260 3:45441223-45441245 AGAGACCAGCCTGCCCAACATGG - Intronic
954047293 3:47943424-47943446 AGAGATGGGGTTTCACCACATGG - Intronic
955438144 3:58926163-58926185 AGAGACCAGCCTGCCCAACATGG + Intronic
955810104 3:62779086-62779108 TGAGACGAGGCTGGCCAACATGG - Intronic
956683597 3:71804199-71804221 TGAGACGAGGCTGACCAACATGG - Intergenic
956826996 3:73006382-73006404 AGAGACGGGGTTTTACCACATGG + Intronic
959238537 3:103757175-103757197 AGAGACGGGGTTTCACCACTTGG - Intergenic
960586948 3:119328840-119328862 AGAGACCGGCCTGGCCAACAAGG - Intronic
961053884 3:123770108-123770130 CGAGACGAGGCTGACCAACATGG + Intronic
961156198 3:124681813-124681835 AGAGACAGGGCTTCACCACATGG + Intronic
961593411 3:127997803-127997825 GGAGACTGGGCTGCCTCAGACGG - Intergenic
961950585 3:130745819-130745841 CAAGACGGGGCTGGCCAACATGG + Intronic
962788301 3:138788121-138788143 AGAGACCGGCCTGGCCAACATGG - Intronic
966932783 3:184686638-184686660 AGAGACCAGCCTGCCCAACATGG + Intergenic
967899019 3:194428018-194428040 AGAGACTGGCCTGGCCAACATGG + Intronic
968240624 3:197080660-197080682 AGAGACCGGCCTGGCCAACATGG - Intronic
968655201 4:1775565-1775587 GCAGGTGGGGCTGCCCCACAGGG - Intergenic
969410577 4:7025402-7025424 GGAGACGTGGCTGTGCCACAGGG + Intronic
969496721 4:7530432-7530454 AGACATGGGGAAGCCCCACAAGG + Intronic
973913245 4:55605217-55605239 ACAGAAAGGGCTGCCCCACACGG + Intronic
973946861 4:55966390-55966412 CGAGACCAGGCTGGCCCACATGG - Intronic
974056219 4:56985429-56985451 AAAGTCGGGGCCGCCCCACGGGG - Intronic
974864810 4:67566767-67566789 AGAGACCAGCCTGCCCAACATGG + Intronic
975610996 4:76203173-76203195 AGAGACCAGCCTGGCCCACATGG - Intronic
976502816 4:85811988-85812010 AGAGACGGGGTTTCACCATATGG - Intronic
976978529 4:91194153-91194175 AGAGACGGAGTTTCACCACATGG + Intronic
978630362 4:110737027-110737049 AGAGACGGGGTTGCACCATGTGG - Intergenic
979860092 4:125682859-125682881 AGAGCCGGGGCTGCCAAGCACGG - Intergenic
981466870 4:145082347-145082369 CGAGACCGGCCTGACCCACATGG - Intronic
981507882 4:145522863-145522885 AGAGACGGGGTTTCTCCATATGG + Intronic
981594716 4:146406780-146406802 TGAGACCGGGCTGGCCAACATGG + Intronic
983466039 4:168092060-168092082 CGAGACCAGGCTGCCCAACATGG - Intergenic
985515499 5:342846-342868 AGATACTGGGCTGCTCCTCAGGG + Intronic
985988758 5:3538430-3538452 AGTGGCTGGGCTGCCCCACAGGG + Intergenic
986487235 5:8249991-8250013 AGAGACGTGACTGTGCCACATGG - Intergenic
986498160 5:8368266-8368288 AGAGCCTGGGCTGCCACAAAAGG + Intergenic
986813285 5:11382396-11382418 TGAGACTGGCCTGGCCCACATGG + Intronic
987068973 5:14317924-14317946 CGAGACGAGCCTGCCCAACATGG + Intronic
988587927 5:32523884-32523906 AGAATCGGGGCTGCCCCCAAGGG - Intergenic
992469235 5:77040294-77040316 AGAGACGGGGCTTCTCCATGTGG + Intronic
993067426 5:83116805-83116827 AGAGACGGGGTTGTGCCATATGG + Intronic
993087608 5:83382787-83382809 TGAGACCCGCCTGCCCCACATGG + Intergenic
993300734 5:86206423-86206445 AGAGACGGGGTTCCACCATATGG + Intergenic
994931270 5:106188815-106188837 AGAGACGGGGTTTCACCATATGG - Intergenic
996876211 5:128243302-128243324 CGAGACCAGGCTGCCCAACATGG + Intergenic
997351890 5:133236788-133236810 AGAAATGGGGCTGCCAGACAAGG - Intronic
998357561 5:141553437-141553459 CGAGACCGGCCTGCCCAACATGG + Intronic
998517147 5:142766881-142766903 CGAGACCAGGCTGCCCAACATGG - Intergenic
999123019 5:149224565-149224587 AGCGAGGGGGCTGCAGCACATGG - Intronic
999161741 5:149506435-149506457 AGAGACCAGCCTGCCCGACATGG - Intronic
999739161 5:154536457-154536479 TGAGACGAGCCTGCCCAACATGG + Intergenic
1001844681 5:174911224-174911246 AGAGACGGGGTTTCACCACTTGG + Intergenic
1002305619 5:178280928-178280950 TGTGAATGGGCTGCCCCACATGG + Intronic
1002538388 5:179890889-179890911 AGAGCCGACGCCGCCCCACAGGG + Intronic
1003396738 6:5759796-5759818 ATGGAATGGGCTGCCCCACAAGG + Intronic
1004463982 6:15866235-15866257 AGAGACGGGGTTTCACCATATGG - Intergenic
1004938256 6:20529043-20529065 AGAGACGCGGTTTCCCCACATGG - Intergenic
1005492440 6:26359299-26359321 AGAGACGGGGTTTCACCACATGG + Intergenic
1005852205 6:29830062-29830084 AGAGAAGGTGCTGGCACACAGGG - Intronic
1006266272 6:32927187-32927209 AGAGACCAGCCTGCCCAACATGG + Intergenic
1006671396 6:35731822-35731844 AGCGACGGGGCTGCCCGGGAAGG - Intergenic
1008428959 6:51392366-51392388 AGGGATGGGGCAGCACCACAGGG + Intergenic
1009642295 6:66353641-66353663 TGAGACTGGGCTGGCCAACATGG - Intergenic
1010467745 6:76188974-76188996 AGAGATGGGGCTTCGCCATATGG - Intergenic
1010648313 6:78421329-78421351 TGAGACCAGGCTGCCCAACATGG + Intergenic
1011412183 6:87077374-87077396 TGAGACGAGCCTGGCCCACATGG + Intergenic
1013494516 6:110684936-110684958 AGAGACCAGGCTGGCCAACATGG + Intronic
1013967453 6:115972015-115972037 AGAGACAGGGAAGCCCCAAAGGG - Intronic
1014254958 6:119151627-119151649 AGAGATGGGGTTTCCCCACGTGG - Intergenic
1015705989 6:136088285-136088307 AGAGAAGAGGCAGCCCCACAAGG + Intronic
1015835881 6:137419408-137419430 AGAGACGGGGTTTCACCAGATGG - Intergenic
1016052304 6:139542873-139542895 CGAGACCGGCCTGCCCAACATGG + Intergenic
1017851175 6:158307681-158307703 CGAGACCGGGCTGGCCAACATGG - Intronic
1018010213 6:159662983-159663005 AGAGACGGGGCTTCACCATGTGG + Intergenic
1018162575 6:161060819-161060841 TGAGACCGGGCTGGCCAACATGG - Intronic
1018491188 6:164295091-164295113 AGAGACGGGGCTTCTCCATTAGG + Intergenic
1018745890 6:166761939-166761961 GGAGACGAGGCTGCCCCATCTGG - Intronic
1018846641 6:167561391-167561413 AGAGCCGGGCCAGCCCCACATGG + Intergenic
1019010905 6:168842743-168842765 AGGGACGTGCCGGCCCCACATGG - Intergenic
1019288486 7:235620-235642 GGAGACGGCGCTGCCACTCAGGG - Intronic
1019499189 7:1355883-1355905 AGGGCAGGGGCTGCCCCAGAAGG + Intergenic
1019863528 7:3683578-3683600 AGGAACGGGGCTGCTCCACCTGG - Intronic
1019967204 7:4509441-4509463 AGAGATGGGGTTTCACCACATGG - Intergenic
1020033338 7:4948333-4948355 AGAGATGGGGATCCCCCCCAAGG - Intronic
1022500027 7:30876990-30877012 GGGGAGGGGGCTGCACCACATGG - Intronic
1024636434 7:51294430-51294452 AGAGACCAGCCTGGCCCACATGG + Intronic
1024670760 7:51592264-51592286 AGAGACGGGGTTTCACCAAATGG + Intergenic
1025995782 7:66526521-66526543 CGAGACCGGCCTGCCCAACATGG + Intergenic
1026486778 7:70828920-70828942 AGAGACGGGGTCTCCCTACATGG + Intergenic
1026569051 7:71513584-71513606 AGAGACGAGCCTGGCCAACATGG - Intronic
1027129774 7:75582607-75582629 AGAGACGAGGCTGGCCAACATGG + Intronic
1027366909 7:77468031-77468053 AGAGACGGGGCTACACCATGTGG + Intergenic
1028962631 7:96766686-96766708 AGAGAGAGGGCTGTGCCACATGG - Intergenic
1029152466 7:98490705-98490727 CGAGACCAGGCTGCCCAACATGG + Intergenic
1029351152 7:100014015-100014037 AGAGACGGGGTTTCACCATATGG + Intergenic
1029733349 7:102451925-102451947 AAAGAAGGGGCAGCCCCAGAGGG + Exonic
1030072367 7:105709130-105709152 AGAGACCAGGCTGGCCAACATGG + Intronic
1030783973 7:113637185-113637207 AGAGATGGAGCTGCCACACCAGG + Intergenic
1033731903 7:144188282-144188304 AGAGACCTGGCTGCTCCTCATGG + Exonic
1033742752 7:144286865-144286887 AGAGACCTGGCTGCTCCTCATGG + Intergenic
1033751150 7:144362749-144362771 AGAGACCTGGCTGCTCCTCATGG - Exonic
1034071902 7:148194181-148194203 AGAGACGGGGTTTCACCATATGG + Intronic
1035408444 7:158617543-158617565 AGAGACGGGCCTGGCCAATATGG + Intergenic
1035704671 8:1666478-1666500 TGAGACCAGGCTGGCCCACATGG + Intronic
1036517670 8:9459541-9459563 AGAGACGGGGTTGCACCATGTGG - Intergenic
1037007563 8:13800818-13800840 AGAGACGGGGTTCCACCACATGG - Intergenic
1037510227 8:19574847-19574869 AGAGACGGGATTTCACCACATGG - Intronic
1038326273 8:26575132-26575154 AGAGACTAGGCTGGCCAACATGG - Intronic
1039101128 8:33943165-33943187 AGAGCCGGGGGAGCCCCAAATGG + Intergenic
1039589960 8:38737925-38737947 TGAGACGAGGCTGACCAACATGG - Intronic
1041033716 8:53765199-53765221 AGAGACTGGCCTGGCCAACATGG + Intronic
1041662477 8:60413325-60413347 AGGGAAGGGGCAGCCCCGCAGGG + Intergenic
1043505539 8:80898352-80898374 AGAGACAGGGCTTCCCCACGTGG + Intergenic
1045790011 8:105972537-105972559 AGACTCAGGGCTGCCACACACGG - Intergenic
1046669563 8:117042874-117042896 CGAGACCGGCCTGCCCAACATGG - Intronic
1047949820 8:129923041-129923063 AGAGACGGGGTTTCCCCTGATGG - Intronic
1048376983 8:133831499-133831521 AGAAATGTGGCTGCCCCAGAGGG - Intergenic
1049055696 8:140235171-140235193 AGAGACCGGCCTGACCAACATGG - Intronic
1049300523 8:141867140-141867162 AGCCACAGGGCTGCTCCACAGGG + Intergenic
1049341145 8:142113278-142113300 AGAGAGGGGACTGTCCCACTCGG + Intergenic
1049842288 8:144780602-144780624 AGAGACAGGGTTTCACCACATGG - Intronic
1051880985 9:21839934-21839956 AGAGACAGGGCTGGCCACCACGG + Intronic
1051933989 9:22422222-22422244 AGAGACCAGGCTGACCAACATGG - Intergenic
1052155694 9:25187370-25187392 AGAGACTGGCCTGGCCAACATGG - Intergenic
1052273016 9:26646991-26647013 AGGGAAAGGGCTGCCCCACAAGG - Intergenic
1052386561 9:27830021-27830043 AGAGACAGAGGTGCCCCACAGGG - Intergenic
1052763301 9:32614645-32614667 AGAGACAGGGTTGCCCCAACAGG + Intergenic
1052982584 9:34459644-34459666 AGAGACGGGCCTGGGCAACATGG - Intronic
1053030339 9:34770911-34770933 AGAGACTGGCCTGACCAACATGG + Intergenic
1057621764 9:96642729-96642751 AGAGACGGGGTTTCACCAGATGG + Intronic
1058682131 9:107449251-107449273 AGAGACGGGGTTTCGCCACTTGG - Intergenic
1061090927 9:128425709-128425731 CGAGACGAGGCTGACCAACACGG - Intronic
1061276442 9:129571585-129571607 AGAGGAGGAGCTGCCCCAGAAGG + Intergenic
1061682346 9:132249252-132249274 GGAGACCTTGCTGCCCCACAGGG + Intergenic
1062623910 9:137434510-137434532 AGGGAGGGAGCTGCCCCACCTGG - Exonic
1185751285 X:2611450-2611472 AGAGACCAGCCTGCTCCACATGG - Intergenic
1186511756 X:10134976-10134998 AGAAACCTGGCTGCCCCACAGGG - Intronic
1187449002 X:19380724-19380746 AGAGACCAGCCTGGCCCACATGG - Intronic
1187952375 X:24483897-24483919 AGAGACGGGGTTTCACCATATGG + Intronic
1189724868 X:43958346-43958368 AGTGATGTGGCTGGCCCACAGGG - Intronic
1190016920 X:46835441-46835463 AGAGACGGGGTTTCACCAGACGG + Intergenic
1190238803 X:48640257-48640279 AGAGACGGGGTTTCGCCATATGG - Intergenic
1190994917 X:55597416-55597438 AGAGACCAGCCTGCCCAACATGG + Intergenic
1192753191 X:74016403-74016425 CGAGACGAGCCTGCCCAACATGG + Intergenic
1192818309 X:74616883-74616905 GGAGACCAGGCTGCCCAACATGG - Intergenic
1196020390 X:110984941-110984963 AGAGATGGGGTTTCACCACATGG - Intronic
1196796410 X:119505391-119505413 CGAGACTGGGCTGGCCAACATGG + Intergenic
1196832236 X:119784803-119784825 AGAGACGAGGCTTCACCACGTGG + Intergenic
1197196200 X:123703700-123703722 AGAGATGGGGTTTCACCACATGG - Intronic
1197305314 X:124834355-124834377 AGAGATGGGGTTTCGCCACATGG + Intronic
1197703279 X:129615906-129615928 AGTGCCGGGCCTGCCCCACAGGG + Intergenic
1197705849 X:129633996-129634018 TGAGACGGGCCTGGCCAACATGG + Intergenic
1197795017 X:130289380-130289402 AGAGACGAGCCTGGCCAACATGG - Intergenic
1199747373 X:150781969-150781991 GGAGGCGGGGATGCACCACACGG + Intronic
1200033136 X:153312292-153312314 AGATACGGGGGTGCCACAGAAGG + Intergenic
1200046360 X:153404725-153404747 AAATACGGGGCTCCTCCACATGG + Intergenic
1201286568 Y:12383742-12383764 AGAGATGGGGTTTCACCACATGG - Intergenic
1201966103 Y:19738007-19738029 AGAGATGGGGTTTCACCACATGG + Intronic