ID: 1161015000

View in Genome Browser
Species Human (GRCh38)
Location 19:1979100-1979122
Sequence TGCGCGCGCGCGGCGGGGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 714
Summary {0: 1, 1: 0, 2: 14, 3: 77, 4: 622}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161014993_1161015000 -6 Left 1161014993 19:1979083-1979105 CCTGGGCAAGGGTGAGCTGCGCG 0: 1
1: 0
2: 1
3: 16
4: 115
Right 1161015000 19:1979100-1979122 TGCGCGCGCGCGGCGGGGGGCGG 0: 1
1: 0
2: 14
3: 77
4: 622

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161015000 Original CRISPR TGCGCGCGCGCGGCGGGGGG CGG Intronic
900100723 1:960953-960975 TGGGCGCGCGGGGCGCGGGTGGG - Intronic
900102148 1:966462-966484 TGCCCGCGGGAGGCGGGGGCAGG + Intergenic
900113728 1:1020058-1020080 GGCGGGCGGGCGGGGGGGGGCGG - Intergenic
900162826 1:1232417-1232439 CGCGCGGGCGCGGGGGGAGGCGG - Exonic
900237476 1:1599701-1599723 GGCGCGCACGCGGCGCGCGGCGG + Exonic
900258871 1:1712297-1712319 GGAGCGCGAGCGGCGGGCGGAGG - Exonic
900418694 1:2546412-2546434 CGAGCGCGCGGGGCGGAGGGCGG - Intergenic
900671439 1:3857245-3857267 TGCGCAGGCGCGGCCTGGGGTGG - Intronic
901063771 1:6485523-6485545 TCCCCGCGCTCGGCGGGGGCGGG - Intronic
901242869 1:7704959-7704981 GGCGCGCGCGGGGCGGGGGCGGG + Intronic
901433882 1:9234723-9234745 GGGGCGCGCGCGGCGGGGGCGGG - Intergenic
901641432 1:10694887-10694909 AGCGCGCGCGCGGCCGCCGGCGG - Intronic
901660149 1:10794202-10794224 CGCGCGCGCGCGTCGTGGGTTGG + Intronic
902214289 1:14924576-14924598 GGTGCGCGCGGGGCGGGGCGGGG + Intronic
902465196 1:16613226-16613248 TGCGCGAGCGCGGGGGCGGGTGG - Intronic
902585666 1:17437784-17437806 TGCGCCCGGGCGCCGCGGGGAGG - Intronic
902893338 1:19461086-19461108 TGGGCGGGGGCGGGGGGGGGAGG + Intronic
903044245 1:20553711-20553733 TGCGCTCGCTCGGCGGCGGCCGG - Exonic
903069100 1:20717826-20717848 GGCGGGGCCGCGGCGGGGGGCGG + Exonic
903155607 1:21440438-21440460 TGCGCGAGCGCGGGGGCGGGTGG + Intronic
903413954 1:23168720-23168742 GGCGGGAGCGCGGCGCGGGGAGG - Intronic
903750486 1:25617726-25617748 TGCGGGGGCGCGGTGAGGGGAGG - Exonic
903855688 1:26336582-26336604 TGCGTGCCGGCCGCGGGGGGCGG - Intronic
903925234 1:26826930-26826952 TGCTCCAGCGCGGCGGGGCGGGG - Exonic
904171036 1:28592410-28592432 TGGGCGCGGGGAGCGGGGGGCGG + Intronic
904181350 1:28668861-28668883 CGCGCGGGCGCGGGGTGGGGTGG + Intronic
904244972 1:29181454-29181476 TGCGCCTGCGCGGGTGGGGGTGG - Intronic
904500155 1:30908597-30908619 CGGGCGCGGGCGGCGGGCGGCGG + Exonic
904618192 1:31761027-31761049 GCCGCGCGGGCGGCGGGGGAGGG + Intronic
905275299 1:36813745-36813767 AGCGGGGGCGGGGCGGGGGGTGG + Intronic
905449374 1:38046908-38046930 CGGGCGCGCGGGGCGGGGGCCGG - Intergenic
906615837 1:47232253-47232275 GGCGGGCGCGGGGCGGGCGGGGG - Intergenic
906650322 1:47508275-47508297 AGCGCGTGGGCCGCGGGGGGCGG + Intergenic
907278229 1:53328465-53328487 TGTGCGCGTGGGGCGGGGGAGGG + Intergenic
907526481 1:55056870-55056892 CGCGCGCGCGCGTTGGGGGTGGG + Intronic
908014118 1:59814520-59814542 CGCGCGTGCGCGGCGGGGATTGG - Intergenic
908544088 1:65147779-65147801 CGCGCGCGGGCGGCGGGCAGCGG + Intronic
908605332 1:65792376-65792398 AGAGCGCGGGCGGCCGGGGGAGG + Intergenic
910597123 1:88992554-88992576 GGCGGGCGCGCGGCGCGGCGCGG - Intronic
910760934 1:90730440-90730462 TGCGTGCGCGCGCCTGGGTGTGG - Intergenic
912416239 1:109509767-109509789 CGCGTGCGCGCGGCGGGGGCGGG + Intergenic
912492709 1:110070726-110070748 GCGGCGCGCGCCGCGGGGGGCGG + Intronic
912514671 1:110210417-110210439 GGCTCGCGCGCGGCAGGGGGCGG - Intergenic
916651665 1:166839606-166839628 TGAGTGCGCGCGGGCGGGGGCGG + Intronic
917433920 1:174999956-174999978 TGCGTGCTCGCGGTGGGCGGTGG + Exonic
917869620 1:179229720-179229742 GGCGGGCGGGGGGCGGGGGGCGG - Intergenic
918995792 1:191757535-191757557 TGTGCGCGCGCGTGGGTGGGTGG - Intergenic
919748626 1:201023474-201023496 GGCGCGGGCGCGGCTGGCGGAGG + Exonic
919892002 1:201982576-201982598 GGGGCCCGCGCGGCGGGGGCGGG + Intronic
920230440 1:204466469-204466491 TGTGCATGGGCGGCGGGGGGTGG + Intronic
920600598 1:207320867-207320889 CGCGCGCGCGCGCCTCGGGGCGG - Intergenic
920912674 1:210233025-210233047 TGGGCGCGGGCCGCGGGGGCGGG + Intronic
920922638 1:210311132-210311154 CGCGCGCACGTGGCGGGGGGGGG - Intergenic
920922640 1:210311134-210311156 TGCGCGCGCACGTGGCGGGGGGG - Intergenic
921189875 1:212699786-212699808 GGCGCGCGGGCGGGGCGGGGCGG - Exonic
922440533 1:225652659-225652681 GGGGCGCGCGGGGCGGGGGCCGG - Intronic
922958557 1:229625814-229625836 CGCGCGCGCGCGGGCGGGCGGGG - Intronic
922958559 1:229625816-229625838 CGCGCGCGCGCGCGGGCGGGCGG - Intronic
923181967 1:231528554-231528576 TACGCTCGCGCGGCGGTGGCGGG + Intergenic
923299714 1:232630046-232630068 TGCGCTCGGGCGGCCGGCGGGGG + Intergenic
923372739 1:233328699-233328721 GCGGCGCGCGCGGCGGGGGCCGG - Exonic
923783231 1:237043300-237043322 TGCGCGCGCGCGGGTGGTGGTGG + Intronic
924289510 1:242523995-242524017 TGAGCGCGCGCGGGGCGCGGGGG - Intronic
924415222 1:243850471-243850493 GGGGCGCGCCCGGCGCGGGGAGG + Intronic
924754800 1:246931531-246931553 TGGGCCCGCGCGGCGGAGGGCGG - Intronic
1062795824 10:344386-344408 GGCGGGGGCGGGGCGGGGGGGGG + Intronic
1062843517 10:688862-688884 TTCGCGGGCGCTGCGCGGGGAGG - Intronic
1062843814 10:689789-689811 AGCGCGCGCGGGGCGGGCCGGGG - Intergenic
1063115538 10:3068977-3068999 TGAGCGCGCGGGGCGGGCGCGGG + Intronic
1064418232 10:15168721-15168743 GGCGCGGGCGGGGCGGGGCGGGG - Intergenic
1065099094 10:22316274-22316296 CGCGCGGGCGCGGAGGCGGGCGG + Exonic
1065099106 10:22316326-22316348 CGCGCGCACGCGGCTCGGGGCGG - Exonic
1065140471 10:22714450-22714472 AGCGCGCCGGCGGCGGCGGGCGG - Exonic
1065726049 10:28668823-28668845 TGCGCACGGGCGGCCCGGGGCGG + Intergenic
1066464400 10:35640333-35640355 GGCGCGGGCGCGGCGGGCGCGGG - Exonic
1068620480 10:59176584-59176606 CGCGCGCTCCCGGCGGGGAGGGG - Exonic
1070112113 10:73496029-73496051 TGCGCGTGCGGGGGTGGGGGCGG + Intergenic
1070150251 10:73800874-73800896 TGTGCGTGCGCGGGGGGCGGAGG + Intronic
1072021837 10:91410285-91410307 GGCGCGGGCGCGGGCGGGGGCGG + Exonic
1073147955 10:101292622-101292644 TGCGTGTGCGCGGCGGGCGCGGG - Intergenic
1075131514 10:119743646-119743668 TGGGGGCGGGGGGCGGGGGGGGG + Intronic
1076242816 10:128922782-128922804 TGCTCGCCCGGGGCGGGGGCTGG - Intergenic
1076710599 10:132331882-132331904 TGCGCGGGGGTGGCAGGGGGTGG - Intergenic
1076878766 10:133230136-133230158 GGGGCGCGCGGGGCGGGGCGGGG + Intergenic
1077021898 11:420694-420716 TGCGTGGGCGCTGCGGGGCGGGG - Intronic
1077051451 11:568678-568700 TGCGAGGGCGCGGCGGGGCCAGG + Intergenic
1077052979 11:576034-576056 TGCGGGCGCGAGGCGGGGCGGGG + Intergenic
1077544999 11:3165331-3165353 AGCGAGGGCGCGGCGGAGGGAGG + Exonic
1077637844 11:3855638-3855660 GGCGGGCGGGCGGCGCGGGGCGG - Intronic
1078023527 11:7673765-7673787 TGCGGGCCCGCGGCGGGGAGCGG - Exonic
1078415134 11:11158381-11158403 TGGGGGCGGGCGGTGGGGGGGGG + Intergenic
1078514325 11:12009283-12009305 TGCGGGAGCGCGGCGGGGTGCGG + Intronic
1078594427 11:12674501-12674523 TGGGCGCCCGCGGCGGGCGGCGG - Intergenic
1079064369 11:17276713-17276735 CGGGCGCGCGCGGCGGGAGGAGG + Intronic
1079076745 11:17389212-17389234 AGCGCCCGGGCGGCGGGAGGGGG - Intronic
1080746486 11:35112622-35112644 TGGGGGCGGGGGGCGGGGGGCGG + Intergenic
1081528276 11:43942075-43942097 TGCGCGCGCGCGCCTGCGGAGGG + Intronic
1081528280 11:43942081-43942103 CGCGCGCCTGCGGAGGGGGGTGG + Intronic
1081863529 11:46347518-46347540 CGGGGGCGCGCGGCGCGGGGCGG + Intronic
1081981426 11:47269614-47269636 GGCGCGCGCGGGGAGTGGGGGGG - Intronic
1083579092 11:63813542-63813564 GGCGGGCGGGCGGCGGGGAGGGG + Exonic
1083657043 11:64234722-64234744 GGCCCGGGCGCGGCGGGCGGGGG - Exonic
1083753613 11:64777791-64777813 CGCACGCGCGCTGTGGGGGGAGG - Intronic
1083890295 11:65592507-65592529 TGCGCGCTCGCGGCGGGTGCGGG + Exonic
1084070081 11:66728186-66728208 GGCGGGGGCGCGGCGGGCGGGGG + Intronic
1084070122 11:66728320-66728342 GGGGCGCGCGGGGCGGGCGGCGG + Intronic
1084112552 11:67023389-67023411 TGCGTGCGCGCTGCGGGAGGCGG + Intronic
1084151230 11:67288954-67288976 CGCGCGTGCGCGGCGGGCCGCGG - Intronic
1084151460 11:67289624-67289646 TGAGCGGGCGGGGGGGGGGGGGG - Intronic
1084187637 11:67483298-67483320 TGCGCATGCGAGGCGGGAGGAGG + Intronic
1084517153 11:69643264-69643286 GGCTCGCGGGGGGCGGGGGGCGG - Intronic
1084526901 11:69703581-69703603 GGGGCGCGCGCAGCGGGGTGGGG + Intronic
1084972999 11:72781606-72781628 GGCGGGCGCGGGGCGGGTGGCGG + Intronic
1085266790 11:75242125-75242147 CGCGGGCGCGCGGCGCGGGTCGG - Exonic
1085396887 11:76210852-76210874 CGCGCGCGGGGGGCGGGGGCGGG + Intergenic
1086993447 11:93330654-93330676 GGCGGGAGCGCGGCGGCGGGTGG + Intronic
1088869024 11:113875647-113875669 TGCGCGCGCATGCCGGGGGCGGG - Intergenic
1089262559 11:117232703-117232725 TGAGCGGGCGGAGCGGGGGGAGG - Exonic
1089515857 11:119030898-119030920 TGCGCAAGCGCGGCCGGCGGGGG + Exonic
1090664544 11:128905744-128905766 TGGGGGGGCGGGGCGGGGGGAGG + Intronic
1091616203 12:2052927-2052949 GGCGCGGGCGCGGCGGGGCTGGG + Intronic
1091778478 12:3199730-3199752 TGCGTGCGCGCCGAGGGGGCGGG + Intronic
1092045942 12:5431982-5432004 CGGGCGCGCGCGGCGCGGCGCGG + Intergenic
1092502840 12:9065156-9065178 TGGGCGGGGGCGGGGGGGGGGGG - Intergenic
1092743266 12:11649958-11649980 GGAGCGCGCGGGGCGGGGCGGGG - Exonic
1093488624 12:19680707-19680729 TGGGCGGGGGCGGGGGGGGGTGG + Intronic
1094041466 12:26124940-26124962 TGTGCGAGCGCGGTGGAGGGGGG - Exonic
1094218512 12:27970350-27970372 GGCGGGCGCGCGGGGGGCGGGGG + Intronic
1094565030 12:31591172-31591194 TGGGAGCGCGGGGCGGGCGGGGG + Intergenic
1095687239 12:45050484-45050506 GGCGCGGGCGCGGCTGGGGAGGG + Intronic
1095752965 12:45730318-45730340 CGCGTGCGCGCGGCGGGCGCGGG + Intronic
1096101295 12:48971829-48971851 CGCGCGCGCGCGCTGGGAGGAGG - Intergenic
1096127672 12:49131477-49131499 TGGGCGCGCGGGGCCGGAGGAGG - Intergenic
1096284144 12:50283545-50283567 CGCGCCCCCGCGGCGGTGGGCGG - Intronic
1096435931 12:51591157-51591179 GGCGCGCGCGCGGTGGCGCGCGG + Intronic
1096461135 12:51821848-51821870 TGCAGGAGCGCGGCCGGGGGCGG + Intergenic
1096647634 12:53047331-53047353 GGCGGGGGCGCGGCGGGGCGGGG - Intronic
1096847900 12:54418201-54418223 TGTGCGCGCGTGAAGGGGGGTGG - Intronic
1096870294 12:54588507-54588529 TGGGCCCGCGCTGCGGCGGGAGG + Exonic
1096994613 12:55830805-55830827 CGCGTGCGCGCGGTGGGGGGAGG - Intronic
1097218147 12:57430501-57430523 TGGGGGCGCGGGGCGGAGGGCGG - Intronic
1097267705 12:57755468-57755490 GGCTCGCTAGCGGCGGGGGGAGG - Exonic
1097815804 12:64072141-64072163 TGTGTGTGGGCGGCGGGGGGGGG + Intronic
1098369187 12:69739074-69739096 CGCGCGGGCGCCGAGGGGGGCGG - Intronic
1099989557 12:89708558-89708580 CGCCCGCCCGCGGCCGGGGGCGG - Intronic
1100391750 12:94150109-94150131 TGGGGGCGAGCGGCGGGGCGGGG + Intronic
1100583394 12:95956894-95956916 TGAGCGCGCCCGGCGGGAGCTGG + Exonic
1100613339 12:96210541-96210563 TGCGCCCGCGCGCAGGGCGGTGG - Intronic
1100679850 12:96907332-96907354 TGCGCGGACGCGGCGGGCGGGGG - Intronic
1100869421 12:98894927-98894949 CGAGGGCGCGCGGCGGGGGGTGG - Intronic
1101772157 12:107761255-107761277 TGCGCACGCGCGGAGGGGCCTGG - Intronic
1102025709 12:109713547-109713569 TGCGCGCCGGCGCCGGGTGGAGG - Intergenic
1102084400 12:110124293-110124315 TGCGCGCGCGCGCGGGAGAGCGG + Intergenic
1102197387 12:111034783-111034805 TGCCGGCGAGCGGCGGGGCGCGG - Intronic
1102543359 12:113638057-113638079 TGCGGGCGGCCGGCGGGGAGTGG - Intergenic
1103048767 12:117761201-117761223 TGGGGGTGCGCGGCGGGGTGCGG + Exonic
1103325363 12:120116666-120116688 TGCGCGCGGGCGGGCGGGGTCGG + Exonic
1103488198 12:121296743-121296765 GGCGGGCGCGCGGGGGGCGGGGG + Intronic
1103488200 12:121296747-121296769 GGCGCGCGGGGGGCGGGGGCGGG + Intronic
1103562411 12:121799703-121799725 TACGCGCTCGCAGCTGGGGGGGG + Intronic
1103698542 12:122835643-122835665 GGCGAGCGGGCGGCGGGCGGCGG + Exonic
1104049522 12:125186358-125186380 AGCGAGCGAGCGCCGGGGGGAGG - Intergenic
1104215034 12:126726605-126726627 AGAGCGCGGGCGGCGGGGAGGGG - Intergenic
1104854333 12:131894966-131894988 CGGGGGCGCGGGGCGGGGGGTGG - Exonic
1104977756 12:132559927-132559949 AGCGCGGGCGGGGCGGGGGCGGG - Intronic
1105040272 12:132956016-132956038 TGGGGGCGCGCGGGGGTGGGAGG - Intronic
1105871879 13:24512682-24512704 TGCGTGGGCGCTGCGGGGTGGGG - Intronic
1106735663 13:32586258-32586280 TGCGTGCGCGCGGACGGGGCGGG + Intergenic
1106735673 13:32586295-32586317 TGCGCGCGCGCGGACGGGGCGGG + Intergenic
1106776694 13:33016370-33016392 CGGGCGGGCGCGGCGGGGCGCGG + Intergenic
1107073599 13:36297886-36297908 TGCCCGCAGGCGGCAGGGGGTGG + Intergenic
1107133529 13:36920367-36920389 TGCGCGGGCCCGGCGGGGGGCGG + Intronic
1107468029 13:40666654-40666676 GGCGCGCGCGCCGCCGCGGGCGG - Intergenic
1107605218 13:42049169-42049191 GGCGCGGGCGGGGCGGGGAGGGG + Intronic
1108363710 13:49690492-49690514 TGCGCGTGTGTGGTGGGGGGCGG + Intronic
1108403993 13:50081649-50081671 TGCGAGTGGGCGGCGGCGGGCGG - Intergenic
1110705973 13:78602256-78602278 GGCGCGGGCGCGGCGGCCGGCGG - Exonic
1113655641 13:112066767-112066789 TGGGCGCGGGCGGCGGAGCGGGG - Intergenic
1113820277 13:113208729-113208751 TGCGCACCCGCGGCGGGGCCGGG - Intronic
1114485167 14:23057651-23057673 CGGGCCCGCGCGGCGGGGGCGGG + Intergenic
1115502216 14:34060123-34060145 GGCGAGCGCGCGGCGGGGCGCGG + Intronic
1115610658 14:35046233-35046255 GGCTCGCGCGGGGCGGGGCGGGG - Intronic
1115851751 14:37595023-37595045 GGCGGCCGCGCGGCGCGGGGCGG + Exonic
1117392060 14:55271636-55271658 TGCGCTCCCGGGGCGCGGGGCGG + Intronic
1118836923 14:69484467-69484489 TGGGCGCGCGGGGCGGGGACGGG + Intergenic
1119457614 14:74769854-74769876 TGTGGGCGGGGGGCGGGGGGGGG - Intronic
1121473388 14:94174053-94174075 TGCGCACGCGCTGTGGGGTGGGG + Intronic
1121616994 14:95319930-95319952 GGCGCGGGCGGGGCGGGGCGGGG + Intergenic
1121879434 14:97486907-97486929 TGGGCGGGCGAGGCCGGGGGCGG + Intergenic
1122081955 14:99272797-99272819 TGGTCGCGGGCGGCGAGGGGAGG + Intergenic
1122108725 14:99480684-99480706 TGCGCCCGCGCGGCCCGCGGGGG - Intronic
1122220722 14:100238140-100238162 CGCGAGCGCCCGGCGGGGTGCGG - Intergenic
1122226866 14:100285477-100285499 TGCGCGTGCGCAGCGCGGAGCGG + Intergenic
1122582077 14:102777379-102777401 CGCGCGCGGGCGGCGGGGGCGGG + Intergenic
1122904547 14:104795759-104795781 GGCGGGCGCGGGGCGGGGAGAGG - Intergenic
1122978752 14:105181685-105181707 TCCGCGGGCGGGGCCGGGGGCGG + Intergenic
1123004452 14:105314678-105314700 GGCGCGCGCGGGGCGGCCGGGGG + Exonic
1123034300 14:105465647-105465669 TGCACGCCCTCGGCAGGGGGAGG + Intronic
1123035500 14:105470235-105470257 GGCGGGCGAGGGGCGGGGGGCGG - Exonic
1124427056 15:29570980-29571002 GGAGCGCGCGGGGCGGGCGGGGG - Intergenic
1126348121 15:47717790-47717812 TGTGTGCGCGCGGTGGGGGTCGG + Intronic
1127868142 15:63048355-63048377 CGGGCGCGCGCGGCTGGGAGGGG - Intronic
1128067881 15:64775647-64775669 CGGGCGCCGGCGGCGGGGGGCGG + Intergenic
1128370054 15:67033853-67033875 AGCGCGGCCGCGGCGGGGGACGG - Intergenic
1128547745 15:68579216-68579238 GGCGCGGGCGCGGCGTGCGGGGG - Exonic
1128791139 15:70434712-70434734 TGCGCGCGCGCGCGCGCGGGTGG - Intergenic
1129199874 15:73992333-73992355 TGCGCCCGCGCCGCCGCGGGTGG - Exonic
1129273967 15:74433514-74433536 GGCGAGCGAGCGGCGGGGGCCGG - Intronic
1129983557 15:79896738-79896760 AACGTGCGCGCGCCGGGGGGTGG + Intronic
1129983561 15:79896742-79896764 TGCGCGCGCCGGGGGGTGGGGGG + Intronic
1130224400 15:82046250-82046272 GGCGCGCGCCAGGCCGGGGGCGG + Intergenic
1131692779 15:94844992-94845014 TCCCCGAGCGCGGCGGGAGGCGG + Intergenic
1132092495 15:98957478-98957500 TGCGCACGCGCAGCGGGGTGGGG + Exonic
1132398145 15:101489266-101489288 CGCGCGCGCGGGGCCGGGGCCGG + Intronic
1132591152 16:727011-727033 GGCGCGTCCGCGGAGGGGGGCGG + Intronic
1132724686 16:1333650-1333672 TCGGCGCGCGCGGCTGGGAGCGG + Intronic
1132880204 16:2158755-2158777 AGCGTGGGCTCGGCGGGGGGGGG + Intronic
1132885117 16:2179094-2179116 AGCGCGGGCGCGCCGGGGGACGG + Exonic
1133032901 16:3020240-3020262 TGAGCGGGCGCCGCGGGGCGGGG + Intronic
1134149830 16:11797051-11797073 GGCGCGCGCGGGGGGGGCGGGGG + Intronic
1134696981 16:16232521-16232543 CGCGCGTGCGCGGCGGCGGCTGG + Exonic
1136146706 16:28320615-28320637 TGCGCGCGCGGTGCGAGGGCCGG - Exonic
1136399870 16:30011440-30011462 CGCGCGCGGGCGGGGGCGGGGGG - Intronic
1136399875 16:30011444-30011466 GCCGCGCGCGCGGGCGGGGGCGG - Intronic
1136505315 16:30699041-30699063 CGCGCGTGCGCGGCTGGAGGCGG - Intronic
1136540009 16:30923817-30923839 TGCGCGCGGGCTGGGGGGGGCGG + Intronic
1137454814 16:48610094-48610116 TGAGGGCGGGCGGCGGGGCGCGG - Exonic
1137531763 16:49282408-49282430 CGTGCGCGCGCGGCGGGGCGGGG + Intergenic
1137765868 16:50977268-50977290 TTCATGCTCGCGGCGGGGGGAGG - Intergenic
1138105878 16:54286938-54286960 CCCGCGCGCGGGGCGGGGCGGGG + Intergenic
1138619046 16:58197598-58197620 TCAGCGGGCCCGGCGGGGGGCGG + Intronic
1139602292 16:67993935-67993957 TGTGCGGTCGGGGCGGGGGGCGG - Intronic
1139917886 16:70439252-70439274 GGCGCGCGTGCGGGGGGCGGAGG - Intergenic
1140927571 16:79599175-79599197 GGCGGGGGCGCGGCGGGGGCGGG - Exonic
1141054587 16:80803939-80803961 GGCGCGGGCGCCGCGGGAGGCGG + Intronic
1141538470 16:84699953-84699975 TGGCCGCGCGCCGCGGGGCGCGG - Intergenic
1141608525 16:85169105-85169127 GGCGGGCGCGCGGCGGGCGGGGG - Intergenic
1141972344 16:87492453-87492475 GGCGCGCGCGGGGCGCCGGGGGG + Intergenic
1142049868 16:87951351-87951373 TGGGCGCGCGGGCCCGGGGGCGG - Intronic
1142184205 16:88686615-88686637 TGCGCGGGCGGGACGGGGCGGGG + Intergenic
1142240374 16:88941917-88941939 GGCGAGCGCGGGGCAGGGGGCGG - Intronic
1142395315 16:89828450-89828472 GGCGCTCGCGCGGGGCGGGGCGG + Intronic
1142429745 16:90019568-90019590 GGCGCGCGCGGGCCGGGGCGGGG - Intronic
1142509658 17:385831-385853 GGCGGGGACGCGGCGGGGGGTGG - Intronic
1142704225 17:1684401-1684423 TGCGCGCGCGCAGGCGGGTGGGG - Intronic
1142704227 17:1684403-1684425 TGTGCGCGCGCGCAGGCGGGTGG - Intronic
1142785919 17:2222541-2222563 TGCGGGGGCGGGGGGGGGGGGGG + Intronic
1142810215 17:2392676-2392698 TGCGCGCGTGCTTCGGGGTGGGG - Intronic
1142812463 17:2401656-2401678 TGCGAACGCACTGCGGGGGGAGG - Intergenic
1143521223 17:7445411-7445433 TGAGGGCGCGCGGGGGGTGGAGG + Intronic
1143565292 17:7717213-7717235 TGCGGGGGGGCGGCGCGGGGCGG - Intergenic
1143750362 17:9022612-9022634 TGAGCGAGCGCGGCGAGGAGCGG + Exonic
1144172832 17:12676225-12676247 TGCGTGCGCGCGCAGGGGGAGGG - Intronic
1144757151 17:17686608-17686630 TGCACGCGCGCGCCGGGGAGGGG + Intronic
1144759696 17:17700416-17700438 TGCGCGCGAACGCCGAGGGGCGG - Intronic
1145049652 17:19649128-19649150 CGCACGCGTGCGGCGGGGTGTGG + Intronic
1145243505 17:21253005-21253027 TGCAAGCGCGCGCCGCGGGGTGG - Intronic
1145925618 17:28644836-28644858 AGGGGGCGCGCGGCGAGGGGAGG - Intronic
1145937981 17:28726276-28726298 GGGGCGCGGGCGGCTGGGGGCGG - Intronic
1147168672 17:38605952-38605974 TGCGCGCGCGCGGGCCGGCGCGG + Intergenic
1147360561 17:39927288-39927310 TGCGAGCGGGAGGCCGGGGGTGG - Intronic
1147395695 17:40140785-40140807 TGCGCGCAGGCGGGGCGGGGTGG + Intronic
1147774328 17:42889935-42889957 TGTGGGCGGGCGGCGGGGAGGGG + Intergenic
1148013357 17:44503460-44503482 TGCGCGCGCCCGGTGGGCGTGGG - Intergenic
1148225608 17:45896252-45896274 TCCGTGCGCGCTGCGGGCGGCGG + Intronic
1148284093 17:46372783-46372805 GGCGCGCGCGCGGCGGGGGCGGG + Intergenic
1148306314 17:46590704-46590726 GGCGCGCGCGCGGCGGGGGCGGG + Exonic
1150225600 17:63523096-63523118 CGCGCGCCGGCGGCGGGGAGGGG - Intergenic
1150250066 17:63700172-63700194 GGCGGGCGCGGGGCGGGGGCCGG - Intronic
1150488909 17:65561342-65561364 TGGGCGCGGGGGGCGGGAGGGGG - Intronic
1150643395 17:66964411-66964433 CGCGCGGGCGCGGGGAGGGGAGG + Intergenic
1150643591 17:66965066-66965088 GCCGCGGGCGCGGCGGGGCGGGG - Exonic
1150802434 17:68292216-68292238 TGCGCGCGCGCCCCGGGCCGGGG - Intronic
1151559166 17:74861550-74861572 AGCCCGGGCGCGGCGGGGCGGGG + Intergenic
1151708398 17:75784997-75785019 TGCGCGCGCGGCGGGGGGGGGGG - Intronic
1151708400 17:75784999-75785021 CGTGCGCGCGCGGCGGGGGGGGG - Intronic
1152245547 17:79183046-79183068 AGGGCGCGCGCGGCGCGAGGCGG - Intronic
1152349772 17:79778111-79778133 TGCGCGTGCGCGGGGCGGGCCGG + Exonic
1152466656 17:80470459-80470481 TGTGCGTGCGTGGCTGGGGGAGG - Exonic
1152635140 17:81427729-81427751 TGCGTGCCAGCCGCGGGGGGCGG - Intronic
1152689657 17:81712262-81712284 CGCGCGCGCGCCCCGGGGGCGGG - Intronic
1152714434 17:81891689-81891711 TGCGCGCGCGGGACGGGGTGAGG + Intronic
1152744188 17:82031598-82031620 CGAGCGCGGCCGGCGGGGGGCGG - Intergenic
1152748411 17:82051630-82051652 GGCGCGCGCGGGGCCGGGGCGGG + Exonic
1152781563 17:82229299-82229321 TGCGAGGGCGCGGAGGGGCGCGG - Intronic
1152861352 17:82698404-82698426 TGCGGGCGCGGGGCCGGGGAGGG - Intronic
1152924220 17:83080059-83080081 TGCGGGGGCGCGGCCGGGGGCGG + Intronic
1153051987 18:908416-908438 GGGGCGCGCGGGGCGGGCGGCGG + Intronic
1153596385 18:6729648-6729670 TTCGCGCGCCCGGGGCGGGGCGG + Intergenic
1153900656 18:9614611-9614633 CGCGCGCGCGGGGCGGGCCGAGG + Intronic
1153935211 18:9914556-9914578 TGCGCGCGCCGGCCGGGGCGAGG + Intronic
1155209330 18:23586961-23586983 TCCGCGAGTGCGGCGGGGCGGGG + Intergenic
1155909007 18:31487144-31487166 TGGGCACGGGGGGCGGGGGGAGG + Intergenic
1155910349 18:31498188-31498210 TGCGCGCTCGGGGCAGGCGGCGG + Exonic
1157279025 18:46333935-46333957 GGCGCGCGGGTGGCGGAGGGAGG - Intronic
1158954696 18:62526610-62526632 TGCGCGGCGGCGGCGGCGGGAGG - Intronic
1160024715 18:75208492-75208514 TGCGCGCGGGCGGCCCGGCGGGG + Intronic
1160164113 18:76495317-76495339 CGCGCGCGGGCGGCGCGAGGAGG - Intergenic
1160204513 18:76822316-76822338 GGCGCGGGCGCGGTGGGGGCGGG - Intergenic
1160499805 18:79396057-79396079 TGTGCGCGCGTGGCGGGGCCCGG - Intronic
1160500713 18:79400126-79400148 CGCGCGCGCGCGAGGGGGCGGGG + Intronic
1160668439 19:344518-344540 TGCGCATGCGCGGCGGCGCGGGG - Intronic
1160706277 19:531691-531713 CGCGCAGGCGCAGCGGGGGGCGG + Exonic
1160739636 19:680005-680027 TGCGCGCGGGCCGGGGCGGGGGG - Intronic
1160745332 19:708779-708801 GGGGCGCGCGGGGCGGGGGGCGG + Intergenic
1160810745 19:1012018-1012040 TGCGAGGGCGCGGGTGGGGGCGG - Intronic
1160864103 19:1249598-1249620 GGCGCGGGCGGGGCGGGGGCGGG + Intronic
1160904556 19:1446184-1446206 TGCGCCTGCGCGGAGAGGGGCGG - Intergenic
1160935522 19:1592772-1592794 GGCGCGCGCCCGGCTGGGGGCGG - Intronic
1160947954 19:1652218-1652240 AGCGCGCGCGGGGCGGGCCGGGG + Intronic
1161015000 19:1979100-1979122 TGCGCGCGCGCGGCGGGGGGCGG + Intronic
1161104155 19:2434937-2434959 TGCGGGCGCGGGGCGGGGCGGGG + Intronic
1161150108 19:2702875-2702897 GGCGCGGGCGGGGCCGGGGGCGG + Intergenic
1161203693 19:3029363-3029385 GGCGCGGGCGCGGGGAGGGGCGG - Intronic
1161293091 19:3506276-3506298 CGGGCGCGCGCGGCGGAGGGAGG + Intronic
1161400731 19:4065545-4065567 TGGCCGCCGGCGGCGGGGGGTGG - Intronic
1161401597 19:4067971-4067993 TGCGACCGCGCGCCTGGGGGGGG + Intergenic
1161412513 19:4124203-4124225 TGCGCAGGCGCGGCGGCTGGGGG - Intergenic
1161550659 19:4910329-4910351 CGCACGCGCGCGGGGGGGGCCGG + Intronic
1161612486 19:5250934-5250956 GGTGCGGGGGCGGCGGGGGGGGG + Intronic
1161643073 19:5436367-5436389 CGCGCGCGTGCGGGGAGGGGAGG + Intergenic
1161664640 19:5568002-5568024 AGCGCGGGCGCGGCGGGGGCGGG - Intergenic
1161752821 19:6110217-6110239 TCCGCGCGCGCGGCGGAGTTTGG - Intronic
1161802582 19:6424397-6424419 CGCGCGCGCGCAGGCGGGGGAGG - Intronic
1161956936 19:7501351-7501373 TGCGGGCGCGCGTCGTGGGGTGG - Exonic
1161973474 19:7596354-7596376 TGCGGGAGCGCGGTGGGGGTGGG + Intronic
1162021358 19:7869919-7869941 TGCGCGAGGGCGGCGGCGGCGGG + Exonic
1162029481 19:7911237-7911259 TGCGCTCGGGCTGCAGGGGGGGG - Exonic
1163027088 19:14518608-14518630 TGTGCGCGCGCGCCGCGGGGAGG - Intronic
1163102570 19:15107320-15107342 TGCTGGCGCGGGGCGGGGGGCGG + Intergenic
1163113838 19:15177856-15177878 AGGGCGCGAGCGGCGCGGGGCGG + Exonic
1163535245 19:17872913-17872935 AGCGCGCGCGGGGCGGGGCCCGG + Intronic
1163631323 19:18419366-18419388 GGGGCGCGCGCGGCGGGAGGAGG + Exonic
1163681284 19:18683933-18683955 GGGGCGCGCGCGGCGGGGGCGGG + Intronic
1165510963 19:36266503-36266525 GGCGCGCTTGCGGCGGCGGGTGG - Intergenic
1165668593 19:37655494-37655516 TGCGCTAGCGCGCGGGGGGGCGG + Intronic
1165803115 19:38565124-38565146 GGCGCGGGCGCGGCGGAGGCGGG + Exonic
1165816791 19:38647565-38647587 GGCGCGCGCGCGCGGGAGGGCGG + Intergenic
1165867848 19:38949909-38949931 CGCGCGAGCGAGGCGGGGGCGGG - Intronic
1166367384 19:42284430-42284452 CCCCCGCGCGCGCCGGGGGGCGG + Intronic
1166727759 19:45039073-45039095 CGCGCGAGCGCAGCGGTGGGAGG + Exonic
1166799984 19:45450894-45450916 TGCGCGGGCGTGGGGGGGGGGGG - Intronic
1167040858 19:47021648-47021670 GGCGCGCTCGCGGCGCGGGAAGG + Exonic
1167251109 19:48398859-48398881 TGCGCGCGACCGGGGCGGGGCGG + Intronic
1167441905 19:49513503-49513525 TGCAGGCGGGCGGCGGGAGGCGG + Intronic
1168315266 19:55482232-55482254 GGCGCGGGGGCGGCGGCGGGAGG - Exonic
1168408017 19:56120855-56120877 CGCGTGCGCGTGGCGGGGGCAGG - Intronic
925730597 2:6917516-6917538 TGCGCGGGCGCGGGGAGGCGCGG + Exonic
926018385 2:9474280-9474302 TGCGCCCGCGGAGCGCGGGGTGG + Intronic
926095851 2:10080264-10080286 TGAGGGGGCGCGGCCGGGGGCGG + Exonic
926422950 2:12716873-12716895 GTCGCGGGGGCGGCGGGGGGGGG + Exonic
927070106 2:19519578-19519600 TGCGGGGGGGCGGCGGTGGGGGG - Intergenic
927168736 2:20350847-20350869 TGCGCGCGCCCGGTGGGCGGGGG - Intronic
927751442 2:25673664-25673686 TCCGCGCGCGGGGAGGGGGCGGG + Intergenic
927881433 2:26692637-26692659 TGCGGGCGGGGGGCGGGGGGCGG + Intergenic
928094144 2:28393654-28393676 TGCGCGGCCGCGGCGAGGGCGGG + Exonic
928964882 2:36966539-36966561 TGGGCGGGAGCGGCGGAGGGAGG - Intergenic
928998613 2:37324442-37324464 GGGGAGCGCGCGGCGGGAGGTGG - Intronic
929468620 2:42169314-42169336 TGCGCGCGGGCGCGGGGGCGGGG + Intergenic
929937227 2:46302147-46302169 TGTGCCCGTGCGTCGGGGGGGGG + Intronic
930700669 2:54456250-54456272 GGAGCGCGGGGGGCGGGGGGAGG - Intergenic
931602548 2:64019070-64019092 AGCGGGCGCGGGGCGGGGGCGGG - Exonic
931763608 2:65436215-65436237 TGCGCGCGCCTCGCGGGGCGGGG - Intergenic
932238959 2:70142440-70142462 CGCGCGAGCTCGGCGGGGAGGGG - Intergenic
932776355 2:74530312-74530334 TTCGCGCGCGTGGCTGGCGGTGG + Exonic
932812018 2:74833929-74833951 GGCGCGCCGGGGGCGGGGGGCGG - Intergenic
933654982 2:84880001-84880023 TGCGCCCGCGACGCGGGGGTGGG - Intronic
934763508 2:96868728-96868750 CGCGCGCAGGCGACGGGGGGAGG + Intronic
935275800 2:101474396-101474418 GGGGCGCGCGGGGCGCGGGGCGG + Intronic
936279010 2:111122084-111122106 TGCGCGTCCGCGGCCAGGGGTGG + Intronic
937221747 2:120346071-120346093 GGCGCGGGCGCGGGCGGGGGCGG + Intergenic
937956255 2:127423190-127423212 TGCTGGCGGGCGGCGGGGCGGGG + Intronic
938258372 2:129877816-129877838 CGGGCGCGCGTGTCGGGGGGCGG + Intergenic
939166785 2:138649085-138649107 GGCGTGCGGGGGGCGGGGGGTGG - Intergenic
939613036 2:144332597-144332619 TGCGCGGGCGGGCCGAGGGGCGG - Intergenic
940883529 2:158969217-158969239 GGCGCGGGGGAGGCGGGGGGAGG + Intronic
941095504 2:161237012-161237034 TGCGCGCGCGCGGAGAAGGGAGG - Intergenic
942398882 2:175580515-175580537 GGCGGGGGCGCGGTGGGGGGCGG + Intergenic
942505609 2:176638256-176638278 GGCGTGCGCGCGGCGGCGGGTGG + Intergenic
943333897 2:186590556-186590578 TGGGTGCGCGCGGTGGGGGAGGG - Intronic
945189023 2:207166921-207166943 GGCGCCCGCGGGGCGGGGCGGGG - Intronic
945699393 2:213151668-213151690 TGCGCGAGCCCGGCCGGCGGGGG - Intronic
945699441 2:213151856-213151878 TGCGCGCGCGCGCGGGCTGGCGG + Intronic
946219961 2:218217550-218217572 CGCGCGCCCGGGGCCGGGGGTGG + Intronic
946692436 2:222319555-222319577 GGCGCGCGGGCAGCGGCGGGAGG + Intergenic
947275826 2:228390959-228390981 TGCGGGAGCTTGGCGGGGGGAGG - Intergenic
947353634 2:229271306-229271328 GGCGAGCGCGCGGCGGCGGCGGG + Intergenic
947741754 2:232487907-232487929 GGGGCGCGCGGGGCGGGCGGAGG - Intergenic
947860501 2:233354485-233354507 AGCGCGCGCACCGCGGGCGGGGG - Exonic
948473829 2:238203746-238203768 TGCGCGCGGGCTGGGCGGGGCGG + Intergenic
948805926 2:240453438-240453460 TGCGGGAGCGGGGCGGGCGGAGG - Intronic
1168855085 20:1002401-1002423 AGCGCGCGCGGGGAGGGGGCGGG + Intergenic
1169164115 20:3407684-3407706 CGCGCGGGCCCGGCGGGGGCGGG + Intergenic
1170889974 20:20368433-20368455 TGGGCGCGCTCCGCGGGCGGCGG - Exonic
1172284622 20:33732097-33732119 TGCGAGGGCGCGGCGGGAGGGGG - Intronic
1172547341 20:35772137-35772159 TGCGCGCGCGCCGTGCGGGCGGG + Intronic
1172793579 20:37522564-37522586 TGGGCGGGCGGGGCAGGGGGTGG + Intronic
1173516172 20:43667027-43667049 GGCGCGCGGGCGCCGGGGGAGGG - Intronic
1173548127 20:43914737-43914759 CGCGCGGGCGGGGCGGGGGCGGG + Intergenic
1173807468 20:45935092-45935114 CGGGAGCGCGCGGCGGGGCGGGG + Intronic
1174586794 20:51615088-51615110 TGGGGGGGCGGGGCGGGGGGTGG + Intronic
1175215810 20:57391307-57391329 CGCGCGCCCGGGGCGGGGCGGGG + Intergenic
1175429599 20:58891941-58891963 CGCGCGCCCGGGGCGGGGGGCGG - Intronic
1175517301 20:59577619-59577641 TAAGCGCGCGCTGCGGGGAGGGG + Intronic
1175847407 20:62065909-62065931 GGCGCGCGGCCGGCGGGGGGCGG + Intergenic
1176015030 20:62926524-62926546 CGCCCCCGCGCGGCGGGCGGAGG + Intronic
1176062166 20:63177207-63177229 GGCGTGCGCGTGGCGGGGTGTGG + Intergenic
1176194568 20:63831292-63831314 CGCGCGCGCGCGGGCGGCGGGGG - Intergenic
1176194587 20:63831336-63831358 GCCGGGCGCGCGCCGGGGGGCGG - Intergenic
1176221083 20:63969679-63969701 GGCTCGGGCGCGGCGGGGGGCGG + Intronic
1176549303 21:8214501-8214523 TGGGCGGGCGGGGCCGGGGGTGG + Intergenic
1176549514 21:8215028-8215050 GCCGCGCGCGGGTCGGGGGGCGG + Intergenic
1176549956 21:8216879-8216901 GGCGCGCGCGGGGTGGGGCGGGG - Intergenic
1176550431 21:8218676-8218698 CGCGCGCGCGGGGCGCGTGGAGG - Intergenic
1176557196 21:8258724-8258746 TGGGCGGGCGGGGCCGGGGGTGG + Intergenic
1176568235 21:8397539-8397561 TGGGCGGGCGGGGCCGGGGGTGG + Intergenic
1176568439 21:8398062-8398084 GCCGCGCGCGGGTCGGGGGGCGG + Intergenic
1176568882 21:8399913-8399935 GGCGCGCGCGGGGTGGGGCGGGG - Intergenic
1176569360 21:8401715-8401737 CGCGCGCGCGGGGCGCGTGGAGG - Intergenic
1176576138 21:8441759-8441781 TGGGCGGGCGGGGCCGGGGGTGG + Intergenic
1176576351 21:8442292-8442314 GCCGCGCGCGGGTCGGGGGGCGG + Intergenic
1176576796 21:8444148-8444170 GGCGCGCGCGGGGTGGGGCGGGG - Intergenic
1176577273 21:8445946-8445968 CGCGCGCGCGGGGCGCGTGGAGG - Intergenic
1177431689 21:20998267-20998289 GGCGGGGGCGCGGCGAGGGGAGG - Intergenic
1178488463 21:33033241-33033263 TGGGCGCGCGGCGCGGGCGGAGG + Intergenic
1178535104 21:33404015-33404037 CGCGGGCGCGCGGGTGGGGGAGG - Intronic
1178992283 21:37366399-37366421 GGCGCGGGCGCGGGGCGGGGCGG + Intronic
1178992285 21:37366401-37366423 CGCGGGCGCGGGGCGGGGCGGGG + Intronic
1179209345 21:39312940-39312962 GGCGCGGGGGGGGCGGGGGGCGG + Intronic
1179213803 21:39349267-39349289 TGGGGGCGCCCGGGGGGGGGGGG - Intronic
1179675035 21:42975099-42975121 CGGGGGCGCGCGGCGGGGCGGGG + Intronic
1179882663 21:44300025-44300047 GGCGCGCGCGGGGCGGGGCGGGG + Intergenic
1179911981 21:44455483-44455505 TGCGCGGGCGAGGGGCGGGGTGG - Exonic
1179950824 21:44707987-44708009 TGCACGCGCGGGGCGGGGAGGGG - Intronic
1179950826 21:44707989-44708011 TGTGCACGCGCGGGGCGGGGAGG - Intronic
1179977033 21:44874029-44874051 TGCGCCTGCGCGGCGGGGAACGG + Intergenic
1180209594 21:46286581-46286603 CGCGCGGACGCGGCGGGGTGCGG - Exonic
1180649983 22:17369600-17369622 GGCGGGCGCCGGGCGGGGGGCGG - Exonic
1180748856 22:18110895-18110917 TGCGGGCGCGCGGCAGGCGTAGG + Intronic
1180831093 22:18906486-18906508 TACGCGGGCGGGGCGGGCGGCGG + Intronic
1180831138 22:18906727-18906749 TGCGCGGGGGCAGCGGGAGGAGG + Intronic
1180908368 22:19431583-19431605 TGAGGGCGCGGGGCGGGCGGCGG - Exonic
1180950448 22:19718412-19718434 GCGGAGCGCGCGGCGGGGGGCGG - Intronic
1181457798 22:23069701-23069723 TGGGCGGTGGCGGCGGGGGGCGG + Intronic
1181787643 22:25238400-25238422 GGCGGGGGCGGGGCGGGGGGTGG + Intergenic
1182149511 22:28018294-28018316 TGTGTGCGCGCGCGGGGGGGGGG + Intronic
1182149513 22:28018298-28018320 TGCGCGCGCGGGGGGGGGGGCGG + Intronic
1182638754 22:31750192-31750214 CGCGCGCGCGGTGCGGGGGCGGG - Intergenic
1183452965 22:37906586-37906608 GGCGAGCGGGCGGCGCGGGGCGG + Intronic
1183601744 22:38844028-38844050 TGAGCCCGGGCGGCGGGAGGAGG + Intergenic
1183649443 22:39145651-39145673 TGCGCGCGGCCGGCGGGGGCGGG - Intronic
1183649445 22:39145655-39145677 TGCGTGCGCGCGGCCGGCGGGGG - Intronic
1183702152 22:39457053-39457075 CACGCGCGGGCGGCGCGGGGCGG + Intergenic
1183788391 22:40045155-40045177 AGCGCGCGTGGGGCGGGGAGCGG + Intronic
1183823953 22:40370582-40370604 AGCGCACGCGTGGCGGGGCGTGG - Intronic
1184086911 22:42270717-42270739 GGAGGGCGCGCGGCGGGGCGGGG + Intronic
1184101390 22:42343446-42343468 AGCGCGGGCGCGGCGGGGGGCGG - Intronic
1184139800 22:42571931-42571953 TGGGGGCGGGGGGCGGGGGGTGG + Intronic
1184153046 22:42649419-42649441 GGCGGGCGCGCGGGGCGGGGCGG + Intronic
1184522998 22:45007083-45007105 CGGGGGCGCGCGGCCGGGGGCGG + Intronic
1184523860 22:45010066-45010088 GGCGCGGGCGGGGCGGGGGCGGG - Intergenic
1184797076 22:46738592-46738614 CGATCGGGCGCGGCGGGGGGCGG + Intergenic
1185268663 22:49918452-49918474 TGCGCGCGAGGGGCGGGGAGCGG + Exonic
1185351749 22:50343256-50343278 CGCACGCTCGCGGCCGGGGGCGG - Intergenic
1185409409 22:50674358-50674380 GGGGCGGGGGCGGCGGGGGGAGG - Intergenic
1185409575 22:50674761-50674783 CGGGCGCGCCCGGCGGGGGTGGG - Intergenic
1203254188 22_KI270733v1_random:130817-130839 TGGGCGGGCGGGGCCGGGGGTGG + Intergenic
1203254401 22_KI270733v1_random:131350-131372 GCCGCGCGCGGGTCGGGGGGCGG + Intergenic
1203254846 22_KI270733v1_random:133205-133227 GGCGCGCGCGGGGTGGGGCGGGG - Intergenic
1203255327 22_KI270733v1_random:135015-135037 CGCGCGCGCGGGGCGCGTGGAGG - Intergenic
1203262244 22_KI270733v1_random:175896-175918 TGGGCGGGCGGGGCCGGGGGTGG + Intergenic
1203262457 22_KI270733v1_random:176429-176451 GCCGCGCGCGGGTCGGGGGGCGG + Intergenic
1203262902 22_KI270733v1_random:178284-178306 GGCGCGCGCGGGGTGGGGCGGGG - Intergenic
1203281180 22_KI270734v1_random:131757-131779 TACGCGGGCGGGGCGGGCGGCGG + Intergenic
1203281225 22_KI270734v1_random:131998-132020 TGCGCGGGGGCAGCGGGAGGAGG + Intergenic
950407026 3:12811104-12811126 TGCAGGCACACGGCGGGGGGTGG + Intronic
950509991 3:13420288-13420310 GGCGCGCGCGCGGGCGGGAGCGG - Exonic
950530289 3:13549109-13549131 TGTGTGCGCGCGGGGCGGGGCGG - Exonic
950683871 3:14602875-14602897 CGCGCGCGCGGCGCGGGGTGCGG - Intergenic
951017042 3:17742678-17742700 GGAGGGCGCGCGGCGGGAGGCGG - Intronic
951078694 3:18425781-18425803 GGCGCGCGGGCGGCAGGGGCAGG + Intronic
951485298 3:23203276-23203298 GGCGCGAGCGCGGCGGGGACAGG + Exonic
952241277 3:31533116-31533138 TGCGCGCACAAGGCGGCGGGCGG + Exonic
952706192 3:36380403-36380425 GCCGCGGGCGCGGCGGGGCGGGG + Exonic
952867219 3:37862103-37862125 CGCGGGGGCGCGGCGCGGGGGGG - Intronic
953705285 3:45226045-45226067 TACGCGCGCGAGGCCGGCGGCGG + Exonic
953705422 3:45226448-45226470 TGCGGGGGCGCGGCGGAGAGCGG + Intergenic
953748736 3:45594171-45594193 GGCGCGCGCGGGCCGGAGGGCGG - Intronic
954442689 3:50530442-50530464 GGGGCGCGGGCGGCGGCGGGGGG + Intergenic
955368778 3:58333106-58333128 GGCGGGCGGGCGGCGTGGGGCGG + Intronic
955954560 3:64275297-64275319 TGCACTGGGGCGGCGGGGGGAGG + Intronic
956179119 3:66501065-66501087 TGCGGGCGAGCGGCCGGGGGCGG - Intronic
956420313 3:69080267-69080289 TGAGAGAGCGCGGCGGTGGGCGG - Intronic
956420344 3:69080377-69080399 TGCCCACGCGCGGCAGGGCGGGG + Exonic
956432180 3:69198129-69198151 TGGGGGCGGGCGGAGGGGGGCGG + Intronic
956675074 3:71725444-71725466 GGGGCGCGCGGGGCGGGGCGGGG - Intronic
959530795 3:107431714-107431736 ACCCCGCGCGCGGCGGGGCGAGG + Intergenic
960223767 3:115146985-115147007 GGCGCGGGCGGGGCGGGGCGGGG + Intronic
964344670 3:155744259-155744281 AGCGCCCGAGCGGCGCGGGGTGG - Intronic
964649087 3:158991401-158991423 TGCTCAAGCGCGGTGGGGGGAGG - Intronic
965558135 3:170038074-170038096 GGAGCGCGCGGGGCGGGGCGGGG + Exonic
966593002 3:181702013-181702035 CGCGCGCGCGCATGGGGGGGTGG - Intergenic
966889914 3:184399418-184399440 TGCTGGGGCACGGCGGGGGGTGG + Intronic
967171795 3:186827569-186827591 TGCGCGAGCGCGGCGGGCGGAGG + Intergenic
967858502 3:194135019-194135041 TGTGCGCGCGCCCCGGGGGCAGG - Intergenic
968701057 4:2058648-2058670 TGCGCGGCCGCGGGGGGCGGGGG + Intergenic
968729231 4:2261876-2261898 TGTGCGCCCGCGGCGGTGGGCGG - Intronic
968965122 4:3765845-3765867 GGCGGGCGCGCGGGGCGGGGCGG - Intergenic
969115499 4:4868474-4868496 TGCGCGGGGGCGGGTGGGGGGGG - Intergenic
969295655 4:6269582-6269604 TCCGCGGGCGGGGCGGGGGCGGG + Intergenic
969344745 4:6563685-6563707 CGCGGGCCCGGGGCGGGGGGCGG + Intergenic
969344864 4:6564030-6564052 TGCGGGCGCGGGGCGGGGTGTGG + Intergenic
970399407 4:15703231-15703253 GGCGCGCGCGCGGTGGCGCGGGG + Exonic
970407673 4:15778849-15778871 TGCCCGCGGGAGGCGGGGGGGGG + Intronic
972305503 4:37826545-37826567 TGCGGGTGCGCTGCAGGGGGTGG - Intergenic
972321575 4:37977416-37977438 GGCCCGCGGGCGGCCGGGGGCGG - Intronic
977607221 4:98995548-98995570 TGCGCGCGCGGGGCGGGGGCGGG + Intergenic
977908188 4:102501251-102501273 CGCGCGCACGCAGCGGGGGCGGG - Intergenic
979311958 4:119213120-119213142 GGCGCTCGCGAGGCGGGAGGAGG + Intronic
980053795 4:128061534-128061556 TGCGCGGCCTCGGCGGGCGGCGG + Intronic
984923413 4:184785596-184785618 TGGGCGGGGGCGGGGGGGGGGGG + Intronic
985549175 5:524513-524535 CGCGAGTGCGCGGCGGGGGCGGG - Intergenic
985660892 5:1155998-1156020 TGGGGCCGCGCGGCGCGGGGAGG + Intergenic
985705761 5:1400557-1400579 TGCCCCCGTGAGGCGGGGGGTGG + Intronic
985784464 5:1886706-1886728 GGCCGGCGCGGGGCGGGGGGTGG - Intronic
987327280 5:16823771-16823793 TGGGGGCGGGGGGCGGGGGGCGG + Intronic
990509960 5:56481130-56481152 CGGGCGCGCGGGGCTGGGGGCGG - Intronic
991769186 5:70025229-70025251 TGCGCGTGCGCGGCCGGGGCTGG - Intronic
991848481 5:70900647-70900669 TGCGCGTGCGCGGCCGGGGCTGG - Intronic
992067402 5:73120507-73120529 TGCGCGGGCGCGGCGGCCCGGGG - Exonic
992939921 5:81751437-81751459 AGCGCGGGCGGCGCGGGGGGAGG - Intronic
993501852 5:88674625-88674647 CGGGCGCGCGCGGCGGGTGGGGG - Intergenic
996184961 5:120464213-120464235 TGCGCGAGAGCGCCGGGCGGCGG + Intergenic
997426814 5:133808859-133808881 TGTGCGGGGGCGGTGGGGGGTGG - Intergenic
998033931 5:138897297-138897319 TGGGCGGGGGCGGGGGGGGGGGG - Intronic
998143251 5:139711414-139711436 TGCGCGCGCGCTCCGAGGGGAGG + Intergenic
998143273 5:139711456-139711478 GGGGTGCGCGGGGCGGGGGGAGG + Intergenic
998394060 5:141806829-141806851 TGGGCAGGTGCGGCGGGGGGCGG + Intergenic
999399363 5:151252834-151252856 TGCGCGCGCGGGAGGGGCGGGGG - Intronic
1000296308 5:159916313-159916335 GGCGCGCCCTCTGCGGGGGGCGG - Intergenic
1000665424 5:163989216-163989238 TGTGCGCGCGCGTGTGGGGGGGG + Intergenic
1001653260 5:173329786-173329808 GGCGCGGGCGGGGCGCGGGGCGG - Intergenic
1002058006 5:176609830-176609852 TGTGTGCGCGCGGCTGGGGGCGG - Intronic
1002091753 5:176810376-176810398 CCCGCGCGCGCTGCGCGGGGCGG + Intergenic
1002140267 5:177133649-177133671 CGCGCGCGCTCGGTGGGGGAAGG + Intronic
1002487740 5:179550935-179550957 GGCGCGGGCGCGGTGGGGGCCGG + Intronic
1002488761 5:179559103-179559125 CGCGCGCGCGCGCCCGGGTGAGG + Intronic
1002523991 5:179805870-179805892 TGGGCGCACGCGGAGGGCGGGGG + Intronic
1002541178 5:179907560-179907582 CGCCAGCGCGCGGCGGGGCGGGG - Intronic
1003035492 6:2637540-2637562 TGTGCGCGTGCGGGGGTGGGGGG + Intergenic
1003577591 6:7312616-7312638 TGAGCGCGAGGGGCTGGGGGTGG + Intronic
1004193625 6:13486203-13486225 TGCGCGCGCGCGCCTGGGAGAGG - Intronic
1004561804 6:16759968-16759990 TGCGCGCGCGCGCCGGGCGGGGG - Intronic
1004607251 6:17206379-17206401 TGCGCCTGGGCCGCGGGGGGAGG + Intergenic
1004690336 6:17987665-17987687 CGGGCGCGCGGGGCGGGGCGCGG + Intergenic
1005039465 6:21588187-21588209 TGCGCGTGCACGGCGCGCGGGGG - Intergenic
1005385307 6:25279498-25279520 AGCGGGCGCGGGGCGCGGGGCGG - Exonic
1006137240 6:31902390-31902412 CGCGCGCGCGCTGCGGGATGCGG - Intronic
1006271992 6:32972089-32972111 CGCGCGCGCGCGGAGGGGGTGGG + Exonic
1006366864 6:33621240-33621262 GGCGGGCGAGCTGCGGGGGGAGG + Exonic
1006396229 6:33789131-33789153 TGCGCGCCAGGGGCGGGCGGGGG - Exonic
1006472741 6:34237543-34237565 CGCGGGCGCCCTGCGGGGGGCGG + Intronic
1006611648 6:35297828-35297850 GGCGCCCGCCCGGCTGGGGGCGG - Intergenic
1006787940 6:36680268-36680290 CGCGCGCGCGCGCCGGGAGCCGG - Intronic
1006814337 6:36840127-36840149 TGTGCGCGCGTGGCGGGCCGGGG + Intergenic
1007390181 6:41546342-41546364 CGCGCGGGCGGGGCGGGAGGGGG - Intergenic
1007576654 6:42929510-42929532 TCCGCGCGCGCCGCGGGAGGAGG + Exonic
1007775589 6:44222907-44222929 CGTGTGCGCGCGGAGGGGGGTGG - Intronic
1008625205 6:53308878-53308900 TGCGCAGGTGGGGCGGGGGGCGG + Intronic
1010703359 6:79077951-79077973 AGCGGTCGGGCGGCGGGGGGCGG + Intronic
1010781218 6:79947598-79947620 TGGCCGCGCGCGGGGGCGGGGGG + Intergenic
1011603709 6:89081740-89081762 TCCGGGCGCGCGGCGGGGTGGGG + Intronic
1012211280 6:96521720-96521742 TGCGCCCGAGGCGCGGGGGGCGG - Intronic
1012245790 6:96924500-96924522 AGCGCGCTGGCGGCGGGCGGTGG + Intergenic
1012872902 6:104693060-104693082 CGCGCGCGCGCGCTGGGGTGGGG + Intergenic
1013273191 6:108560833-108560855 TGCGGCTGGGCGGCGGGGGGAGG + Intronic
1014505563 6:122249780-122249802 TGTGTGTGTGCGGCGGGGGGCGG + Intergenic
1014632503 6:123803781-123803803 GGCGAGCGCGCGTCGGGCGGCGG + Intergenic
1014724924 6:124962477-124962499 TGCCCGCGGGCGCCGGGTGGGGG + Intergenic
1015315018 6:131807940-131807962 GGGGCGGGCGCGGCGGGGAGGGG + Intergenic
1016340912 6:143060805-143060827 CGCGGGCGCGGGGCGGGGCGGGG - Intronic
1016340914 6:143060807-143060829 GGCGCGGGCGCGGGGCGGGGCGG - Intronic
1017662442 6:156687491-156687513 TCGGCGAGCGCGGCGGCGGGCGG + Intergenic
1018400127 6:163413966-163413988 CGCGAGCGCGCGGTGGGGGAGGG - Intergenic
1018865876 6:167746704-167746726 CGCCCGCTCGGGGCGGGGGGAGG - Intergenic
1019431000 7:999713-999735 TGCGCGCTGGGGGCAGGGGGCGG - Intronic
1019563268 7:1668097-1668119 TACGCGCGCGGGGCCGTGGGAGG - Intergenic
1019711356 7:2519579-2519601 TGCACGTGCGCGCCGGGGGCGGG + Intronic
1020169414 7:5833418-5833440 TGTGCCCGCGAGGCGGGGGGTGG + Intergenic
1021845303 7:24757459-24757481 TGCGCTGGGCCGGCGGGGGGCGG + Intronic
1021998337 7:26201635-26201657 GGCGCGCGCCCGGCGGGGGGAGG - Intronic
1022230776 7:28410154-28410176 GGCGCGCGCCCGGGGAGGGGAGG + Intronic
1022715157 7:32891899-32891921 CGAGAGCGCGCGGCGGGGGCGGG - Intronic
1023064849 7:36367036-36367058 GGCGGGGGCGCGGCGGGAGGCGG + Intronic
1023937110 7:44748370-44748392 GGCGCGGGCGGGGCGGGTGGGGG + Intergenic
1023955725 7:44885371-44885393 GGCGCGAGCGCGGCGGGCGGTGG - Intergenic
1024089090 7:45920962-45920984 TCCGCGCACACGGCGGGCGGAGG + Exonic
1025916838 7:65873119-65873141 CGCGCGGGCGCGGAGGGAGGGGG - Intergenic
1027250016 7:76393226-76393248 TGCGGCTGCGCGGCGGGGCGAGG - Intronic
1029238818 7:99144105-99144127 GGCGCGCGCGCGGCTCGGAGAGG - Intergenic
1029465145 7:100720685-100720707 TGTGCGTGCGCGGGTGGGGGTGG - Intergenic
1029496327 7:100896994-100897016 TGCGCGCGCGCGGCGGTGCGGGG + Intergenic
1029640452 7:101816505-101816527 GGGGAGCGGGCGGCGGGGGGCGG + Intronic
1029715144 7:102321581-102321603 GGCGCGCGCGCGGCCGGGCGCGG - Exonic
1030021475 7:105279195-105279217 AGAGGGCGGGCGGCGGGGGGAGG + Intronic
1030820498 7:114086473-114086495 GGCGCGCCCGGGGAGGGGGGGGG - Intronic
1031043553 7:116862926-116862948 GGCGCGGGCGCGGGGGAGGGCGG + Intronic
1031513261 7:122673894-122673916 TGGGAGCCCACGGCGGGGGGTGG + Intronic
1034559459 7:151870791-151870813 TGAGGCCACGCGGCGGGGGGAGG + Intronic
1034649214 7:152676167-152676189 TGCGCACGCGCGCGGGTGGGCGG - Intergenic
1034911829 7:155003428-155003450 CGCATGCGCGCGGCGGAGGGGGG + Intergenic
1035169688 7:157010543-157010565 TGTGCGAGCGCGGCCCGGGGCGG - Exonic
1035404349 7:158588050-158588072 GGGACGCGCGGGGCGGGGGGCGG - Intergenic
1035627259 8:1080274-1080296 AGCACGCGGGCGGCGGGGCGGGG - Intergenic
1035747606 8:1973670-1973692 GGCGCGCGCGGGGCGCGGGGAGG - Intergenic
1036785312 8:11681484-11681506 GGCGCTCGCGGGGGGGGGGGGGG + Intronic
1036786751 8:11692878-11692900 GGCGAGCGCGGGGCGGCGGGCGG - Intronic
1037260441 8:17001874-17001896 GGAGCGCGCGCGGCGGGCCGGGG - Exonic
1037450797 8:19014005-19014027 GGCGGGCGCGCGGCTGCGGGAGG - Intronic
1037825303 8:22156824-22156846 GGCGCGCGCGGGGCGGCGCGGGG + Exonic
1037900481 8:22685434-22685456 CGCGCGCGCGCGGGGAGGGGAGG + Intergenic
1037900483 8:22685436-22685458 CGCGCGCGCGGGGAGGGGAGGGG + Intergenic
1038039749 8:23714675-23714697 TCCGCTCCCGCGGCGGGCGGCGG - Intergenic
1038761257 8:30385204-30385226 TGCGGGCGGCCGGCGGGGCGCGG + Intronic
1039498237 8:37997406-37997428 AGAGAGCGCGCGGGGGGGGGGGG - Intergenic
1039554897 8:38468433-38468455 GGCGCGCTCGCGGCCGGGGAAGG + Intronic
1039918361 8:41875990-41876012 TGCGCGCGCGGGGCCAGGCGCGG - Intronic
1041244789 8:55879943-55879965 TGCTGGCGCGGGGCCGGGGGTGG - Exonic
1042082614 8:65071547-65071569 AGGGCGCGGGGGGCGGGGGGAGG + Intergenic
1042235966 8:66613367-66613389 AGAGCGCGCGCGGCTGAGGGCGG + Intronic
1042962670 8:74320760-74320782 GGCGCGGGCGCGGGGGTGGGAGG + Intronic
1045336109 8:101205597-101205619 GGCGGGCGCGCGGCGGCGGCGGG - Intronic
1047262274 8:123274039-123274061 AGCCCGCTCGCGGCGGCGGGTGG - Intronic
1047423562 8:124727074-124727096 CGCGCGCGCGCGTGGGGGCGGGG - Intronic
1047423564 8:124727076-124727098 TGCGCGCGCGCGCGTGGGGGCGG - Intronic
1048296822 8:133220732-133220754 TGCTCACGCGCCGCGGGTGGGGG - Exonic
1048484259 8:134832347-134832369 TGCGCGCGCGCGTGGGGAAGGGG + Intergenic
1048553910 8:135457377-135457399 GGCGGGCGCGGGGCGGGGCGGGG + Intergenic
1049452502 8:142669793-142669815 CGGGCGCGCGGGGCGGGGCGGGG - Intronic
1049452504 8:142669795-142669817 GGCGGGCGCGCGGGGCGGGGCGG - Intronic
1049452517 8:142669834-142669856 TGGGCGCGGGCGGCGCGGGCGGG - Intronic
1049585713 8:143431465-143431487 TGGGTGCGAGCGGCGGGGGCGGG + Intergenic
1049693683 8:143973572-143973594 TGCGGGGGCGGGGCGGGGGCGGG - Intronic
1049798854 8:144508672-144508694 AGCGCGCACGTGGCGGGGCGGGG + Intergenic
1049879445 8:145052251-145052273 GGCGCGGGCGGGGCGGGGAGCGG - Intergenic
1049879458 8:145052278-145052300 GGCGCGGGCGGGGCGGGGCGCGG - Intergenic
1051079604 9:13279326-13279348 TGCGCGCGCGCCGGCGGGGAAGG - Intronic
1051774515 9:20620548-20620570 GGCGAGCGCGGCGCGGGGGGCGG + Intronic
1051780498 9:20684127-20684149 TGCGCGCGAGCCGGGGAGGGCGG + Intronic
1052807521 9:33025685-33025707 TGCTCGCTCGGGGTGGGGGGGGG + Intronic
1052991767 9:34522854-34522876 TGCGGGCGGGGGGCGGCGGGAGG + Exonic
1052991904 9:34523333-34523355 TGCCGGCGCGGGGCGGGAGGAGG + Intergenic
1053079363 9:35161885-35161907 TACGTGCTCGCGGGGGGGGGCGG + Intergenic
1055757661 9:79572837-79572859 TGAGTGCGGGCGGCGGGGCGCGG + Intronic
1056787639 9:89604365-89604387 TGGCCGAGCGCGGCGGGGCGCGG - Intergenic
1056910893 9:90699509-90699531 TGTGTGCGCGCGGCGGGGATGGG - Intergenic
1057623312 9:96655348-96655370 TGGGCGCGGGGGGCGGGGCGGGG + Intergenic
1057758090 9:97853124-97853146 TGCGCCCGGGCCCCGGGGGGCGG + Intergenic
1057773281 9:97984832-97984854 CCCGCGCGCCCGGCGCGGGGCGG - Intronic
1057995633 9:99820042-99820064 AGGGCGCGCGGGGCGGGGCGGGG - Intergenic
1058058546 9:100473235-100473257 GGCGCGCGCGCGGCGGGCGGGGG - Exonic
1058110737 9:101028865-101028887 TGCGCGCGCCCGTGGGGCGGAGG - Exonic
1058467538 9:105244547-105244569 TGGGCGCGGGAGGCGGGAGGCGG + Intergenic
1058908260 9:109498365-109498387 CCCGCGCGCCGGGCGGGGGGCGG + Intergenic
1059191840 9:112333848-112333870 CGCGCGCGCGCGCCGGGCCGAGG - Intergenic
1059414670 9:114155577-114155599 TGAGGGCGCGCGGAGGGCGGTGG - Exonic
1060106783 9:120877442-120877464 CGCGCCCGCGGGGCGGGCGGGGG - Intronic
1060106785 9:120877444-120877466 TGCGCGCCCGCGGGGCGGGCGGG - Intronic
1060283370 9:122228487-122228509 CGCGCGCGAGCGGGGGGGGGGGG - Intronic
1060283372 9:122228489-122228511 CGCGCGCGCGAGCGGGGGGGGGG - Intronic
1060283374 9:122228491-122228513 AGCGCGCGCGCGAGCGGGGGGGG - Intronic
1060283491 9:122228884-122228906 TGCGCGCGGGCCGGGGGCGGGGG - Intronic
1060477951 9:123999688-123999710 CGGGCGCGTGCGGCCGGGGGCGG - Intergenic
1060700513 9:125746658-125746680 TGCGGCCCCGCGCCGGGGGGAGG - Intergenic
1061084921 9:128393118-128393140 TGCGTGCGCGGGGCTGGGCGGGG - Intergenic
1061095939 9:128456745-128456767 GGCCCTCGCCCGGCGGGGGGGGG + Intronic
1061975887 9:134067900-134067922 TGCGCGCGCGGGGCGGCGGGCGG - Intronic
1061976104 9:134068542-134068564 CGCGCGCGCGGGGCGGGGGGCGG + Intergenic
1061987056 9:134136055-134136077 TGCGCGTGCGCGAGGGGAGGGGG - Intronic
1062230517 9:135479578-135479600 GGCGCGGGCGCGGCGGCAGGTGG + Intronic
1062349899 9:136133457-136133479 TCCGGGCGCGGGGCTGGGGGCGG - Intergenic
1062364366 9:136201987-136202009 GTCGCGGGCGCGGCGCGGGGTGG - Intronic
1062584185 9:137241590-137241612 AGGGCGCGCGGGGCGGGGGAGGG + Intronic
1062646758 9:137551773-137551795 GGAGCGCGCGGGGCGGGGCGGGG - Exonic
1203470589 Un_GL000220v1:113961-113983 TGGGCGGGCGGGGCCGGGGGTGG + Intergenic
1203470802 Un_GL000220v1:114494-114516 GCCGCGCGCGGGTCGGGGGGCGG + Intergenic
1203471247 Un_GL000220v1:116350-116372 GGCGCGCGCGGGGTGGGGCGGGG - Intergenic
1203471725 Un_GL000220v1:118152-118174 CGCGCGCGCGGGGCGCGTGGAGG - Intergenic
1203478410 Un_GL000220v1:157933-157955 TGGGCGGGCGGGGCCGGGGGTGG + Intergenic
1203478623 Un_GL000220v1:158466-158488 GCCGCGCGCGGGTCGGGGGGCGG + Intergenic
1203479068 Un_GL000220v1:160322-160344 GGCGCGCGCGGGGTGGGGCGGGG - Intergenic
1185894210 X:3843667-3843689 GGTGCGCGCGCGGCCGGGCGCGG + Exonic
1185899329 X:3882091-3882113 GGTGCGCGCGCGGCCGGGCGCGG + Intergenic
1185904446 X:3920520-3920542 GGTGCGCGCGCGGCCGGGCGCGG + Intergenic
1186200120 X:7148163-7148185 TGCGCGTGCGCGGGGCGGGCGGG - Intronic
1186669960 X:11758203-11758225 GGAGCGCGCGCGGTGGGGGAGGG - Exonic
1187067417 X:15854600-15854622 GGCGCGCGCGGGGTGGCGGGGGG + Intronic
1188242644 X:27809485-27809507 GGGGCGGGCGGGGCGGGGGGGGG - Intronic
1189915376 X:45851183-45851205 TGCGCGCGCGCTGTGGTAGGTGG - Intergenic
1190598841 X:52069425-52069447 TGCGCGCCCGCGGTAGGAGGAGG - Intergenic
1190609983 X:52184648-52184670 TGCGCGCCCGCGGTAGGAGGAGG + Intergenic
1196819667 X:119692870-119692892 GGCGCGCGGGGGGCGGGGGGCGG - Intronic
1197655142 X:129108649-129108671 TGTGCGCGCGCGCGGCGGGGCGG + Intergenic
1198205321 X:134460092-134460114 CGCGCGGGCGGGGCCGGGGGCGG + Intergenic
1198205473 X:134460625-134460647 TGCGAGCGTGCTGCGGGGAGGGG + Intronic
1198871034 X:141177206-141177228 TGCGCCGGCGCGACGGGGGAGGG + Intergenic
1199469812 X:148181885-148181907 TGTGCGAGCGTGGTGGGGGGAGG - Intergenic
1199736801 X:150693342-150693364 CGCGCGCGGGGGTCGGGGGGCGG - Intronic
1200100779 X:153688406-153688428 GGCGGGCGGGCGGCGGGGTGCGG - Exonic
1200173598 X:154097136-154097158 TGCGCACGCGCGCCGGTGGGGGG + Intronic
1200229437 X:154436842-154436864 CGGGCGCGCGCGGGGCGGGGCGG + Intergenic
1200229439 X:154436844-154436866 GGCGCGCGCGGGGCGGGGCGGGG + Intergenic
1200231060 X:154444075-154444097 AGCTGGCGCGCGGCGGGGCGGGG + Intergenic
1200239566 X:154486627-154486649 CGGCGGCGCGCGGCGGGGGGTGG - Exonic