ID: 1161014518

View in Genome Browser
Species Human (GRCh38)
Location 19:1977145-1977167
Sequence ATGGTGCCCTGTCATGCCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 71}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161014508_1161014518 14 Left 1161014508 19:1977108-1977130 CCAGCTGGATGGTGCCTGAGAGA 0: 1
1: 0
2: 2
3: 15
4: 165
Right 1161014518 19:1977145-1977167 ATGGTGCCCTGTCATGCCGCGGG 0: 1
1: 0
2: 0
3: 1
4: 71
1161014504_1161014518 28 Left 1161014504 19:1977094-1977116 CCCAACACGGTGACCCAGCTGGA 0: 1
1: 0
2: 1
3: 13
4: 91
Right 1161014518 19:1977145-1977167 ATGGTGCCCTGTCATGCCGCGGG 0: 1
1: 0
2: 0
3: 1
4: 71
1161014507_1161014518 15 Left 1161014507 19:1977107-1977129 CCCAGCTGGATGGTGCCTGAGAG 0: 1
1: 0
2: 0
3: 14
4: 173
Right 1161014518 19:1977145-1977167 ATGGTGCCCTGTCATGCCGCGGG 0: 1
1: 0
2: 0
3: 1
4: 71
1161014512_1161014518 0 Left 1161014512 19:1977122-1977144 CCTGAGAGACGGGGCTGCCCCAC 0: 1
1: 0
2: 1
3: 11
4: 167
Right 1161014518 19:1977145-1977167 ATGGTGCCCTGTCATGCCGCGGG 0: 1
1: 0
2: 0
3: 1
4: 71
1161014505_1161014518 27 Left 1161014505 19:1977095-1977117 CCAACACGGTGACCCAGCTGGAT 0: 1
1: 0
2: 0
3: 8
4: 74
Right 1161014518 19:1977145-1977167 ATGGTGCCCTGTCATGCCGCGGG 0: 1
1: 0
2: 0
3: 1
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161014518 Original CRISPR ATGGTGCCCTGTCATGCCGC GGG Intronic
900639399 1:3681566-3681588 AAGCTGCCCTGTCCTGCAGCCGG - Intronic
901424621 1:9173993-9174015 ATGGGGCTCAGTCATGCCTCAGG - Intergenic
902527560 1:17069033-17069055 ATGGTGCCCTGACCTGCCAGGGG - Exonic
904371393 1:30049768-30049790 ATGGTGCTCTGTTATGTGGCAGG + Intergenic
904702704 1:32367352-32367374 ATAGTGCCCTGTCAGGCCACAGG - Intronic
908119800 1:60975478-60975500 ATCATGCCCTCTCATGCCTCTGG + Intronic
919718788 1:200809884-200809906 ATGATGCCCTGTGCTGCCTCAGG - Intronic
1064494694 10:15896852-15896874 ATGGTAAACTGTCATGGCGCTGG + Intergenic
1067093464 10:43283602-43283624 AGGCTGCCCAGTCCTGCCGCAGG + Intergenic
1074035051 10:109730295-109730317 ATGTTGCCCTGTCATCAGGCTGG - Intergenic
1075716078 10:124556192-124556214 ACGGTGACCTCTGATGCCGCTGG + Intronic
1076741508 10:132488090-132488112 GTGGGGCCCAGTCAAGCCGCAGG - Intergenic
1078430592 11:11285199-11285221 ATGGTCCCTTGTCCTGCCTCTGG - Intronic
1089344296 11:117780705-117780727 GTGGTGCCCTGCCCGGCCGCGGG - Exonic
1091349336 11:134880548-134880570 CTGGTGTCCTGTCCTGCTGCCGG - Intergenic
1096973014 12:55682403-55682425 ATTGTGCCCCGTCATGGCACTGG - Intronic
1105753710 13:23445632-23445654 ATGGTGCCTTCCCATGCTGCTGG + Intergenic
1110488375 13:76072945-76072967 ATGGAGTCCTGTCTTGCAGCAGG - Intergenic
1112982966 13:105409584-105409606 ATGGTGCTCTGTCAGGAAGCTGG + Intergenic
1116403739 14:44542492-44542514 ATGGGGGCCTGTCATGGGGCGGG + Intergenic
1117820599 14:59644954-59644976 ATGGTGGCCTGTCCTCCCCCTGG - Intronic
1120975806 14:90247194-90247216 ATCCTGCCCTGTAATGCCCCTGG - Intergenic
1121011262 14:90521539-90521561 ATGGAGACCTGGCATGCAGCGGG + Intergenic
1121567355 14:94920092-94920114 ATGCTGCCCTGTCAGGCTGGGGG + Intergenic
1122235929 14:100330623-100330645 ATGGTGCTGAGTCCTGCCGCAGG + Intergenic
1132549734 16:549430-549452 ATGCTGCCCTGTGATGAGGCCGG + Exonic
1133728051 16:8555535-8555557 ATGGTAAACTGTCATGGCGCTGG + Intergenic
1143612208 17:8025320-8025342 TTAGTGCCCTCTTATGCCGCAGG - Intergenic
1144586624 17:16491592-16491614 ATGGAGCCCTGTCTGGCAGCAGG - Intronic
1150433920 17:65139555-65139577 CCGGTGCCCTTTCATGCCTCAGG + Intronic
1152698968 17:81809993-81810015 AAGGGGCCCTGTCATTCCTCAGG + Intronic
1153823203 18:8850237-8850259 ATGGTGACCTGTCATTCCATGGG - Intergenic
1160336287 18:78043097-78043119 ATGCTGCCCTGTCATTGCCCAGG - Intergenic
1161014518 19:1977145-1977167 ATGGTGCCCTGTCATGCCGCGGG + Intronic
1161619461 19:5290649-5290671 ATGCTGCCCTGTCCTGGGGCGGG + Intronic
925958567 2:8993875-8993897 ATGGTGCCCTCTCCAGCCCCTGG + Intronic
927964990 2:27262884-27262906 ATGGAGCCCTCTCCAGCCGCTGG - Exonic
929403512 2:41612911-41612933 ATTGTACACTGTCATGGCGCTGG + Intergenic
929691968 2:44082423-44082445 ATTTGGCCCTGTCATGCCCCAGG + Intergenic
935675539 2:105592368-105592390 ATGCTGGCCTGGCATGCCACTGG + Intergenic
938408787 2:131047093-131047115 ATGGCGCCCTGTCCTGCCAAGGG + Exonic
943541919 2:189226479-189226501 ATGGTGCTCTGTCAGGCAGAAGG - Intergenic
1172798479 20:37559759-37559781 ATGGTAAACTGTCATGGCGCTGG - Intergenic
1178803485 21:35818734-35818756 TTGGAGCCCTGCCATGCCCCTGG - Intronic
1178856008 21:36250939-36250961 ATGTTGGCGTGTCATGCCGGCGG - Intronic
1185168716 22:49278464-49278486 ATGGGGCCCTGAGCTGCCGCAGG + Intergenic
949830086 3:8205083-8205105 ATGCTGCCCAGACATGCGGCAGG + Intergenic
957907708 3:86578912-86578934 ATGCTGCCCTGTCATGGCAGAGG - Intergenic
959473651 3:106783648-106783670 ATGGGGGCCTGTCAGGCGGCTGG + Intergenic
969497824 4:7535988-7536010 ATGTTTCCCTGTGATGCTGCTGG + Intronic
970408997 4:15789791-15789813 GTGATGCCCTGTCCTGCCTCAGG + Intronic
970431228 4:15990757-15990779 ATGGTTAGCTGTCATGGCGCTGG - Intronic
996252094 5:121348030-121348052 ATGGGGACCTGTCAGGCCGTGGG - Intergenic
999690322 5:154140783-154140805 AAGGGACCCTGTCATGCTGCAGG - Intronic
1002805570 6:570818-570840 ATGCTCCCCTGTCATGCCTTTGG - Intronic
1006153887 6:32003761-32003783 AAGGTACCCTGTCCTGCCCCCGG - Intergenic
1006160195 6:32036498-32036520 AAGGTACCCTGTCCTGCCCCCGG - Intergenic
1008380368 6:50834314-50834336 ATTCTGCCCTGTCATGGGGCGGG - Intronic
1012439663 6:99251839-99251861 AGGCTCCCCTGTCATCCCGCAGG + Intergenic
1017750291 6:157485247-157485269 GTGGTGCCCTGTACTGCAGCAGG + Intronic
1023990850 7:45127410-45127432 ATGGAGCCATGTCATGCCATGGG - Intergenic
1027525721 7:79266637-79266659 ATGTTGCCATGTCATGTAGCTGG - Intronic
1043390333 8:79785540-79785562 CTGGAGCCCTGTGCTGCCGCTGG - Intergenic
1061594364 9:131619379-131619401 AGGGTGCCCTTTCATGCAGATGG - Intronic
1062446320 9:136596887-136596909 CTGGTGCCCTCTCCTGCCCCAGG + Intergenic
1186030871 X:5367661-5367683 ATGGTGCCCTTTCATGAAACTGG - Intergenic
1188433933 X:30139086-30139108 ATGTTGCCATGGCATGGCGCTGG + Intergenic
1194793709 X:98183345-98183367 ATGGTGCCCACTCATGCAGAGGG + Intergenic
1200011901 X:153126130-153126152 CTGGTGGCCTGTCACGGCGCAGG + Intergenic
1200011972 X:153126454-153126476 CTGGTGACCTGTCACGGCGCAGG + Intergenic
1200027629 X:153273465-153273487 CTGGTGACCTGTCACGGCGCAGG - Intergenic
1200027700 X:153273789-153273811 CTGGTGGCCTGTCACGGCGCAGG - Intergenic
1200755319 Y:6985213-6985235 CTGGCGCCCTGTCCTGCTGCTGG - Intronic