ID: 1161017753

View in Genome Browser
Species Human (GRCh38)
Location 19:1991639-1991661
Sequence CTGGGTCCTTTCCAGGATGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 299
Summary {0: 1, 1: 1, 2: 1, 3: 31, 4: 265}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161017740_1161017753 16 Left 1161017740 19:1991600-1991622 CCCTGCATCTGACCTGCCAGGAT 0: 1
1: 0
2: 1
3: 14
4: 194
Right 1161017753 19:1991639-1991661 CTGGGTCCTTTCCAGGATGCCGG 0: 1
1: 1
2: 1
3: 31
4: 265
1161017749_1161017753 0 Left 1161017749 19:1991616-1991638 CCAGGATGGAGGGGGAGAAGGTT 0: 1
1: 0
2: 0
3: 37
4: 338
Right 1161017753 19:1991639-1991661 CTGGGTCCTTTCCAGGATGCCGG 0: 1
1: 1
2: 1
3: 31
4: 265
1161017747_1161017753 4 Left 1161017747 19:1991612-1991634 CCTGCCAGGATGGAGGGGGAGAA 0: 1
1: 0
2: 5
3: 43
4: 339
Right 1161017753 19:1991639-1991661 CTGGGTCCTTTCCAGGATGCCGG 0: 1
1: 1
2: 1
3: 31
4: 265
1161017741_1161017753 15 Left 1161017741 19:1991601-1991623 CCTGCATCTGACCTGCCAGGATG 0: 1
1: 0
2: 2
3: 16
4: 183
Right 1161017753 19:1991639-1991661 CTGGGTCCTTTCCAGGATGCCGG 0: 1
1: 1
2: 1
3: 31
4: 265
1161017738_1161017753 24 Left 1161017738 19:1991592-1991614 CCGGGATGCCCTGCATCTGACCT No data
Right 1161017753 19:1991639-1991661 CTGGGTCCTTTCCAGGATGCCGG 0: 1
1: 1
2: 1
3: 31
4: 265

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161017753 Original CRISPR CTGGGTCCTTTCCAGGATGC CGG Intronic
900460515 1:2800368-2800390 CTGGGTCCTGTCCGGGGTGCAGG - Intronic
900617534 1:3572065-3572087 CTGGGTCCTTCCTGGTATGCTGG + Intronic
900617788 1:3573090-3573112 CTGGGTCCTTCCTGGTATGCTGG + Intronic
900925909 1:5705859-5705881 CATGGTCCTTTCCAGGTTGGAGG - Intergenic
901632180 1:10653345-10653367 CTGGGTCCTGCCCAGAAAGCAGG - Intronic
901843956 1:11970827-11970849 CTGGGGCATAGCCAGGATGCGGG + Intronic
902640061 1:17761393-17761415 CTGGGCCGCTTACAGGATGCAGG + Intronic
902813588 1:18903163-18903185 CTGGGTCCTGGCCAAGAAGCTGG - Intronic
903931068 1:26862911-26862933 CTGGCACCTTTCCAGGCTCCAGG - Intergenic
904499720 1:30907153-30907175 CTGGGTCCTTTTCAGCCTGGGGG + Intronic
904982739 1:34520534-34520556 TTGGGGCCTTTCCCAGATGCTGG - Intergenic
905236877 1:36556090-36556112 CTGACTCCTTCCCATGATGCTGG + Intergenic
905302914 1:36997789-36997811 CTTGGTCCTTTCCAGGATGTGGG - Intronic
905433349 1:37940564-37940586 CTGTGTCCTTTCGAAGCTGCTGG - Intronic
905515472 1:38558961-38558983 CTGGGGCCTGTCCAGGCGGCTGG - Intergenic
905857034 1:41320992-41321014 CAAGCTCATTTCCAGGATGCTGG + Intergenic
906136917 1:43506364-43506386 CTGGAGCCTGTCCAGGGTGCTGG - Intergenic
906543653 1:46606741-46606763 CTGGCTCCTTTGCAGGAAGAGGG + Intronic
908068760 1:60435379-60435401 CTGGGTCCCTCCCATGATGTGGG + Intergenic
908274585 1:62456968-62456990 TTGTGTCCTTTCCAGAATTCCGG + Intronic
908324954 1:63014877-63014899 CTGATTCCTTTGCAAGATGCAGG - Intergenic
909564427 1:77039128-77039150 CTGGCTCCTGTACAGCATGCTGG + Intronic
910192688 1:84610754-84610776 CTGGGTCCTTCCCACAATTCTGG - Intergenic
911409367 1:97483385-97483407 ATGGGTCCTTTCCAAAATTCAGG + Intronic
911621243 1:100068145-100068167 ATGGGTGCTCCCCAGGATGCTGG - Exonic
912490265 1:110058977-110058999 CTGGGTCCCCTCCCGGATACAGG + Intronic
912560272 1:110546569-110546591 CAAGGTCCTTTCAATGATGCTGG + Intergenic
912956747 1:114159290-114159312 CTTGGCCCTTTCCTGGAAGCAGG - Intergenic
913710144 1:121474473-121474495 CTGGGTCCCTCCCATGATGTGGG + Intergenic
913997272 1:143661706-143661728 CCCGGGCGTTTCCAGGATGCTGG + Intergenic
914679693 1:149930400-149930422 CTGGGTCATAGCCAGGATTCTGG + Exonic
917499468 1:175573322-175573344 CTGCGGCTTTTCCAGGAAGCAGG + Intronic
917534168 1:175862756-175862778 CTTCCTCCTTTCCAGGCTGCTGG + Intergenic
920885540 1:209924387-209924409 CTGGGTCTTTTCCACAAGGCTGG + Intergenic
921132858 1:212234585-212234607 CTGTGTCCTTTGCAGGTTTCTGG + Intergenic
922252815 1:223865001-223865023 CTGAGGCCTTTCCAGGGTGGGGG - Intergenic
923043146 1:230333961-230333983 CTGCGTCCCCTCCAGGCTGCTGG - Intronic
924314746 1:242784284-242784306 CTGTTTCCTGGCCAGGATGCTGG + Intergenic
1069219235 10:65862789-65862811 TTATGTCCTTACCAGGATGCAGG - Intergenic
1069281894 10:66664927-66664949 CTGGGTCCTATCCAGTTTGTAGG - Intronic
1069515185 10:69071770-69071792 CTGGCTCCTTTCCACTAGGCGGG + Intergenic
1069754196 10:70763313-70763335 CTGGGGGCTTTTTAGGATGCAGG + Intergenic
1073921531 10:108465620-108465642 CTGGGTCTTTTAGAAGATGCTGG + Intergenic
1074016221 10:109536772-109536794 CTGGGGCCTGTCCAGGGTGGGGG - Intergenic
1076136277 10:128047246-128047268 GTGGGGCCTTTTCAGGATGATGG + Intronic
1076774580 10:132687640-132687662 CTGGGTGGTGGCCAGGATGCAGG + Intronic
1076877914 10:133225617-133225639 GAGTGTCCTTTCCAGGAAGCAGG - Exonic
1079031032 11:16986777-16986799 TTGGGGCCTTTCCAGGATGTTGG - Intronic
1080283980 11:30586764-30586786 CTGGCACCGTTCCAGGACGCAGG + Intronic
1080467265 11:32509382-32509404 CAGGGTCCCTTCCATGTTGCAGG - Intergenic
1083266595 11:61549880-61549902 GTGGGCCCTTTCCAGGACTCTGG + Intronic
1083430981 11:62613344-62613366 CTGGCTCCTCTCCTGGCTGCTGG + Exonic
1084060019 11:66665649-66665671 CTGGGTCCTGTCCTGTATTCCGG + Intronic
1084891160 11:72237756-72237778 CTGGATGCTCTCCCGGATGCGGG - Exonic
1086564662 11:88212009-88212031 CTGTGTCTTTTCCAGGCTGAGGG + Intergenic
1087915342 11:103803487-103803509 CTGGGTTCTCTCCAGGAGGTAGG - Intergenic
1091099935 11:132862609-132862631 CTGTGTCCTAGCTAGGATGCTGG - Intronic
1091108854 11:132946642-132946664 TTAGGTCCTTTCCAGAAAGCAGG + Intronic
1092177317 12:6419127-6419149 CTGGGTGCTGGGCAGGATGCGGG - Intergenic
1092826482 12:12404570-12404592 ATGGGTCCCTTCCAAAATGCAGG - Intronic
1094830596 12:34298423-34298445 CTTGGTCCTTACACGGATGCAGG + Intergenic
1095332939 12:40990768-40990790 CTGGGGCTTTTCCAGGAAGCTGG - Intronic
1101546048 12:105713916-105713938 CTGGTTCATTTTCAGGAAGCAGG + Intergenic
1101963274 12:109265550-109265572 TCGGGTCCTTGCCAGGAGGCTGG - Intronic
1103096440 12:118136395-118136417 CTGGGTCCCACCCAGGAGGCCGG - Intronic
1104142932 12:126005793-126005815 CTGGGACCTTTTAAGGGTGCAGG - Intergenic
1104855174 12:131898418-131898440 CTAGGTCCTTGCCAGGAGGGTGG + Intronic
1105899453 13:24742874-24742896 CTGGTTCCACTCCAAGATGCCGG - Intergenic
1107819661 13:44274933-44274955 CTGGGTCCTTTCCATGCAGCTGG - Intergenic
1113188582 13:107718036-107718058 CTGGTTCCTTGCCAGAATGTAGG - Intronic
1114771368 14:25431091-25431113 CTGCATCCTTTCCAGAATCCAGG - Intergenic
1119757632 14:77130054-77130076 CTGGGGCCTTTCCATGATACGGG - Intronic
1121752577 14:96369904-96369926 CTGAGGCTTTTCCAGGATGAGGG - Intronic
1121813620 14:96912755-96912777 CTGGGTCACTTCGAGGACGCTGG + Intronic
1122014451 14:98782255-98782277 CTGGTTCCTGTCTAGGCTGCTGG - Intergenic
1122634149 14:103122473-103122495 CTGGGTCCTTTCCAGAGGGCAGG + Intergenic
1122793729 14:104195323-104195345 CAGAGTCCTGTCCAGCATGCAGG - Intergenic
1122999418 14:105284466-105284488 CTGGGCCATCTCCAGGAGGCCGG - Intronic
1123023416 14:105412552-105412574 CTGCCTCGTTTCCAGGCTGCAGG + Exonic
1123173460 14:106396500-106396522 CTGGATTCCTTCCAGGATGTGGG - Intergenic
1123777955 15:23599144-23599166 CTGGGTCTTATCCAGACTGCTGG - Intronic
1124050959 15:26197325-26197347 CTGGTTCCTGTCCAGGAACCTGG + Intergenic
1125464689 15:39939211-39939233 CTGGGTGCTCTCCTGGAAGCTGG - Intronic
1127356623 15:58207061-58207083 CTGGGTCCCTTCCATAATGTGGG - Intronic
1129412244 15:75356431-75356453 CCAGGCTCTTTCCAGGATGCTGG - Exonic
1129918277 15:79294260-79294282 TAGGCTGCTTTCCAGGATGCCGG - Exonic
1134025064 16:10947045-10947067 CTGGTTCCTTTGCAGTATCCTGG + Intronic
1134161764 16:11896122-11896144 CTGGATGCTTGCCAGGTTGCTGG - Intronic
1134557560 16:15178788-15178810 CTGCTTCCTTTCCAGGAGCCTGG - Intergenic
1134918127 16:18090471-18090493 CTGCTTCCTTTCCAGGAGCCTGG - Intergenic
1138564620 16:57824133-57824155 CTGGGAGTTTTCCAGCATGCAGG - Intronic
1139510414 16:67425015-67425037 CTGAGGGCTTTCCAGAATGCGGG - Intergenic
1140820345 16:78657367-78657389 CAGGCTCCTTTACAGGATGGGGG - Intronic
1142143689 16:88483704-88483726 CAGGTGCCGTTCCAGGATGCAGG - Intronic
1142849661 17:2698255-2698277 CTGGTCCCGCTCCAGGATGCCGG + Exonic
1143950517 17:10629001-10629023 CTCGCTCCTTTTCAGGATGGCGG + Intronic
1144630066 17:16866845-16866867 CTGGGTCCTTCCCAGCTTGGAGG - Intergenic
1144651308 17:17008951-17008973 CTGGGTCCTTCCCAGCTTGGAGG + Intergenic
1145253585 17:21310521-21310543 CTGGGGCCCTTGCAGGATGGGGG - Intronic
1146589745 17:34118570-34118592 CTGGTCCCTTTCCTGGATGTGGG + Intronic
1147150709 17:38511936-38511958 CTGGGTCCTGTCCATCCTGCAGG - Exonic
1147769130 17:42855809-42855831 CTGAGTCCTTTCCAGGCTCCAGG + Intronic
1147898910 17:43770730-43770752 GGGGGTGCTTTCCAGGGTGCTGG + Intronic
1148888899 17:50793630-50793652 CTGGGGCCTTCCCCAGATGCAGG - Intergenic
1149998011 17:61415050-61415072 CTGTGTCCTTTCCTGGAGCCTGG + Intergenic
1150343206 17:64385377-64385399 CTGAGTCATTTCCAGGTTGAGGG - Intronic
1151211534 17:72548073-72548095 CTGGGTCCCTCCCACAATGCGGG + Intergenic
1151895968 17:76981245-76981267 CTGGGGCCTGTCCAGGAGCCTGG + Intergenic
1152073541 17:78145640-78145662 CTGGGGCCTTTCCAAGCAGCTGG - Intergenic
1152620521 17:81362102-81362124 CTGGGTCCTTCCCTCCATGCAGG - Intergenic
1152634151 17:81423570-81423592 CTGGGACCATTCCAGGAACCTGG - Intronic
1152790409 17:82275595-82275617 CTGGGGGCTTTCCAGTCTGCAGG - Intergenic
1153073300 18:1131774-1131796 CTGGGTCCTACCCAAAATGCAGG + Intergenic
1153089862 18:1331191-1331213 CTCTGTCCTTTCCATGATGGAGG - Intergenic
1153586664 18:6628129-6628151 CTGGGTCCTTTGCAGGTTCTGGG + Intergenic
1153711952 18:7809184-7809206 CCTGGTGTTTTCCAGGATGCCGG + Intronic
1156953456 18:42933465-42933487 CCAGGTCCCTTCCAGGATGTGGG - Intronic
1157102056 18:44740043-44740065 CTGGTTCCTTACCAGGATTTGGG - Intronic
1161017753 19:1991639-1991661 CTGGGTCCTTTCCAGGATGCCGG + Intronic
1163506850 19:17712667-17712689 TTGGGTTGTTTCCAGGTTGCAGG - Intergenic
1163695769 19:18762568-18762590 CTGGCTGCTTTCCAGAGTGCAGG + Intronic
1164520072 19:28972336-28972358 CTGGGTGCTTGCCAGGGTGAGGG - Intergenic
1164571394 19:29377128-29377150 CTGGGTCTCTGCCAGGATGGTGG - Intergenic
1164843682 19:31413670-31413692 ATTGGTCCATGCCAGGATGCTGG + Intergenic
1165272457 19:34722763-34722785 CTGTCTACGTTCCAGGATGCTGG + Intergenic
1166348604 19:42182695-42182717 CTGGGCCCCTTCTAGGATGATGG - Intronic
1168650445 19:58088975-58088997 CTGGGTACTTTGCAGGCTGGAGG - Intronic
925031241 2:651293-651315 CTGGGTCCTTTGCCGGCAGCAGG - Intergenic
925131858 2:1499455-1499477 CTGGGTGCTCCCCAGGGTGCAGG + Intronic
925249278 2:2417429-2417451 GAGGGTCCTCTCCAGGTTGCAGG - Intergenic
926422764 2:12716090-12716112 TTGGGTCCTATCCAGGGTGCTGG - Intergenic
928721303 2:34124794-34124816 CTGTATCTTTTCCAGGATTCAGG - Intergenic
929530948 2:42752318-42752340 CTGGGTCCTTTCCTGGCAGCAGG + Intronic
929773575 2:44913671-44913693 CTGGGCCCATTCCAGGCTGGTGG + Intergenic
929934746 2:46286474-46286496 CTGGGACCCTTCCAGGGTCCAGG + Intergenic
930003860 2:46880832-46880854 CTGGCTCTTTTCCAGGGAGCAGG - Intergenic
930057823 2:47265475-47265497 CTGGGTCCTTTCCCCCATGTGGG + Intergenic
931162946 2:59714406-59714428 TTGAGTCCTCTCCAGGTTGCTGG + Intergenic
932064905 2:68544763-68544785 ATGGGACCTTTCTAGGATGTTGG + Intronic
934738025 2:96699795-96699817 CTGGTTCCCGCCCAGGATGCAGG - Intergenic
935137494 2:100321188-100321210 TTTTGTCTTTTCCAGGATGCTGG - Intronic
935540350 2:104340843-104340865 CCGTGTCCTGTCCAGGATGGTGG - Intergenic
937299359 2:120829772-120829794 ATGGGTCCTGGCCAGGAAGCAGG - Intronic
937370743 2:121295652-121295674 CTGGGTCCATGCCAGGCTGAGGG + Intergenic
937465655 2:122131146-122131168 CTGGGTGGTTTCCAGGTTCCTGG + Intergenic
938097917 2:128475396-128475418 CTTGGTGCTCACCAGGATGCTGG - Intergenic
939096127 2:137835450-137835472 CTGGGCCCTTCCCAGGTGGCTGG - Intergenic
941001120 2:160204814-160204836 CTGGGGACTTTACAGGATGCTGG - Intronic
941771550 2:169350792-169350814 CTGGGTCCTTTTCAGCAGCCTGG + Intronic
942130857 2:172877717-172877739 CTGGGTGCTTTCCAGAATACAGG - Intronic
944667868 2:201971996-201972018 CTGGGACCTTCCCAGGATCCAGG + Intergenic
945663449 2:212713993-212714015 CTGGGCCCTGTCCAGAAAGCTGG - Intergenic
946416985 2:219544632-219544654 CTGGGTCCCCACCAGGATGGGGG - Intronic
947348728 2:229220637-229220659 CTGGGTCTTTTCTAGGATGGAGG + Intronic
948189278 2:236045662-236045684 CTGAGTCCGTGCCAGGAGGCTGG + Intronic
948855777 2:240729925-240729947 CTGGGTCATTTCCAAACTGCTGG + Intronic
1168994914 20:2125877-2125899 CTGGGTGCTTTCCCAGCTGCCGG - Intronic
1169587002 20:7096494-7096516 CTGAGTCCTTTCAAGGCAGCAGG - Intergenic
1169692703 20:8350244-8350266 CTGGGGCCTATCCAGGGTGGGGG - Intronic
1170941855 20:20854621-20854643 CAGGGTCATGGCCAGGATGCTGG - Intergenic
1171181401 20:23093606-23093628 CTGGGTCTTTGCAAGGGTGCGGG - Intergenic
1171378982 20:24718857-24718879 CTGGGTCCTTTCCTTCATGCAGG + Intergenic
1172022230 20:31923123-31923145 CTGGGCCCTTGGCAGGCTGCTGG - Intronic
1172592397 20:36127062-36127084 CTGAGTCCTCTCCAGTCTGCGGG - Intronic
1173737191 20:45370610-45370632 CTGTGTACCCTCCAGGATGCTGG - Intronic
1174578814 20:51556519-51556541 CCGGGTACTTTCCAAGATGCTGG - Intronic
1175179300 20:57134133-57134155 TTGCTTCCTTCCCAGGATGCTGG + Intergenic
1175277758 20:57783502-57783524 CTGGGATCTTTCCAGGAGGAGGG + Intergenic
1175977057 20:62716279-62716301 CTGGGTCTTCTCTAAGATGCAGG + Intronic
1176264189 20:64200142-64200164 CCGTGTCCTTGCCATGATGCTGG - Intronic
1176382822 21:6121527-6121549 CAGTGTCCGTGCCAGGATGCAGG - Exonic
1176992907 21:15520784-15520806 CTGGCTCTTTTCCAGGATGAGGG - Intergenic
1179494737 21:41764410-41764432 CTGGGCCTCTTCCAGGCTGCTGG - Intronic
1179522009 21:41951918-41951940 CTGTGTCCTTTGTAGGAGGCAGG - Intronic
1179740647 21:43416712-43416734 CAGTGTCCGTGCCAGGATGCAGG + Exonic
1180787357 22:18554392-18554414 CTGGGTGCTGGCCCGGATGCTGG + Intergenic
1181138152 22:20783957-20783979 CTGTGGCCTTTACAGGATCCTGG + Exonic
1181234382 22:21440913-21440935 CTGGGTGCTGGCCCGGATGCTGG - Intronic
1181244266 22:21493918-21493940 CTGGGTGCTGGCCCGGATGCTGG + Intergenic
1181602699 22:23961564-23961586 CTGGGGCCTTTCCAGGACGGCGG - Intergenic
1181605815 22:23979743-23979765 CTGGGGCCTTTCCAGGACGGCGG + Intronic
1182700915 22:32237406-32237428 CTGGGTCATTTCCAGGGTTGTGG - Intronic
1183172275 22:36197222-36197244 CTGAGTCCTGTCCAAGATGAGGG - Intronic
950033483 3:9867262-9867284 CTGGGCCCTCTTCAGCATGCAGG - Exonic
951309664 3:21109098-21109120 CTGGGTGCTTTCCAGGATGCGGG - Intergenic
951376632 3:21926287-21926309 CTGGGTCCTGTCAGGGATGAGGG - Intronic
953097160 3:39789490-39789512 CTGGGTCCTTCCCAGGAGCTGGG + Intergenic
953694256 3:45145800-45145822 CTGGGTGCTTTCAAGAATCCCGG + Intronic
954608974 3:51934271-51934293 CTAGGCCCTGTCCAGGGTGCTGG - Intronic
955194810 3:56795334-56795356 CTGGGTCATTTCCTGGAGGCTGG + Intronic
958951859 3:100425468-100425490 GTGATCCCTTTCCAGGATGCTGG - Intronic
960710859 3:120526676-120526698 CTGGACCGTGTCCAGGATGCAGG - Intergenic
960993644 3:123327472-123327494 CGGGGTCCTTTTTAAGATGCAGG + Intronic
961599361 3:128047270-128047292 CTGGGTTCTTGGCAGGATGGGGG - Intergenic
966779031 3:183567665-183567687 CTGGTTCATCTCCAGGATGAAGG - Intergenic
968075765 3:195815464-195815486 CCGGGTCCTTTCCCGGTGGCAGG + Intergenic
968267563 3:197374202-197374224 CTGGGTCTCCTCCAGGCTGCAGG + Intergenic
969347185 4:6576755-6576777 CTGGGTCTTTGCCAGGATACTGG - Intronic
969428777 4:7140877-7140899 CTGGGGCTCTTCCAGGATGAGGG + Intergenic
969662715 4:8539550-8539572 CTGGGTCCCTTCCTGGGTGCTGG - Intergenic
970365441 4:15353654-15353676 CTGGGTCCTAACCAGGGAGCGGG + Intronic
973676730 4:53271155-53271177 CTGTGTCCTCTTCAGGATGTCGG - Intronic
975743741 4:77455684-77455706 CTGGGGCCTGTCCAGGAGTCGGG - Intergenic
978909071 4:114044818-114044840 GTGGGCCCTTTCCAAGATGGTGG - Intergenic
981014676 4:139961478-139961500 GTGGGACCTTGCCAGGATGATGG - Intronic
981864012 4:149392672-149392694 CTGGCTTCTTTCCAGGCTTCTGG - Intergenic
986104188 5:4644158-4644180 CTGGCTCTTGTGCAGGATGCTGG - Intergenic
986108756 5:4689036-4689058 CTGGGGCCTGTCGAGGATGGGGG + Intergenic
986803375 5:11284417-11284439 CTGGGTCCTGTCCAGGGGGCAGG - Intronic
989253338 5:39340687-39340709 CTGGGTCAGCTCCAGAATGCTGG + Intronic
989268142 5:39501506-39501528 CTGGATTCTTTCCAGCAGGCAGG + Intergenic
990315160 5:54576704-54576726 CTGTGTCCTCTTCAGGAGGCTGG - Intergenic
990637372 5:57744024-57744046 CTGGGTCCATTCCAGTAAGCAGG + Intergenic
990776349 5:59309657-59309679 GTGGGTCCTCTCAAGGTTGCTGG + Intronic
991358906 5:65799729-65799751 CTGGGTCCTTTAAAGGATGATGG + Intronic
991599902 5:68341872-68341894 CTGTGTCCTTTGAAGGATGAGGG + Intergenic
992771308 5:80050914-80050936 CTGAGTGCTTTCCAGGGTGGTGG + Intronic
998906402 5:146909725-146909747 CAGGGTCTTTTCCAGTCTGCTGG + Intronic
999102792 5:149040628-149040650 CTGTGGCCTTTCCAGGAAGAGGG - Exonic
999238593 5:150114540-150114562 CTGGGGGCTTTCCAGGACACCGG + Exonic
1000216795 5:159165883-159165905 CTGGGTTGTTCCCAGGATTCTGG + Intronic
1000809206 5:165839679-165839701 CTGGGGCCTGTCCAGGGTGGGGG - Intergenic
1002577181 5:180180748-180180770 TTGTGTGCTTTCCAGGATGTAGG - Intronic
1003115354 6:3280327-3280349 CTGGTTCCTTCCCAGGCTCCGGG + Intronic
1003312376 6:4980810-4980832 CTGGGTCAGTTCCTGGATGGGGG + Intergenic
1003438715 6:6120442-6120464 CTGGGTGATTCCCAGGATCCCGG + Intergenic
1003656041 6:8009746-8009768 CTGGGGCCTTCCTAGGCTGCAGG - Intronic
1006710142 6:36061401-36061423 CTGGGTCCTTACATGGATGAAGG - Intronic
1007229944 6:40341144-40341166 TTGGCTCCTTGCCAGGATGCAGG - Intergenic
1011080506 6:83485738-83485760 CTGGGGCCTTTTCAGGGGGCTGG + Intergenic
1011177051 6:84575304-84575326 ATAGGGCCTTTCAAGGATGCTGG - Intergenic
1013558631 6:111282879-111282901 CTGGGTCCCTCCCATGATGTGGG + Intergenic
1016726847 6:147381139-147381161 CTGGGTCTTTTCCATGACACTGG + Intronic
1019548325 7:1589328-1589350 CTGTGGCCTTTCCAGCATGGTGG + Intergenic
1021597673 7:22334560-22334582 CAGGCTGCTGTCCAGGATGCAGG - Intronic
1021784026 7:24134742-24134764 CTGGGTCCTTCCCTGGAGTCAGG + Intergenic
1022069680 7:26900450-26900472 CTGGATCTTTGCCAGGATGCTGG - Intronic
1022444568 7:30459624-30459646 CTGGAGCCTTTCCAGGCAGCAGG - Intronic
1022488873 7:30801347-30801369 CTATTTCCTTTCCAGCATGCCGG + Intronic
1024611082 7:51064896-51064918 CTGCATCCTTTCCAGGCAGCAGG - Intronic
1024676335 7:51641113-51641135 CTCAGTTCATTCCAGGATGCAGG + Intergenic
1025786551 7:64649259-64649281 ATGGGTCCTTTCCAGCACGAAGG + Intergenic
1026825560 7:73579130-73579152 CTGGATCCTTTCAAGGAAGCGGG + Intergenic
1029089162 7:98034519-98034541 CTGGGCTCTGCCCAGGATGCGGG + Intergenic
1029383283 7:100227062-100227084 CTGGGTTCTTCCCAGGGTGGAGG - Intronic
1029677390 7:102079828-102079850 CTGACTCCTGTCCAGGATACAGG + Intronic
1032081550 7:128861022-128861044 CTGGGTGATTTCCAGGTTTCTGG - Intergenic
1034497505 7:151431423-151431445 CTGGGCCCTCTCCAGGACACTGG - Intronic
1034637533 7:152579260-152579282 TTGGCTCCTCTCCAGGACGCTGG + Intergenic
1035272670 7:157729704-157729726 CTGGGTCCTTTCCAGCACATGGG - Intronic
1035730745 8:1852214-1852236 CCCGGTCCTCTCCAGGATGATGG - Intronic
1035730760 8:1852278-1852300 CCCGGTCCTCTCCAGGATGATGG - Intronic
1035730775 8:1852342-1852364 CCCGGTCCTCTCCAGGATGATGG - Intronic
1035730790 8:1852406-1852428 CCCGGTCCTCTCCAGGATGATGG - Intronic
1035730805 8:1852470-1852492 CCCGGTCCTCTCCAGGATGATGG - Intronic
1035730818 8:1852534-1852556 CCGGGTTCTCTCCAGGATGATGG - Intronic
1035917210 8:3637777-3637799 CTGGGTCCCTCCCAAGATGTGGG - Intronic
1035925591 8:3724613-3724635 CTGGGTCACTCCCAGTATGCAGG + Intronic
1036462183 8:8963292-8963314 CTGGTTCCTTTCCAAGAGCCAGG - Intergenic
1037474783 8:19246408-19246430 CTGATTCCTTTCCAGGAGGTAGG - Intergenic
1037743322 8:21624283-21624305 CTGACTCCTTTCCAGGCTCCAGG - Intergenic
1037961669 8:23102690-23102712 CCGGGTCCTGTCCAGGCTGTAGG - Exonic
1037969857 8:23164231-23164253 CCGGGTCCTGTCCAGGCTGTAGG + Intergenic
1039107289 8:34003484-34003506 CTGGGTCCCTCCCATGATGTGGG + Intergenic
1039880231 8:41621081-41621103 CTGTGTCCTTTCCAGACTCCAGG + Exonic
1044414212 8:91917706-91917728 CTGGATCCTGTCCAGGTTGAGGG - Intergenic
1045030466 8:98130361-98130383 CCGGGTCCTTTGCCAGATGCTGG + Intronic
1046580675 8:116088616-116088638 CTGGGAACTTTCCAGAGTGCAGG + Intergenic
1048036593 8:130683040-130683062 CTGGGTCCTTTCCATGCTGTGGG + Intergenic
1048290582 8:133178415-133178437 GTGGGTCATCTCCAGGAAGCAGG + Intergenic
1048300943 8:133250758-133250780 GTGTGGCCTTTCCAGGATGGGGG - Intronic
1048982769 8:139711943-139711965 CTGGGTGCTGTGCTGGATGCCGG - Intergenic
1050133640 9:2439406-2439428 CTGGGTTGTTTCCAGGCAGCAGG + Intergenic
1051904480 9:22079556-22079578 CTGGGTCCTGTCCTGGGTGAGGG + Intergenic
1053609155 9:39693545-39693567 CTGGGTCCTTCTCAGGGTCCAGG + Intergenic
1053866997 9:42449817-42449839 CTGGGTCCTTCTCAGGGTCCAGG + Intergenic
1054089161 9:60777944-60777966 CTGGGTCCTTCTCAGGGTCCAGG - Intergenic
1054244370 9:62648853-62648875 CTGGGTCCTTCTCAGGGTCCAGG - Intergenic
1054558496 9:66683396-66683418 CTGGGTCCTTCTCAGGGTCCAGG - Intergenic
1055573680 9:77642072-77642094 CAGGGAACTTTCCAGGATGATGG + Intronic
1055914760 9:81389674-81389696 CTGGGTCCTTGCCATGCTGGAGG - Intergenic
1056733552 9:89185571-89185593 CAGGGTCCATTCTAGGATGAAGG + Intergenic
1056787836 9:89605417-89605439 CTGGCTCCTCCGCAGGATGCAGG + Exonic
1057197315 9:93122223-93122245 CTGTCTCCTTTCCAGGACCCTGG - Exonic
1059392272 9:114006692-114006714 CTGGGTCTTTCCCTGGCTGCAGG + Intronic
1059473800 9:114527651-114527673 CTGGGTCCTTCCCAGTCTACAGG - Intergenic
1060277305 9:122191874-122191896 CTGGTTCCCTGCCAGGATGGAGG - Intronic
1062459611 9:136657426-136657448 CTGGGTCCTTCCCAGGAGGGAGG - Intergenic
1186030650 X:5365766-5365788 CTATGTCCTTTCCAAGATGCTGG + Intergenic
1187423314 X:19155329-19155351 CTGCGTATTTTCCAGCATGCTGG - Intergenic
1189881016 X:45492253-45492275 CTGGGTCCTTCCCATGACACAGG + Intergenic
1191224949 X:58032843-58032865 CTGGGGCCTGTCAGGGATGCAGG - Intergenic
1193718429 X:84958953-84958975 CTGGGGCCTTTGGAGGATGGAGG - Intergenic
1194182868 X:90735136-90735158 CTGGGTCCCTCCCAGGACGTGGG - Intergenic
1196072481 X:111541868-111541890 AAGGGAACTTTCCAGGATGCAGG - Intergenic
1199526031 X:148792923-148792945 CTGGGTCCTTTACAGGAGTGGGG + Intronic
1200234102 X:154459953-154459975 CTGGCTCCTTTCCAGCATGGGGG + Intronic
1200529487 Y:4317091-4317113 CTGGGTCCCTCCCAGGACGTGGG - Intergenic
1201943395 Y:19483530-19483552 CTGGGTACTACCCAGGATGATGG + Intergenic