ID: 1161017706

View in Genome Browser
Species Human (GRCh38)
Location 19:1991442-1991464
Sequence TGGGTTCGTAGTGGTTTTAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161017701_1161017706 -5 Left 1161017701 19:1991424-1991446 CCGAGGACACCTCTCAAGTGGGT No data
Right 1161017706 19:1991442-1991464 TGGGTTCGTAGTGGTTTTAGGGG No data
1161017699_1161017706 -4 Left 1161017699 19:1991423-1991445 CCCGAGGACACCTCTCAAGTGGG No data
Right 1161017706 19:1991442-1991464 TGGGTTCGTAGTGGTTTTAGGGG No data
1161017697_1161017706 -1 Left 1161017697 19:1991420-1991442 CCTCCCGAGGACACCTCTCAAGT No data
Right 1161017706 19:1991442-1991464 TGGGTTCGTAGTGGTTTTAGGGG No data
1161017694_1161017706 23 Left 1161017694 19:1991396-1991418 CCGGGCAGGCCTTTCTGCGGGCA No data
Right 1161017706 19:1991442-1991464 TGGGTTCGTAGTGGTTTTAGGGG No data
1161017695_1161017706 14 Left 1161017695 19:1991405-1991427 CCTTTCTGCGGGCATCCTCCCGA No data
Right 1161017706 19:1991442-1991464 TGGGTTCGTAGTGGTTTTAGGGG No data
1161017693_1161017706 24 Left 1161017693 19:1991395-1991417 CCCGGGCAGGCCTTTCTGCGGGC No data
Right 1161017706 19:1991442-1991464 TGGGTTCGTAGTGGTTTTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161017706 Original CRISPR TGGGTTCGTAGTGGTTTTAG GGG Intronic