ID: 1161015000

View in Genome Browser
Species Human (GRCh38)
Location 19:1979100-1979122
Sequence TGCGCGCGCGCGGCGGGGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 714
Summary {0: 1, 1: 0, 2: 14, 3: 77, 4: 622}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161014993_1161015000 -6 Left 1161014993 19:1979083-1979105 CCTGGGCAAGGGTGAGCTGCGCG 0: 1
1: 0
2: 1
3: 16
4: 115
Right 1161015000 19:1979100-1979122 TGCGCGCGCGCGGCGGGGGGCGG 0: 1
1: 0
2: 14
3: 77
4: 622

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161015000 Original CRISPR TGCGCGCGCGCGGCGGGGGG CGG Intronic