ID: 1161014517

View in Genome Browser
Species Human (GRCh38)
Location 19:1977144-1977166
Sequence CATGGTGCCCTGTCATGCCG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 141}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161014505_1161014517 26 Left 1161014505 19:1977095-1977117 CCAACACGGTGACCCAGCTGGAT 0: 1
1: 0
2: 0
3: 8
4: 74
Right 1161014517 19:1977144-1977166 CATGGTGCCCTGTCATGCCGCGG 0: 1
1: 0
2: 0
3: 13
4: 141
1161014507_1161014517 14 Left 1161014507 19:1977107-1977129 CCCAGCTGGATGGTGCCTGAGAG 0: 1
1: 0
2: 0
3: 14
4: 173
Right 1161014517 19:1977144-1977166 CATGGTGCCCTGTCATGCCGCGG 0: 1
1: 0
2: 0
3: 13
4: 141
1161014508_1161014517 13 Left 1161014508 19:1977108-1977130 CCAGCTGGATGGTGCCTGAGAGA 0: 1
1: 0
2: 2
3: 15
4: 165
Right 1161014517 19:1977144-1977166 CATGGTGCCCTGTCATGCCGCGG 0: 1
1: 0
2: 0
3: 13
4: 141
1161014504_1161014517 27 Left 1161014504 19:1977094-1977116 CCCAACACGGTGACCCAGCTGGA 0: 1
1: 0
2: 1
3: 13
4: 91
Right 1161014517 19:1977144-1977166 CATGGTGCCCTGTCATGCCGCGG 0: 1
1: 0
2: 0
3: 13
4: 141
1161014512_1161014517 -1 Left 1161014512 19:1977122-1977144 CCTGAGAGACGGGGCTGCCCCAC 0: 1
1: 0
2: 1
3: 11
4: 167
Right 1161014517 19:1977144-1977166 CATGGTGCCCTGTCATGCCGCGG 0: 1
1: 0
2: 0
3: 13
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161014517 Original CRISPR CATGGTGCCCTGTCATGCCG CGG Intronic
902527561 1:17069034-17069056 CATGGTGCCCTGACCTGCCAGGG - Exonic
904287663 1:29462467-29462489 CCTGGTGTCCTGGCATGCAGTGG - Intergenic
904947947 1:34213122-34213144 CGTGGTGCCCTGTCATTCCTGGG + Intronic
910281466 1:85506167-85506189 CATGTTGCCCTGTCAGGCCCGGG - Intronic
911019681 1:93374323-93374345 CATGGTGTCCTGTCCTACTGTGG + Intergenic
911171447 1:94774581-94774603 CAAGGTGCTCTCTCATGCCATGG - Intergenic
911450722 1:98056986-98057008 CATGGCCTCCTGTCATGCTGGGG + Intergenic
912464487 1:109861966-109861988 CATGGGGACCTGTCATGGGGTGG + Intergenic
915005297 1:152629943-152629965 CATGGTGCCCTATTATACTGTGG - Intergenic
920528461 1:206685210-206685232 CATGGTGCCCGGGGACGCCGGGG - Exonic
921456685 1:215380184-215380206 AATGGTGCCCTATCCTGCTGTGG - Intergenic
921492099 1:215789737-215789759 CATGGTGCCATTTCATGCCTGGG - Intronic
922585994 1:226735920-226735942 CATGGTGCCCTGCCAAACCCTGG + Exonic
924501864 1:244645589-244645611 CCTGTTGCCCTGTGAGGCCGAGG - Intergenic
1063161257 10:3420511-3420533 CTGGGTCCCCTGTCTTGCCGTGG - Intergenic
1063309492 10:4938839-4938861 CATGGTGCCTTGTGGTGCTGAGG + Intronic
1065754572 10:28919389-28919411 CACTGTGCCCTGTCATGCACTGG - Intergenic
1066292832 10:34029633-34029655 CGTGGTGTCCTGTCCCGCCGAGG + Intergenic
1068467887 10:57418408-57418430 CATGGGGGCCTGTCATGGGGTGG + Intergenic
1069635072 10:69920065-69920087 CCTGCTGCCCTGTCCTGCCTGGG - Intronic
1071566279 10:86672987-86673009 CATGGTCCCCTCTCATCCAGAGG + Intronic
1074153099 10:110776005-110776027 CATGATTCTCTGTCATGCCATGG - Intronic
1079465589 11:20726752-20726774 CATGGAGGCCTGTCATGGGGTGG - Intronic
1085546098 11:77319618-77319640 GATGATGCCCTTTCATGCTGGGG - Intergenic
1090608185 11:128446288-128446310 CATGGGGGCCTGTCATGGGGTGG + Intergenic
1090693955 11:129217397-129217419 CCTGGGGCCATGTCATGCCAAGG + Intronic
1091705172 12:2688710-2688732 CATGGTGCCCAGCCAGGCTGGGG + Exonic
1094741632 12:33296334-33296356 CCTGGTGCCCTGTCCTACTGTGG - Intergenic
1098395258 12:70010661-70010683 CCTGGTGCCCTATCTTGCTGTGG - Intergenic
1100904864 12:99286215-99286237 CCTGGTGCCCTGTCCTACTGTGG - Intronic
1102980622 12:117238131-117238153 CATGATGACCTGTCATGGCAAGG + Intronic
1108084055 13:46766664-46766686 CATGGTCCCCTGTGCTGCTGTGG + Intergenic
1108429945 13:50343481-50343503 CATGGGGGCCTGTCATGGGGTGG + Intronic
1110699943 13:78535379-78535401 CATGGTAGCCTGTCATCCCATGG + Intergenic
1112502586 13:99954610-99954632 CAGGGAGCTCTGTCATGCTGGGG + Intergenic
1113062445 13:106337833-106337855 CATGGGGCCCTGTCAGTCCTGGG - Intergenic
1114072722 14:19127343-19127365 CAAGGTGCCCTGTCCTTCTGTGG + Intergenic
1114089538 14:19272629-19272651 CAAGGTGCCCTGTCCTTCTGTGG - Intergenic
1114808918 14:25872787-25872809 CATGATGCCCTATAATGCCTTGG - Intergenic
1116403738 14:44542491-44542513 CATGGGGGCCTGTCATGGGGCGG + Intergenic
1118948331 14:70409906-70409928 TATGTTGCCCAGTCATGCCTTGG - Intronic
1121011261 14:90521538-90521560 CATGGAGACCTGGCATGCAGCGG + Intergenic
1121567354 14:94920091-94920113 CATGCTGCCCTGTCAGGCTGGGG + Intergenic
1122974593 14:105165908-105165930 CATGCTGCCCTGGCTTGCTGAGG - Intronic
1132321942 15:100931791-100931813 CATAGTGCACTGTCAGGCAGCGG - Intronic
1132663051 16:1070048-1070070 CAGGGTGCCCTGACATCCTGCGG - Intergenic
1139427894 16:66894514-66894536 CCTGGTCCCCTGTCCTGCCCTGG + Intronic
1153177935 18:2399961-2399983 CATGGGGGCCTGTCATGGGGTGG + Intergenic
1153277854 18:3385454-3385476 CATGGTGCCCTGCTCTGCCAGGG + Intergenic
1153823204 18:8850238-8850260 CATGGTGACCTGTCATTCCATGG - Intergenic
1156274937 18:35575453-35575475 CTTGTTGCCCTGTCATTCCTTGG - Intergenic
1157062310 18:44305826-44305848 CATGGGGGCCTGTCATGGGGTGG + Intergenic
1157860750 18:51138208-51138230 AATGAGGCCCTGTCATGCAGGGG + Intergenic
1161014517 19:1977144-1977166 CATGGTGCCCTGTCATGCCGCGG + Intronic
1161619460 19:5290648-5290670 CATGCTGCCCTGTCCTGGGGCGG + Intronic
1165645357 19:37431361-37431383 CCTGGTGCCCTATCATACTGTGG - Intronic
1168129988 19:54311942-54311964 CATGGTGCTCTGTCATGGATGGG + Exonic
926125169 2:10267585-10267607 CATGGCGCCCTGCCTTGTCGCGG - Intergenic
928862498 2:35875354-35875376 ACTGGTGCCCTGTCCTGCTGTGG + Intergenic
928973141 2:37052821-37052843 CATCTTGCCCTGTCCTGCCTAGG - Intronic
929525097 2:42694090-42694112 CCTGGTGCCCTGTCCTACTGTGG + Intronic
930162400 2:48171554-48171576 CATGGAGCCTTGTCATCCTGGGG + Intergenic
933134946 2:78722701-78722723 CATCGGGGCCTGTCATGCGGTGG - Intergenic
933880973 2:86669673-86669695 CATGGGGGCCTGTCATGGGGTGG + Intronic
934914091 2:98284375-98284397 CATGGTGCCCTGATATGACTGGG - Intronic
938408786 2:131047092-131047114 GATGGCGCCCTGTCCTGCCAAGG + Exonic
938828597 2:135031898-135031920 CATGGTGGCCTGGTCTGCCGTGG - Intronic
941851857 2:170191163-170191185 CCTGGTACCCTGTCCTACCGTGG + Intronic
943883739 2:193183547-193183569 CATGGTGCATTGTCATGGCATGG + Intergenic
945681421 2:212918555-212918577 CATGTTGCCCTGGCATGCTCTGG - Intergenic
948194569 2:236085711-236085733 CATGGTCCCTGGTCATGCCCTGG - Intronic
1168917275 20:1500428-1500450 CACGGTGCCCTATCCTGCTGTGG + Intergenic
1169225706 20:3855408-3855430 CATGGGGCCCTGTCCTGGCACGG + Intronic
1174125180 20:48299096-48299118 CATGGCGCCTGGTCCTGCCGGGG + Intergenic
1175366685 20:58460921-58460943 CCTGGTGCTCTGTCATGGGGAGG - Exonic
1175664852 20:60849852-60849874 AATGGTGGCCTGGCATGCAGGGG - Intergenic
1176039028 20:63054808-63054830 CAGGGTGGGCTGACATGCCGGGG - Intergenic
1176170127 20:63693000-63693022 CAAGGTGCCCTGGCTTGCAGAGG + Exonic
1177295031 21:19162785-19162807 CATGGTGCCCTGTCCTTCTGTGG + Intergenic
1179924372 21:44525975-44525997 CATGATGACCTGTAATGCGGGGG - Intronic
1180079788 21:45481408-45481430 CATGCTGCACTGGCATCCCGTGG + Intronic
1180491165 22:15849718-15849740 CAAGGTGCCCTGTCCTTCTGTGG + Intergenic
1180857590 22:19058205-19058227 CATGGTGCCCTGCCATGGGCAGG + Intronic
1184057143 22:42060209-42060231 CATGGAGCCTTGGCATGCCCAGG - Exonic
951130191 3:19033489-19033511 CACGGCGCCCTGCCATGCCTGGG - Intergenic
954250945 3:49366903-49366925 CCTGCTGCCCTGTCATGACAGGG + Intronic
954491766 3:50913292-50913314 ACTGGTGCCCTGTCTTGCTGTGG + Intronic
959693141 3:109220815-109220837 CATGGGGGCCTGTCATGGGGTGG + Intergenic
959806643 3:110562382-110562404 CCTGGTGCCCTATCCTGCTGTGG + Intergenic
960521213 3:118657933-118657955 CCTGGTGCCCTATCCTGCTGTGG + Intergenic
960835500 3:121902515-121902537 CATGGGGGCCTGTCATGGGGTGG - Intronic
962480040 3:135790040-135790062 CATGGGGGCCTGTCATGGGGTGG - Intergenic
965374716 3:167908979-167909001 CATGGTGGCCATTCATGCAGAGG + Intergenic
966594491 3:181713143-181713165 CAGGGCGCCCTGCCAGGCCGGGG + Exonic
968134192 3:196209580-196209602 CCTTGTGCCCTGTGATGCCGTGG - Intronic
968620662 4:1602066-1602088 CCTGGTGCCCTGGCACGCCAAGG - Intergenic
970963307 4:21898450-21898472 TCTGGTGCCCTGTCCTGCTGTGG - Intronic
972879952 4:43410555-43410577 CCTGGTGCCCTGGCAGGCAGGGG + Intergenic
973836313 4:54813045-54813067 CATGGGGGCCTGTCATGGGGTGG + Intergenic
975230211 4:71924061-71924083 CATGGTGCCCTGTGTTTCAGTGG + Intergenic
976453912 4:85223585-85223607 CATGGTGCCCTATCATATGGTGG + Intergenic
976975343 4:91160052-91160074 CATGGGGGCCTGTCATGGGGTGG - Intronic
977325738 4:95572623-95572645 CATGGTGCCCTTTCCTACTGTGG + Intergenic
981329160 4:143488368-143488390 CCTGGCGCCCTTTCATGCTGTGG - Intergenic
983338110 4:166421549-166421571 CCTGGTGCCCTATCATACTGTGG + Intergenic
983681155 4:170354941-170354963 CATGGGGGCCTGTCATGGGGTGG - Intergenic
986410399 5:7473638-7473660 CATGATACCCTGTCATTCCCAGG - Intronic
987545935 5:19310061-19310083 CAGGGTGCCATGTCATGGGGTGG + Intergenic
988352567 5:30130545-30130567 CATGGGGACCTGTCATGGGGTGG - Intergenic
994292900 5:98050991-98051013 CCTGGTGCCCTATCCTACCGTGG - Intergenic
996252095 5:121348031-121348053 CATGGGGACCTGTCAGGCCGTGG - Intergenic
997882897 5:137606083-137606105 CCTGGTGCCTTGTCTTGCAGGGG + Intergenic
1001494084 5:172175607-172175629 GATGGTGGCCTCTCATGCAGAGG - Intronic
1008017050 6:46532288-46532310 CATGGTGCCCTGTCGTTTCTAGG - Intergenic
1011386333 6:86802240-86802262 CTTGGTGCCCTGTCCTACTGTGG + Intergenic
1017022193 6:150149220-150149242 CATGTGGCCCTGTCATTCAGTGG + Intronic
1020619096 7:10496811-10496833 CATTTTGCCCTGCCATGCTGGGG + Intergenic
1021214659 7:17901151-17901173 CCTGGTGCCCTGTCCTACTGTGG + Intronic
1022347833 7:29534387-29534409 CATGGGGACCTGTCATGGGGTGG + Intergenic
1022749921 7:33213814-33213836 CCTGGTGCCCTATCCTGCAGTGG + Intronic
1023966544 7:44965843-44965865 CAAGGTGCCCCGCCATGCCTGGG + Exonic
1023990851 7:45127411-45127433 GATGGAGCCATGTCATGCCATGG - Intergenic
1026275036 7:68869231-68869253 CGTGCTGCCCTGTCATGGGGTGG - Intergenic
1029797364 7:102909722-102909744 ACTGGTGCCCTATCCTGCCGTGG + Intronic
1031581339 7:123478407-123478429 CATGGGGGCCTGTCATGGGGTGG + Intronic
1033242769 7:139694462-139694484 CACGGGGCACTGTCATGCTGAGG + Intronic
1035254621 7:157618462-157618484 CATGCTGCGCTGTCATGGTGGGG - Exonic
1035729705 8:1845448-1845470 TATGGTGCCTTGACATGCTGAGG + Intronic
1039914391 8:41849022-41849044 CCTGGTGCCCTGTCTGGCCCTGG - Intronic
1040485686 8:47869334-47869356 CCTGGTGCCCTGTTCTGCTGTGG - Intronic
1040876811 8:52161706-52161728 CATGCTGCTCTGTCCTGCCATGG - Intronic
1042297887 8:67242372-67242394 CCTGGTGCCCTGTCCTGCTGTGG - Intronic
1043687801 8:83109691-83109713 CATCGGGGCCTGTCATGCAGTGG + Intergenic
1047376451 8:124301639-124301661 CAGGGCGCCCTGCCAGGCCGGGG + Intergenic
1047774521 8:128058799-128058821 CATGGTCGTCTGTCATGCTGGGG - Intergenic
1052697629 9:31898560-31898582 CATGGTGGCCTGTCAGGAGGTGG - Intergenic
1055559759 9:77511018-77511040 CATGGTGCCCTATAATCCAGGGG - Intronic
1057864166 9:98666199-98666221 CATGGTACCCTGTCCTGCAGGGG - Intronic
1058767766 9:108198532-108198554 CTTGGTGCCCTATCCTGCTGTGG - Intergenic
1059937665 9:119327474-119327496 CATGGTTCCCTGTGATCCCATGG - Intronic
1188769495 X:34134482-34134504 CACGGTGGCCTGTCATGGAGTGG - Intergenic
1188827309 X:34851764-34851786 CCTGGTGCCCTATCATACTGTGG - Intergenic
1190431849 X:50385628-50385650 CATGGTGCCTTGCCCTGCCTTGG - Intronic
1190537810 X:51446948-51446970 ACTGGTGCCCTATCATGCTGTGG + Intergenic
1191116785 X:56860898-56860920 CCTGGTGCCCTATTATGCTGTGG + Intergenic
1191149914 X:57209516-57209538 CATGGTGCCCTGTTTTGCCATGG + Intergenic
1192064861 X:67872224-67872246 CATGGGGCCCTGTCGTGGGGTGG + Intergenic
1192694235 X:73398118-73398140 CATGGGGCACTGTCAGGCAGAGG + Intergenic
1193092516 X:77510102-77510124 CCTGGTGCCCTGTCCTACTGTGG - Intronic
1193563414 X:83047879-83047901 TCTGGTGCCCTGTCATACTGTGG + Intergenic
1194692965 X:97009766-97009788 CATGGTGCCCTGTCCTTCTGTGG + Intronic
1194793708 X:98183344-98183366 GATGGTGCCCACTCATGCAGAGG + Intergenic
1195050980 X:101096727-101096749 CATGGTGCCCAGTCTGGCCTCGG + Intergenic
1196221499 X:113116407-113116429 CATCCTGCTCTGTCATGCCTGGG - Intergenic
1200052388 X:153441500-153441522 CATCAAGCCCTGGCATGCCGTGG - Intergenic