ID: 1161021389

View in Genome Browser
Species Human (GRCh38)
Location 19:2013289-2013311
Sequence AAGAGGGACCGGGGAGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 517
Summary {0: 1, 1: 0, 2: 3, 3: 44, 4: 469}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161021374_1161021389 5 Left 1161021374 19:2013261-2013283 CCTGCCCCCGACCAATGAGGGGC 0: 1
1: 0
2: 1
3: 6
4: 99
Right 1161021389 19:2013289-2013311 AAGAGGGACCGGGGAGTGGAGGG 0: 1
1: 0
2: 3
3: 44
4: 469
1161021365_1161021389 27 Left 1161021365 19:2013239-2013261 CCCGCAGCAAGAAAACCCAGCCC 0: 1
1: 0
2: 2
3: 29
4: 234
Right 1161021389 19:2013289-2013311 AAGAGGGACCGGGGAGTGGAGGG 0: 1
1: 0
2: 3
3: 44
4: 469
1161021380_1161021389 -2 Left 1161021380 19:2013268-2013290 CCGACCAATGAGGGGCAGGGTAA 0: 1
1: 0
2: 1
3: 10
4: 131
Right 1161021389 19:2013289-2013311 AAGAGGGACCGGGGAGTGGAGGG 0: 1
1: 0
2: 3
3: 44
4: 469
1161021376_1161021389 1 Left 1161021376 19:2013265-2013287 CCCCCGACCAATGAGGGGCAGGG 0: 1
1: 0
2: 2
3: 13
4: 93
Right 1161021389 19:2013289-2013311 AAGAGGGACCGGGGAGTGGAGGG 0: 1
1: 0
2: 3
3: 44
4: 469
1161021381_1161021389 -6 Left 1161021381 19:2013272-2013294 CCAATGAGGGGCAGGGTAAGAGG 0: 1
1: 0
2: 1
3: 12
4: 183
Right 1161021389 19:2013289-2013311 AAGAGGGACCGGGGAGTGGAGGG 0: 1
1: 0
2: 3
3: 44
4: 469
1161021368_1161021389 11 Left 1161021368 19:2013255-2013277 CCAGCCCCTGCCCCCGACCAATG 0: 1
1: 0
2: 1
3: 50
4: 528
Right 1161021389 19:2013289-2013311 AAGAGGGACCGGGGAGTGGAGGG 0: 1
1: 0
2: 3
3: 44
4: 469
1161021370_1161021389 7 Left 1161021370 19:2013259-2013281 CCCCTGCCCCCGACCAATGAGGG 0: 1
1: 0
2: 0
3: 23
4: 262
Right 1161021389 19:2013289-2013311 AAGAGGGACCGGGGAGTGGAGGG 0: 1
1: 0
2: 3
3: 44
4: 469
1161021378_1161021389 0 Left 1161021378 19:2013266-2013288 CCCCGACCAATGAGGGGCAGGGT 0: 1
1: 0
2: 0
3: 7
4: 82
Right 1161021389 19:2013289-2013311 AAGAGGGACCGGGGAGTGGAGGG 0: 1
1: 0
2: 3
3: 44
4: 469
1161021372_1161021389 6 Left 1161021372 19:2013260-2013282 CCCTGCCCCCGACCAATGAGGGG 0: 1
1: 0
2: 0
3: 6
4: 82
Right 1161021389 19:2013289-2013311 AAGAGGGACCGGGGAGTGGAGGG 0: 1
1: 0
2: 3
3: 44
4: 469
1161021367_1161021389 12 Left 1161021367 19:2013254-2013276 CCCAGCCCCTGCCCCCGACCAAT No data
Right 1161021389 19:2013289-2013311 AAGAGGGACCGGGGAGTGGAGGG 0: 1
1: 0
2: 3
3: 44
4: 469
1161021366_1161021389 26 Left 1161021366 19:2013240-2013262 CCGCAGCAAGAAAACCCAGCCCC 0: 1
1: 0
2: 4
3: 18
4: 335
Right 1161021389 19:2013289-2013311 AAGAGGGACCGGGGAGTGGAGGG 0: 1
1: 0
2: 3
3: 44
4: 469
1161021379_1161021389 -1 Left 1161021379 19:2013267-2013289 CCCGACCAATGAGGGGCAGGGTA 0: 1
1: 0
2: 0
3: 5
4: 114
Right 1161021389 19:2013289-2013311 AAGAGGGACCGGGGAGTGGAGGG 0: 1
1: 0
2: 3
3: 44
4: 469

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161021389 Original CRISPR AAGAGGGACCGGGGAGTGGA GGG Intronic
900088167 1:908543-908565 AGGAGGGGCGGGGGAGAGGAGGG + Intergenic
900735818 1:4298762-4298784 GAGTGGGACTGGGGAGGGGATGG + Intergenic
901478069 1:9504552-9504574 AACAGGGCCCGGGGTGTGGTGGG - Intergenic
901733744 1:11298966-11298988 AAGAAGGAACAGGGAGGGGATGG + Intergenic
901863396 1:12088881-12088903 AAGAGGGACTGGGCGGGGGAGGG - Intronic
902253240 1:15170282-15170304 CAGAGGGCCGGGGGAGAGGAGGG - Intronic
903033968 1:20482482-20482504 AAGAGGGAACGGGGAAGGGAAGG + Exonic
903322660 1:22552192-22552214 CAGAGGGACTGGGAAGTGGAGGG + Intergenic
903458153 1:23503272-23503294 AAGAGGGGACGGGGAGAGGGAGG - Intergenic
904699805 1:32351564-32351586 GCGAGGGCCCGGGGAGTAGACGG - Intronic
904930127 1:34081412-34081434 AAGAGGGAGCGGGAGGGGGAGGG - Intronic
905031129 1:34885291-34885313 ACGAGGGACGAGGGAGTGGGCGG + Intronic
905121203 1:35683291-35683313 GAGAGAGAGCGGGGAGAGGAGGG - Intergenic
905281993 1:36855179-36855201 AAGAGGCACGGGGCAATGGAAGG + Intronic
905334523 1:37235249-37235271 AAGAGGAATGTGGGAGTGGAGGG + Intergenic
905393256 1:37651397-37651419 CCGAGGGACTGGGGATTGGAGGG - Intergenic
905505591 1:38476595-38476617 GAGAGGGCGCGGGGAGCGGAGGG - Intergenic
906477311 1:46178385-46178407 AGAAGGGACTGAGGAGTGGAAGG - Intronic
906918766 1:50040822-50040844 AAGAGGGAAATGGGAGTGGAGGG + Intergenic
907301232 1:53487521-53487543 AAGAGTGACCTGGCAGTGGAGGG + Intergenic
908355002 1:63320161-63320183 AGGAGACACCGGGGAATGGACGG + Intergenic
908767748 1:67569699-67569721 GAGAGGGAGTGGGGAGGGGAAGG + Intergenic
910454426 1:87381759-87381781 AAGATGGACACAGGAGTGGAGGG + Intergenic
912688049 1:111782402-111782424 AAGGGGGACCTGGGAGAGAAAGG + Intronic
912878892 1:113390177-113390199 AGGAGGGGCAGGGGAGTGGAAGG - Intergenic
913176002 1:116273743-116273765 GAGAGTGACTGGGGAGTGGCGGG - Intergenic
913344717 1:117796896-117796918 AAGGAGGACAGGGCAGTGGATGG - Intergenic
914841891 1:151255187-151255209 ACGAGGGAATGGGGAGAGGAAGG - Intronic
915235166 1:154475075-154475097 AGGAGGGTCTGGGGAGTGGGAGG + Intronic
915579654 1:156805800-156805822 AAGAGGGATAGGGGAGAGAATGG + Intergenic
916687269 1:167158719-167158741 AAGGGGCAGAGGGGAGTGGAGGG - Intergenic
916715148 1:167441548-167441570 AAGAGGGAACAGAGAGTGCAAGG - Intronic
916715527 1:167443844-167443866 TAGTGGGACCGAGGAGAGGAGGG - Intronic
917261987 1:173179761-173179783 AAGAGGAATGGGAGAGTGGAAGG + Intergenic
918116824 1:181504916-181504938 CAGAGGGAACGAGGAGTGAAGGG + Intronic
919449318 1:197751823-197751845 AACAGAGACAGGGGAGGGGAGGG + Intronic
919673080 1:200355544-200355566 AACAGGGATGGGGGTGTGGATGG - Intergenic
919901278 1:202046029-202046051 AACAGGGACCAGGGAGTGGTGGG + Intergenic
920343010 1:205287444-205287466 AAGAGGGAACAGGGTGGGGAGGG - Intergenic
921944798 1:220879310-220879332 CAATGGGAGCGGGGAGTGGAGGG - Intergenic
922022117 1:221715998-221716020 AAGAGGGAGAGGGGAGGGGAGGG - Intronic
922914025 1:229240929-229240951 AAGAGTGACTGGGGGCTGGAGGG - Intergenic
923214807 1:231838900-231838922 AATAGGCACTGGGGAGTGGAAGG + Intronic
923497308 1:234536834-234536856 AAGCTGGCCCGGGGAGTGGATGG + Intergenic
923865609 1:237935963-237935985 AAGAATGACAGGGGAGGGGACGG + Intergenic
924424013 1:243933991-243934013 AAGAGGGGAAGGGGAGGGGAGGG - Intergenic
924941322 1:248814004-248814026 AAAGGGGACTGGGGAGCGGAAGG - Intronic
1062891146 10:1061311-1061333 AAGAGGGACAAGGAAGTGGCAGG - Intronic
1063695060 10:8326706-8326728 AAGTGGGAGCCGGGAGGGGAGGG + Intergenic
1064306372 10:14170785-14170807 AAGAGAGGTAGGGGAGTGGAAGG - Intronic
1067248466 10:44566374-44566396 AAGAGAGAGAGGGGAGTGGGAGG + Intergenic
1068616699 10:59126405-59126427 AAGAGAGACCAGGGACTGGGAGG - Intergenic
1069548451 10:69345539-69345561 AGGAAGGAGCGGGGAGGGGAGGG + Intronic
1069722779 10:70560280-70560302 AAGAGTGAGCAGGGAGTGGTGGG + Intronic
1069925564 10:71848183-71848205 AAGTGGGACAGGGCAGTGAATGG + Intronic
1071275362 10:84049137-84049159 GAGAGGGAACAGGGAGGGGATGG + Intergenic
1073051333 10:100669382-100669404 GAGAGGGTCCTGGGAGAGGAAGG - Intergenic
1074559386 10:114521651-114521673 AAGAAGGAGCGGGGAAAGGAGGG - Intronic
1075403424 10:122177591-122177613 ATGATGGCCCAGGGAGTGGATGG + Intronic
1076160129 10:128237343-128237365 AAGCTGGATCTGGGAGTGGAGGG - Intergenic
1076163444 10:128263519-128263541 AAGAGGGACAGAGGAGGAGAGGG - Intergenic
1076443085 10:130493605-130493627 AGGAGGGCCCGAGGAGCGGACGG + Intergenic
1076826309 10:132971366-132971388 AACAGGGAAGGGGGAGAGGAAGG - Intergenic
1078500369 11:11868287-11868309 AAGAGGGAATAGGGAGTGAAAGG - Intronic
1078807966 11:14725533-14725555 AGGAGGGAGAGGGGAGGGGAGGG - Intronic
1080764529 11:35282965-35282987 AAGTGAGCCAGGGGAGTGGAAGG - Intronic
1081190653 11:40100011-40100033 AGCAGGGAGCGGGGAGCGGAAGG - Intergenic
1081656699 11:44862132-44862154 TAGAGGGACAGGGGAGCAGAGGG + Intronic
1081789806 11:45774702-45774724 GAGAGGGACCGGGGTGTTGGCGG - Intergenic
1081935706 11:46902726-46902748 GAGAGGGACCTGGGGGTGGGGGG - Intronic
1082675664 11:56099042-56099064 AGGATGGACCGGGTAGTTGAAGG - Intergenic
1083936750 11:65873368-65873390 AAGACGGTCCTGGGGGTGGAGGG - Intronic
1083958710 11:66002181-66002203 AAGACGGACAAGGGAGGGGACGG - Exonic
1084104913 11:66975055-66975077 AGGAGGGAGGGGGGAGAGGAGGG + Intergenic
1084587240 11:70069339-70069361 AACAGGAACAGAGGAGTGGACGG + Intergenic
1085199445 11:74692857-74692879 ATGAGGGAGAGGGGAGTGGGGGG - Intergenic
1085250748 11:75142079-75142101 AACAGGGACCAGGGAGGGGCAGG + Intronic
1086063195 11:82721102-82721124 AAGAGGGACCAGGAAGTTCAAGG + Intergenic
1087619763 11:100528256-100528278 AAGAGTGACATCGGAGTGGAGGG + Intergenic
1089262638 11:117232886-117232908 AAGTGGGACGGGGGGGTGGCTGG + Intronic
1089415113 11:118282218-118282240 AAGAGAGACTGGGGAATGGCTGG - Intergenic
1089540217 11:119185407-119185429 AGGCGGGACCTGGGAGGGGATGG + Intergenic
1090856903 11:130617758-130617780 AAGAGGGGCAGAGGAGTCGAGGG + Intergenic
1096481426 12:51943801-51943823 AGGAGGCACTGGGGAATGGATGG + Intergenic
1096533551 12:52256797-52256819 AAGAGGCATCGGGGAGTGTGGGG + Intronic
1096675524 12:53223604-53223626 AGGAGAGACCGGGGAGGGGAGGG + Intronic
1096756881 12:53806956-53806978 AAGAGTGAAGGGGGAGGGGAGGG + Intergenic
1097167631 12:57094124-57094146 AAGTGGGGGCGGGGACTGGAAGG + Intronic
1097264852 12:57738821-57738843 AAGAGGGAACGGGAGGTGGGTGG + Intronic
1097712800 12:62934313-62934335 AAGAGGGAGTGGGGAGAAGAGGG + Intronic
1099657792 12:85517148-85517170 TGGAGGGAAGGGGGAGTGGAGGG + Intergenic
1100370700 12:93966688-93966710 AAGAGGGAGGAAGGAGTGGAAGG - Intergenic
1101327949 12:103733037-103733059 GAGAGTGACTGGGGTGTGGATGG - Exonic
1101345339 12:103880948-103880970 ATGCGGGGCAGGGGAGTGGAGGG - Intergenic
1102141939 12:110622426-110622448 AAGGGAGACAGAGGAGTGGATGG + Intronic
1102167931 12:110820950-110820972 AAGAGGGAGGGGAGAGGGGAGGG - Intergenic
1102210363 12:111122445-111122467 AAACGGGACGGGGGAGGGGAAGG + Intronic
1102843179 12:116148073-116148095 AAGAGGGGGGCGGGAGTGGAGGG + Intronic
1102986959 12:117286037-117286059 AAGAGGGGAAGGGGAGTGGATGG - Intronic
1103939417 12:124493802-124493824 TAGAGGCACGGGGGAGTGGGGGG + Intronic
1104066846 12:125313595-125313617 GAGAGGGAAAGGGGAGGGGAGGG - Intronic
1104081708 12:125435359-125435381 AAGAGAGACTGGGGTGCGGAAGG + Intronic
1104760902 12:131297108-131297130 AGGAGGGACCTGGGAGTGGCTGG + Intergenic
1104801620 12:131558618-131558640 AGGAAAGACCAGGGAGTGGAGGG - Intergenic
1104818876 12:131663684-131663706 AGGAGGGACCTGGGAGTGGCTGG - Intergenic
1104878736 12:132054694-132054716 TGGAGGGACGGAGGAGTGGAGGG + Intronic
1105256154 13:18745077-18745099 AAGCGGGACCTGGGAGAAGAGGG + Intergenic
1105683421 13:22752571-22752593 AAGCGGGAGCGGGGAGGAGAGGG - Intergenic
1107300230 13:38958338-38958360 AAGAAGGTCTGGGAAGTGGAGGG - Intergenic
1107302406 13:38979385-38979407 AAGTGGGACTGAGGAGAGGATGG - Intronic
1107715616 13:43196437-43196459 AGCAGGGACCGGGGGATGGAGGG + Intergenic
1107835840 13:44411905-44411927 GAGAGGGAGGGGGGAGGGGAGGG + Intergenic
1108299778 13:49061716-49061738 GAGAGGGAGAGGGGAGGGGAGGG - Intronic
1108714805 13:53068615-53068637 AAATGGGAGAGGGGAGTGGAGGG + Intergenic
1113847252 13:113399400-113399422 GAGAGGGTCTGGGGAGTGCATGG + Intergenic
1113869578 13:113550674-113550696 AAAGGGGACTGGGGAGTGGTTGG - Intronic
1114067198 14:19071450-19071472 AAGATGGAGCTGGGAGTAGATGG + Intergenic
1114095064 14:19328578-19328600 AAGATGGAGCTGGGAGTAGATGG - Intergenic
1115480056 14:33851730-33851752 AGGAGTCCCCGGGGAGTGGAGGG + Intergenic
1115498211 14:34027292-34027314 AGGAGGGAGAGGGGAGGGGAAGG + Intronic
1115498241 14:34027350-34027372 AAGAGGGGATGGGGAGGGGAGGG + Intronic
1117885913 14:60362618-60362640 ATGAGGGACTGGTGAGTTGAGGG - Intergenic
1117913849 14:60657271-60657293 AAGAGGGGCCGGGGCCTGAAGGG + Intronic
1118994289 14:70822541-70822563 GAGAGGGACGGGGCAGGGGAGGG - Intergenic
1122116345 14:99529269-99529291 CAGAGGGACCTGGGAAGGGAGGG - Intronic
1122873064 14:104650401-104650423 AGGAGAGAGTGGGGAGTGGAGGG - Intergenic
1122983912 14:105203579-105203601 AAGAGGGGCTGGGAGGTGGAGGG + Intergenic
1202835858 14_GL000009v2_random:76951-76973 AAGTGGGACCTGGGAGAAGAGGG - Intergenic
1125073187 15:35580736-35580758 AAGAGGGAGGCGGGAATGGATGG + Intergenic
1125479993 15:40073287-40073309 AAGAGGGGCGGAGGAGCGGATGG - Intergenic
1125726716 15:41871900-41871922 CACAGGGACCGGGAACTGGAGGG - Exonic
1125828996 15:42699297-42699319 AAGAGGGAATGGGGAGTGGATGG - Intronic
1126114595 15:45197457-45197479 AAGGGGGACACGGGAGTGGAGGG + Intronic
1126355605 15:47792661-47792683 AAGAGGGAGAGGGGAGAGGTTGG - Intergenic
1126412943 15:48390697-48390719 GAGAGGGACGAGGGTGTGGATGG - Intergenic
1127005916 15:54570016-54570038 TAGAGGGACCTGTAAGTGGATGG - Intronic
1127892666 15:63269137-63269159 AAGAGGGACAGGGAAGAGGTAGG - Intergenic
1128528671 15:68429962-68429984 CAGAGGCACCAGGGAGTGAATGG - Intronic
1128542054 15:68543108-68543130 AACAGGGATCGGGGGGTGGAGGG + Intergenic
1128591979 15:68906223-68906245 AAGCAGGCCCAGGGAGTGGAGGG - Intronic
1128617044 15:69118273-69118295 GACAGGGACAGGGGAGGGGAGGG + Intergenic
1128980424 15:72181353-72181375 AAGTGGGGCAGGGGAGTGGAGGG + Intronic
1129242566 15:74260219-74260241 AAAAGGGACCCGAGGGTGGAGGG + Intronic
1129411825 15:75354569-75354591 AAGAGGGCGGGGGGAGTGGTGGG + Intronic
1129601233 15:76999794-76999816 ATGGGGGACCTGGGAGAGGATGG - Intronic
1129919950 15:79311450-79311472 AGGTGAGACCTGGGAGTGGAGGG - Intronic
1131053117 15:89360882-89360904 AACAGGAACCAGTGAGTGGAGGG + Intergenic
1131397377 15:92097419-92097441 TGGAGGGAACTGGGAGTGGATGG - Intronic
1131685926 15:94767501-94767523 AAGAGAGACAGGAGAGGGGAGGG + Intergenic
1131990284 15:98086471-98086493 AAGAGGGAAAGGGGAGGGGAAGG + Intergenic
1133162638 16:3922140-3922162 AAGAGGTATAGGGGAGAGGAAGG + Intergenic
1134346727 16:13398293-13398315 AAGGGGGACCGGGAAGTGCTGGG - Intergenic
1134432823 16:14227317-14227339 AAGAGAGAGCGGGGAGGGGCTGG - Intronic
1135059619 16:19259993-19260015 AACAGGGACTGGGGAGTGTGTGG + Intronic
1135114288 16:19712328-19712350 TAGAGGGGGAGGGGAGTGGAGGG - Intronic
1135420093 16:22299883-22299905 AAGAGAGACCGGGGGGCGGGGGG + Intronic
1135637431 16:24090519-24090541 AAGAGGGGCAAGGGAGTTGAGGG + Intronic
1135958803 16:26978903-26978925 GAGAGAGAAAGGGGAGTGGAGGG - Intergenic
1135986590 16:27188777-27188799 AGAAGGGACGGGGGAGGGGAGGG + Intergenic
1136006066 16:27329972-27329994 AAGAGGGAGAGGGGATAGGAGGG + Intronic
1137497641 16:48983193-48983215 AAGAGGGGGAGGGGAGGGGAGGG - Intergenic
1137776439 16:51058509-51058531 ACAAGGGACTGGGGAGGGGAAGG + Intergenic
1139342002 16:66273524-66273546 AAGAGGGAGAGGGGAGAGCAAGG - Intergenic
1139941695 16:70610248-70610270 GAGAGGGATCTGGGAGAGGAGGG + Intronic
1140878309 16:79173856-79173878 AAGATGGATGGGGGAGAGGACGG + Intronic
1141790449 16:86230857-86230879 AATAAGGTCCAGGGAGTGGAGGG - Intergenic
1141790804 16:86232794-86232816 AAGAGGGAGCGGTGAGGGGCTGG - Intergenic
1142553007 17:752413-752435 AAGAGGGGCCGGGCAGGGGACGG - Intronic
1142640075 17:1280485-1280507 AAGAGAGAGCTGGGAGTGGGGGG + Intronic
1142889394 17:2933127-2933149 AAGAGAGAAGGGCGAGTGGAAGG + Intronic
1143173001 17:4940785-4940807 AAGTGGGACCTGGGGGTGGTTGG + Exonic
1143385610 17:6528412-6528434 AAGAGAGAACAGGGAGGGGAGGG - Intronic
1143390591 17:6556972-6556994 CAGAGGGAGCGGAGAGAGGAAGG + Intergenic
1143482870 17:7237748-7237770 CAGAGGGACCTGGGAGAGCAGGG - Intronic
1143887493 17:10076086-10076108 AAGAGGGAAGGGAAAGTGGAGGG + Intronic
1144020994 17:11240466-11240488 AGGGGGGACAGGGGAGGGGAGGG - Intergenic
1144050585 17:11494354-11494376 AACAGAGACCAGGGAATGGAGGG - Intronic
1144877870 17:18411768-18411790 AAGAGGGCGTGGGGAGAGGACGG - Intergenic
1145154359 17:20532657-20532679 AAGAGGGCGTGGGGAGAGGACGG + Intergenic
1145828797 17:27898304-27898326 AAGAGGAACCAGGGAGTTGAGGG - Intergenic
1145884326 17:28371940-28371962 AAGAGGGACCCGAGAGGGGTCGG - Exonic
1146229398 17:31095061-31095083 AAGGGGACCCGGGGAGGGGAGGG - Exonic
1146255911 17:31391592-31391614 AATAGGGGGCGGGGAGGGGAGGG - Intergenic
1146411501 17:32589526-32589548 AAGTGTGACAGGGGAGAGGAAGG + Intronic
1146518470 17:33508117-33508139 AGGAGGAAGCGGGGAGGGGAGGG - Intronic
1146535818 17:33650820-33650842 AGCAGGGACTGAGGAGTGGAAGG + Intronic
1146816187 17:35944125-35944147 AAGAGGGAGCGGAGTCTGGACGG + Intergenic
1146915439 17:36675483-36675505 AAGAAGGACTGGGGCATGGAAGG + Intergenic
1147135540 17:38431915-38431937 AAGAGGGAGAGGGGAGGGCAGGG + Intronic
1147360582 17:39927363-39927385 CAGAGGGAGTGGGGGGTGGAGGG - Intronic
1147915507 17:43883045-43883067 AGGAGGGACTGGGGGGTGGTGGG + Exonic
1148644215 17:49210236-49210258 CCAAGGGACAGGGGAGTGGAGGG - Exonic
1148743192 17:49904398-49904420 AGGAGGGACTGGGGAGGGAAGGG - Intergenic
1149387143 17:56153457-56153479 AAGAGGACCTGGGGGGTGGAGGG - Exonic
1149536483 17:57437508-57437530 TGGAGGGACTGGGGAGAGGAGGG + Intronic
1150416783 17:64994774-64994796 AAAAGGGAGGGTGGAGTGGAGGG + Intergenic
1150600148 17:66643978-66644000 CAGAGGCAACGGGGAGGGGACGG - Intronic
1150790001 17:68196060-68196082 AAGAGGGACTGGGGGATGGTGGG + Intergenic
1150794869 17:68229107-68229129 AAAAGGGAGGGTGGAGTGGAGGG - Intergenic
1150947650 17:69765505-69765527 AAGAGGAAAGGGGGAGGGGAAGG - Intergenic
1151829430 17:76540847-76540869 AGAAGGCACAGGGGAGTGGAAGG + Intronic
1151933100 17:77245148-77245170 TAGAGGGGACGGGGAGGGGAGGG + Intergenic
1151959947 17:77400580-77400602 AAGAGAGACGGGTGAGGGGAAGG + Intronic
1152066909 17:78117183-78117205 GAGATGTACAGGGGAGTGGAGGG + Intronic
1152132485 17:78485487-78485509 AGGAGGGAACGGGGACTGGCGGG + Intronic
1152170458 17:78743281-78743303 AGGAGGGGCTGGTGAGTGGACGG - Intronic
1152631328 17:81411855-81411877 AAGAGTGACCAGGGTGTGGAGGG - Intronic
1152632125 17:81415058-81415080 AAGAGGGGCCGGGGCGGGAAGGG - Intronic
1153243662 18:3053265-3053287 AAGAAGGACCAGGGAGTGTCAGG - Intergenic
1153643216 18:7173194-7173216 AAGAGAGATGGGGGAGTGAATGG + Intergenic
1154194518 18:12255581-12255603 AAGTGGGACTGTGGTGTGGATGG - Intronic
1154498292 18:14978397-14978419 GAGAGGGACCGCTGAGAGGAGGG + Intergenic
1156081737 18:33343672-33343694 AAGTGGGATTGGGGAGTTGAGGG + Intronic
1158058711 18:53312957-53312979 AGGAGGGAGTGGGGAGAGGAAGG + Intronic
1158427259 18:57351840-57351862 AAGACGGAAAGGGGAGAGGAAGG + Exonic
1158610447 18:58935335-58935357 AGGAGGGAGAGGGGAGAGGAGGG - Intronic
1158610458 18:58935366-58935388 AGGAGGGAGAGGGGAGAGGAGGG - Intronic
1158610464 18:58935382-58935404 AGGAGGGAGAGGGGAGAGGAGGG - Intronic
1158844281 18:61425283-61425305 AAGATGGACCGGGAAGTGATGGG + Intronic
1159954946 18:74512675-74512697 CAGAGGGACAAGTGAGTGGAAGG - Intronic
1160394749 18:78563483-78563505 AGGAGGGAAAGGTGAGTGGATGG - Intergenic
1160588287 18:79925186-79925208 CCGAGGGACCTGGGAGGGGAGGG + Intronic
1160769002 19:821982-822004 GAGGGGGACGGGGGAGGGGAGGG + Intergenic
1161021389 19:2013289-2013311 AAGAGGGACCGGGGAGTGGAGGG + Intronic
1161283329 19:3457050-3457072 TAGAGGGACCGCGGGGTGGCCGG + Intronic
1161285267 19:3465128-3465150 AAGAGGAAGTGGGGGGTGGAGGG - Intronic
1161360153 19:3844026-3844048 GCCAGGGACCGGGGAGGGGAAGG + Intronic
1161475683 19:4483550-4483572 AAGAGGGAGCAGGGAGTACACGG - Intronic
1161485244 19:4531908-4531930 ACGAGGGATGGGAGAGTGGAAGG + Intronic
1162949405 19:14061813-14061835 AAGGGGACCCGGGGAGTGGAGGG - Intergenic
1163147171 19:15387961-15387983 GAGAGGGGGCGGGGAGGGGAGGG + Intronic
1163204228 19:15790533-15790555 AAGAGGGATGGGGCAGAGGAGGG + Intergenic
1163213915 19:15862456-15862478 AGGAGGGAGAGGGGAGGGGAGGG + Intergenic
1163272381 19:16262065-16262087 AAGAGTGCCTGGGCAGTGGAGGG + Intergenic
1163402629 19:17103403-17103425 AAAAGGGAGCGGGGAGAGGCAGG + Intronic
1163712664 19:18856032-18856054 AAAAGACACCGGGGAGTCGATGG - Exonic
1164693272 19:30226207-30226229 AAGAGGGTCTGGGGGGTGGGGGG + Intergenic
1164813640 19:31177482-31177504 AAGATGGAACAGAGAGTGGAGGG - Intergenic
1164866861 19:31611591-31611613 AAGAGGGAGAGGAGAGAGGAAGG + Intergenic
1165311605 19:35031934-35031956 AGGAGAGGCCGGGGAGGGGATGG + Intronic
1165467588 19:35984151-35984173 ATGGGTGACCGGGGAGTAGATGG - Intergenic
1165609103 19:37134633-37134655 AAAAGGGACTGGGGATTGGCTGG - Intronic
1165863310 19:38920388-38920410 AAGAGGGCGCGGGGTGGGGAAGG + Intronic
1165904000 19:39182222-39182244 AAGTGGGCACGGGGAGAGGAAGG + Intronic
1166310246 19:41958639-41958661 AGGAGGGACCGGGCGGTGAAGGG + Intronic
1166384135 19:42370834-42370856 AAGAGGAACCGGGGGGGGGGGGG + Intronic
1166834882 19:45661279-45661301 AAGAAGGGCAGGGGAGGGGAGGG - Intergenic
1166948068 19:46409213-46409235 GAGAGGGAGAGGGGAGGGGAGGG + Intergenic
1167434793 19:49473262-49473284 CTAAGGGACCGGGGAGTGGATGG - Intronic
1167470963 19:49676276-49676298 TAGAGGGATCGGGGAGAGGAGGG + Intronic
1167482194 19:49739938-49739960 ATGAGGCAGCGGGGAGTTGATGG + Intronic
1167549119 19:50147559-50147581 TAGAAGGACTGGGGAGTGGGAGG + Intergenic
1167625831 19:50588579-50588601 AGCAGGGACTGGGAAGTGGAAGG - Intergenic
1168152928 19:54458668-54458690 AAGAGGAACTGGAGAGGGGAGGG - Intronic
1168296652 19:55380317-55380339 AAGGGGGAAGGGGGAGGGGACGG - Intronic
1168517097 19:57017622-57017644 AAGAGGGGACGAGGAGGGGAGGG - Intergenic
1168719160 19:58545293-58545315 AAGAAGGCTCGGGGAGGGGAGGG + Intronic
1202636779 1_KI270706v1_random:50412-50434 AAGTGGGACCTGGGAGAAGAGGG + Intergenic
925135096 2:1521492-1521514 AAGAGGGCCCTGGGGGAGGAGGG - Intronic
925241935 2:2339040-2339062 AAGAGGAAACCAGGAGTGGAAGG - Intergenic
925445371 2:3922664-3922686 AAGAGGGAAGGGGAAGGGGAAGG + Intergenic
925708175 2:6710541-6710563 AAGAGAGATGGGGGAGTGGCAGG - Intergenic
925878026 2:8328613-8328635 GAGAGGGACAGGAGAGTCGATGG + Intergenic
926695540 2:15767878-15767900 AGCAGGGAGCGGGGTGTGGAAGG - Intergenic
928116518 2:28548934-28548956 AGGAGGGACTGGGCAGAGGAGGG + Intronic
928498694 2:31863379-31863401 GATAGGGAACGGGGAGGGGAAGG + Intergenic
930137291 2:47915342-47915364 AAGAGGGTCTGGAGAGTGGGGGG + Intergenic
931246108 2:60493988-60494010 AGGAAGGTACGGGGAGTGGAGGG + Intronic
931440327 2:62285770-62285792 AGGAAGGAAAGGGGAGTGGAAGG + Intergenic
932341366 2:70964551-70964573 AAGAGGGTCCGGGGGCTGGTAGG + Intronic
933748234 2:85585834-85585856 AAGAAGGACCAGGGAGGGAAAGG - Intronic
933779736 2:85793118-85793140 AAGAGAGCCCGGGGAGAGGCTGG - Intergenic
935111777 2:100100855-100100877 AAGGAAGACCAGGGAGTGGAGGG + Intronic
935532166 2:104247689-104247711 AAGAGGGGCTGGGGAAGGGATGG + Intergenic
935556485 2:104515385-104515407 AAGTGGGAGCGGGGAGTGTGGGG + Intergenic
936078822 2:109418552-109418574 AAGGAGGACCGGGATGTGGAGGG - Intronic
936123188 2:109764313-109764335 AAGGAAGACCAGGGAGTGGAGGG - Intergenic
936221494 2:110607156-110607178 AAGGAAGACCAGGGAGTGGAGGG + Intergenic
937062639 2:118991854-118991876 AAGGGAGACCAGGGAGTGAAAGG + Exonic
937263161 2:120599239-120599261 AAGTGGGAAGGGGAAGTGGAAGG - Intergenic
937509805 2:122582951-122582973 AAGGAGGACCAGGGAGGGGAGGG + Intergenic
937556363 2:123162661-123162683 AAGAAGGAAAGGGGAGGGGAGGG - Intergenic
938320557 2:130359578-130359600 AGGAGGGTCAGGGGAGAGGAAGG - Intronic
944674428 2:202023361-202023383 AGGAGGGGCCGAGGAGTGGCTGG - Intergenic
944842226 2:203635282-203635304 AATGGGGGTCGGGGAGTGGAGGG + Intergenic
946070405 2:217029918-217029940 AAGAAGGACCGGGAGATGGAAGG - Intergenic
946152149 2:217783261-217783283 GAGAGGGAAAGGGGAGGGGAGGG - Intergenic
946830835 2:223726632-223726654 GAGAGGGAGGGGGGAGGGGAGGG + Intergenic
947131579 2:226932608-226932630 GAGAGGGACAAGGGAGTGGAAGG - Intronic
948721868 2:239905783-239905805 AAGAAGAAGCGGGGAGAGGAGGG + Intronic
948730797 2:239962575-239962597 AAGTGGGACCTGGAAGTGGAGGG + Intronic
948738407 2:240025759-240025781 AAGAGGGGGCGAGGAGCGGAGGG + Intergenic
948797754 2:240413322-240413344 AAGTGGCACAGGGGAGTGGACGG + Intergenic
949031572 2:241799687-241799709 CAGAGGGGCTGGGGAGTGGCGGG - Intronic
1169361812 20:4956777-4956799 AAGAGGGAAGGGAGAGGGGAGGG - Intronic
1169667606 20:8055370-8055392 AAGAGGGAACAGGCAGTGGGAGG + Intergenic
1170008704 20:11697251-11697273 AAGCAGGACGGGGGAGTGGGGGG + Intergenic
1171164178 20:22956149-22956171 AAGAGGGAAGGGTGAGGGGAGGG + Intergenic
1171318354 20:24215976-24215998 AAGAGTGTCCGGGAAGTGTAAGG + Intergenic
1171474525 20:25397842-25397864 AAGGGGGAAGGGGGAGGGGAAGG + Intergenic
1171880892 20:30616828-30616850 AAGTGGGACCTGGGAGAAGAGGG + Intergenic
1172947653 20:38701554-38701576 AAGGGAGACCGGGCAGGGGAGGG - Intergenic
1173437620 20:43047067-43047089 AAGAGGGAGGAGGGAGGGGAAGG - Intronic
1173706880 20:45116384-45116406 AAGAGGGAGGGAGGGGTGGAGGG - Intergenic
1173833067 20:46105142-46105164 AGGAGGGAGCGGGGAGAGGTAGG - Intergenic
1174445946 20:50591377-50591399 AAGTGATACAGGGGAGTGGAGGG + Intronic
1175486315 20:59349065-59349087 ATGAGGCACAGGAGAGTGGAGGG + Intergenic
1175610499 20:60347385-60347407 AAGAGGGCCCAGGGAAGGGAGGG + Intergenic
1175818550 20:61896257-61896279 AAGAGGGAGAGGGGAAGGGATGG + Intronic
1176109363 20:63404475-63404497 AAGGGAGACCTGGCAGTGGAGGG - Intergenic
1176147148 20:63570660-63570682 AAGTGGGCCCTGGGAGTGGGTGG - Intronic
1176842157 21:13850101-13850123 AAGCGGGACCTGGGAGAAGAGGG + Intergenic
1178096053 21:29217030-29217052 AAGGAGGACCGGGAAATGGAAGG + Intronic
1178270059 21:31181481-31181503 CAGAAGGAGCGGGGAGAGGAAGG + Intronic
1178289754 21:31357033-31357055 AAGATGGGCCAGGGAGTTGAGGG - Intronic
1178626742 21:34224801-34224823 AAAAGGGAGAGGGGAGAGGAGGG - Intergenic
1179150640 21:38805845-38805867 AGGAGGGACGGCCGAGTGGAGGG - Intronic
1179982378 21:44903122-44903144 AAGATGGAAGGGGAAGTGGAGGG + Intronic
1180156118 21:45978023-45978045 AGGAGGGAAGGGGGAGAGGAGGG + Intergenic
1180364092 22:11923901-11923923 AAGTGGGACCTGGGAGAAGAGGG - Intergenic
1180485674 22:15794017-15794039 AAGATGGAGCTGGGAGTAGATGG + Intergenic
1182093767 22:27612941-27612963 TGGAGGGACAGGGGAGTGGATGG + Intergenic
1182166386 22:28178470-28178492 GAGAGGAACGGGGGAGGGGAGGG + Intronic
1182802464 22:33042681-33042703 AAGAGGCAGCCAGGAGTGGAAGG + Intronic
1183218607 22:36497349-36497371 AAGAGGGGCAGGGGCATGGAGGG + Intronic
1183245396 22:36689415-36689437 AAGAGAGACTGGGAAGAGGAAGG + Intronic
1183406426 22:37632714-37632736 CAGAGGGGCTGGGGAGAGGAAGG + Exonic
1183519012 22:38285505-38285527 ATGGGGGAGCGGGGTGTGGAAGG + Intergenic
1183645701 22:39124760-39124782 AAGAGGCAACGGGGCGTGGGGGG + Intronic
1184346357 22:43915946-43915968 AAGGGGGAAGGGGGAGTGGGAGG - Intergenic
1184649723 22:45914032-45914054 AGGAGGGAGTGGGGTGTGGAGGG - Intergenic
1184723934 22:46332166-46332188 AAGCCGCACCGGGGAGGGGAAGG - Intronic
1184784770 22:46666271-46666293 AAGAAGGACCCAGGAGTGCAGGG - Intronic
1185109519 22:48893328-48893350 CAGAGAGACCTGGGTGTGGACGG + Intergenic
949539904 3:5024297-5024319 TAGAGGTACCGGGGGCTGGAGGG - Intergenic
949591241 3:5496385-5496407 AAGGGAGACTGGGGAGTGAAAGG + Intergenic
949614643 3:5739682-5739704 AAGGGAGACAGGGGAGGGGAGGG - Intergenic
949707366 3:6834411-6834433 AGGAGGGAGAGGGGAGCGGAGGG + Intronic
950214640 3:11150745-11150767 AGGAAGGCCCGGGGAGAGGAAGG - Intronic
950241734 3:11376690-11376712 CAGAGGGACCTTGGAGTGCAAGG + Intronic
950289327 3:11770947-11770969 AGGAGGGAACTGGGAGTGAAGGG - Intergenic
950398160 3:12749996-12750018 AAGAAGGCCGGGGTAGTGGAGGG + Intronic
951837366 3:26998039-26998061 GAGAGGGAAGGGGGATTGGATGG - Intergenic
953432933 3:42854531-42854553 ATGGGGGGCCGGGGATTGGATGG - Intronic
954683790 3:52359759-52359781 AGCAGGGACCGGGCAGGGGAAGG - Intronic
956181676 3:66523479-66523501 AAGAGGGACCATGGAAAGGATGG + Intergenic
958431166 3:94043545-94043567 AAGAGGGAGGGGGGAGGGGGAGG - Intronic
960769813 3:121181152-121181174 AAGAGGGGAGGGGGAGGGGAGGG + Intronic
960971327 3:123142114-123142136 AAGAGGGACCAGGGAGAGCTGGG - Intronic
961797849 3:129422575-129422597 AAGAGTGCCCAGGGTGTGGATGG - Intronic
962840753 3:139230424-139230446 AAGAGGGATTGGAGGGTGGAAGG - Intronic
963249517 3:143090274-143090296 AAGAGGGAAGGGAGAGGGGAAGG - Intergenic
964235948 3:154527712-154527734 AAGAGAGACAGGGGAATGGCTGG + Intergenic
964530969 3:157667428-157667450 ACGGGGGATGGGGGAGTGGAGGG + Intronic
964720892 3:159765925-159765947 AAGAGGGAGGGAGGAGAGGAGGG + Intronic
966997292 3:185295546-185295568 AAGAGGAACAGGAGAGAGGAGGG - Intronic
967127405 3:186436193-186436215 AAGAGGGAGAGGGAGGTGGAGGG + Intergenic
967572052 3:191041211-191041233 GAGAGAGACAGGGGAGTGGTTGG - Intergenic
969112360 4:4851973-4851995 CTGAGGGACTGGGGAGGGGAGGG - Intergenic
969437451 4:7196622-7196644 GAGAGGGAAGGGGGAGGGGAGGG - Intronic
969564997 4:7972145-7972167 AAGAGGTCCCGGGGTATGGAGGG - Intronic
970505367 4:16723855-16723877 AGGAGGAATCTGGGAGTGGAGGG - Intronic
973394025 4:49578653-49578675 AAGCGGGACCTGGGAGAAGAGGG - Intergenic
975723486 4:77270279-77270301 AAGCAGGACCAGGGAGAGGAAGG + Intronic
978243764 4:106548739-106548761 AAGAGAGGGAGGGGAGTGGAGGG - Intergenic
978264192 4:106803082-106803104 AAGAGGGAAGAGGGAGGGGAGGG - Intergenic
978465865 4:109008267-109008289 AAGAGGGACAAGGAAGTTGATGG - Intronic
979343026 4:119550597-119550619 AACTGGGAACGGGGAGTGGCTGG - Intronic
980100768 4:128539273-128539295 AAGAGGGACAGGGAAGTGCTGGG - Intergenic
981291360 4:143080207-143080229 AAGAGGGTCCTAGGTGTGGAAGG - Intergenic
981528795 4:145733168-145733190 GAGGCGGACCGGGGAGGGGAGGG - Intronic
981601686 4:146496394-146496416 AAGAGGGACAGGAGACAGGAGGG - Intronic
982339705 4:154284480-154284502 AAGAGGCACTGAGGAGTGTAGGG + Intronic
982756181 4:159221193-159221215 AAAAGGACCCTGGGAGTGGATGG + Intronic
984174480 4:176399325-176399347 AAGAGAGACTGGGGAATGGGTGG - Intergenic
984550550 4:181154031-181154053 AGGAGGGCCTGGGGAGTGGTGGG - Intergenic
1202764094 4_GL000008v2_random:136283-136305 AAGCGGGACCAGGGAGAAGAGGG + Intergenic
985928456 5:3035905-3035927 ATGAGGGACCGGGCAGAGGAGGG - Intergenic
986187338 5:5457082-5457104 GAGATGGACCGGTGGGTGGATGG - Intronic
986317968 5:6603820-6603842 CAGAGAGTCCGGGGAGAGGAGGG - Intronic
987201945 5:15586259-15586281 AAGGGGGAGGGGGGAGGGGAGGG - Intronic
987825867 5:23029690-23029712 AAGAGGGGCAAGGGAGTTGAGGG - Intergenic
991723175 5:69513084-69513106 AAGAGGGATAGGGGTGTGGTAGG - Intronic
993109059 5:83632980-83633002 AAGAGGGACAGGAGACAGGAGGG - Intergenic
994284543 5:97948952-97948974 AAAAGAGAACGGGGAGGGGAGGG - Intergenic
996087357 5:119318685-119318707 AAGAGGGACAGGAGAGGGGAGGG - Intronic
997711452 5:136008255-136008277 AGTGGGGACTGGGGAGTGGAGGG + Intergenic
997853382 5:137352639-137352661 AAGAAGGAGGGAGGAGTGGAGGG + Intronic
998937386 5:147244043-147244065 AACAGGGACTGGGGAGGGGATGG - Intronic
999135494 5:149316119-149316141 AAATGGGTCAGGGGAGTGGAGGG - Intronic
999452237 5:151686993-151687015 AGGAGGGACCACGGGGTGGAGGG - Exonic
999463005 5:151772541-151772563 AAGAGGGAGCAGCGAGTGCACGG + Intronic
1000148071 5:158472690-158472712 AAGAAGGACAGGGGAGGGGAGGG - Intergenic
1000229463 5:159301619-159301641 AAAAGGGAGCGGGGTGGGGAAGG - Intergenic
1001650227 5:173310683-173310705 AACAGAGACCTGGGAGGGGAGGG + Intergenic
1001786576 5:174418847-174418869 GAGAGGGAAGGGGGAGGGGAGGG + Intergenic
1001820506 5:174706464-174706486 AAGAGTGACAGGAGAGTGGCAGG - Intergenic
1002080128 5:176732800-176732822 AAGCGGGGACGGGGAGAGGAGGG + Intergenic
1002350888 5:178582862-178582884 AACAGGGACCTGGGAGTAGGTGG + Intronic
1003378664 6:5602800-5602822 AAAAGGGACTGAGGAGGGGAGGG - Intronic
1003788793 6:9518464-9518486 CAGAGGGGCTGGGAAGTGGAGGG + Intergenic
1003975988 6:11345098-11345120 AAGAGGGACCGGGGTGAGGCAGG + Intronic
1004126817 6:12882114-12882136 GAGAGGGACAGGGGGATGGAGGG + Intronic
1006000705 6:30962954-30962976 GAGAGGGAGGGGGGAGGGGAGGG + Intergenic
1006150468 6:31984190-31984212 AATAGGGGCTGGGGAGGGGAAGG + Intronic
1006156769 6:32016928-32016950 AATAGGGGCTGGGGAGGGGAAGG + Intronic
1006187369 6:32189064-32189086 AGGAGGAATCTGGGAGTGGATGG + Intronic
1006278723 6:33029081-33029103 AAGAGGGAGAGGGGAGGGGAGGG - Intergenic
1006301625 6:33196465-33196487 AAGAGTGACCAGGGCGTTGAGGG - Exonic
1006814469 6:36840621-36840643 ACGACGGGCGGGGGAGTGGAAGG - Intergenic
1007341543 6:41194121-41194143 AGGAGGGACAGGGGAAAGGAGGG - Intronic
1007359100 6:41342568-41342590 TGGAGGGATGGGGGAGTGGAAGG - Intronic
1007659600 6:43475659-43475681 GAGAGGGACAGGGGAGCAGATGG + Intergenic
1007692433 6:43711410-43711432 CAGAGGGACCGAGGAGAGTAGGG + Intergenic
1008413010 6:51205282-51205304 AAGAGGGGGGAGGGAGTGGAAGG - Intergenic
1008878852 6:56360155-56360177 AAAAGTGACAGGGGAGTGGAGGG + Intronic
1012801470 6:103834554-103834576 AGGAGGGACTGGGGAGATGATGG - Intergenic
1013091546 6:106905052-106905074 ATGAGGGACCAGGGACAGGAGGG - Intergenic
1013099078 6:106973348-106973370 AAGATGGGGCGGGGAGTGGAGGG + Intronic
1014818393 6:125959030-125959052 AAGATGGCCAGGGGAGTGGTGGG + Intronic
1014934277 6:127368193-127368215 AAGGGGGAAAGGGGAGAGGATGG - Intergenic
1015181447 6:130366043-130366065 AAAAGGGACCGGGAACGGGAGGG - Intronic
1015966826 6:138702663-138702685 AAGAGGGAAGGGGGAGAGAAAGG - Intergenic
1016446005 6:144132543-144132565 AAGAGAGAGAGGGGAGGGGAGGG - Intergenic
1016932342 6:149423645-149423667 AACAGGGAAGGGAGAGTGGAGGG + Intergenic
1017542662 6:155418576-155418598 GGGAGGGGGCGGGGAGTGGAAGG - Intronic
1018957301 6:168418802-168418824 CAGTGGGACGGGGGAGTGGAGGG - Intergenic
1019159087 6:170057636-170057658 GAGAGGGAATGGGGAGGGGAGGG - Intergenic
1019271722 7:153042-153064 AAGAGGGAGTGGGGAGGGAAGGG - Intergenic
1019407338 7:890411-890433 AGGACGGGCCTGGGAGTGGAGGG + Intronic
1019795160 7:3043579-3043601 AAGAGGGCACGGGGAGGAGATGG - Intronic
1019825398 7:3280091-3280113 AAGAGGGACAGGCAAATGGAAGG - Intergenic
1019930501 7:4219817-4219839 AAGGAGGAGCGGGGAGGGGAGGG - Intronic
1020096744 7:5373857-5373879 AGGAGGGGCCGGGGAGAGGCTGG + Intronic
1022445736 7:30469392-30469414 AAGAGGGAGTAGGGAGGGGAAGG - Intronic
1022729673 7:33010536-33010558 GAGAGGGAACAGGGTGTGGAAGG - Intergenic
1022758895 7:33326230-33326252 AAGAGGGGAGGGGGAGGGGAGGG - Intronic
1022955268 7:35374697-35374719 AAGAGGGAATTGGGAGTAGAAGG - Intergenic
1023551060 7:41370057-41370079 AGGAGGGACCAGGGGGTGGGGGG + Intergenic
1023917009 7:44597087-44597109 AAGGGGGAGGGGGGAGTGGGAGG + Intergenic
1026388731 7:69878272-69878294 TGGAGGGAGCGGGGAGGGGAAGG + Intronic
1026663546 7:72322988-72323010 AAAAAGGACAGGGGAGGGGAGGG + Intronic
1027397141 7:77767768-77767790 AAGGGGGAGGGGGGAGAGGAGGG - Intronic
1028316102 7:89404954-89404976 GAGAGGGAAGGGGGAGGGGAGGG + Intergenic
1028752105 7:94393836-94393858 AAGAGGGACCGGGGGGCTCACGG + Intergenic
1029055507 7:97736676-97736698 AAGGGGGAGTGGGGAGTGCAGGG + Intronic
1029139516 7:98400476-98400498 GAGAGTGAACGGGGAGCGGAGGG + Intronic
1030010082 7:105157064-105157086 AAAAGGGACCGGGAATTGGATGG + Intronic
1030028646 7:105349158-105349180 AAGAGGGGGAGGGGAGGGGAGGG + Intronic
1031400978 7:121326218-121326240 AAGAGGGATTTGGGAGTGTATGG + Intronic
1032019901 7:128401523-128401545 AAGAAGGCCAGGGGAGTGGAGGG + Intronic
1032258786 7:130317937-130317959 AGGAGGGCCCGGGGGGTGGATGG - Intronic
1033296697 7:140144891-140144913 AAGAGGTACAAGGGAGTGGGAGG - Intronic
1034123529 7:148650423-148650445 TACAGGGAACAGGGAGTGGAGGG - Intergenic
1034324907 7:150221026-150221048 AAGAGAGACAGTGGAGTGGGCGG + Intergenic
1034768288 7:153748207-153748229 AAGAGAGACAGTGGAGTGGGCGG - Intergenic
1034998794 7:155595064-155595086 TAAAGGGAACTGGGAGTGGATGG - Intergenic
1035129951 7:156642388-156642410 ATGAGTGACCGGGTTGTGGAGGG + Intronic
1036203041 8:6785128-6785150 AAGAGGAACAAAGGAGTGGATGG - Intergenic
1036603460 8:10285140-10285162 AAGAGAGCTCGAGGAGTGGATGG - Intronic
1037977523 8:23224334-23224356 AAGAAGGACGGGGGTGGGGAGGG + Intronic
1038313727 8:26465426-26465448 CAGAGGGACCAGGGGGTGGGAGG - Intronic
1038697165 8:29817065-29817087 AAGAGGGAAAGAGGAGTGGGAGG - Intergenic
1041743781 8:61184185-61184207 AAGAAGGATCAAGGAGTGGAAGG + Intronic
1042269002 8:66937103-66937125 AAGAGGGAGAGGAGAGGGGAGGG - Intergenic
1043322656 8:79009373-79009395 AAGAGGGAAGGGGGAAGGGAGGG - Intergenic
1043322678 8:79009427-79009449 AAGAGGGAAGGGGGAAGGGAGGG - Intergenic
1043474121 8:80589851-80589873 AAGAGGGGAGGAGGAGTGGATGG + Intergenic
1043858231 8:85286185-85286207 GAGAGGGAGAGGGGAGGGGAGGG + Intergenic
1045490325 8:102663251-102663273 AAGCGGGACCGTGGAGTGGAGGG - Intergenic
1046130990 8:109968654-109968676 AGGAGGGAGAGGGGAGGGGAGGG - Intronic
1046619102 8:116509064-116509086 AAGAGGGTCAAGGGAGTTGAGGG + Intergenic
1047247601 8:123158752-123158774 AAGAGGAATCTCGGAGTGGATGG + Intergenic
1048299076 8:133238466-133238488 AAGAGGAAACGGGAAGTGGGCGG + Exonic
1048333999 8:133489801-133489823 AAGAGGGGCCCAGGAGTGGGCGG - Intronic
1049236844 8:141516527-141516549 AAGAGGGAGCGGGCAGTGATGGG - Intronic
1051377316 9:16415767-16415789 AAAAGGGACAGGGGAGTGGATGG - Exonic
1051599125 9:18854475-18854497 AAGAGGAACCAGGTAGTTGAGGG + Intronic
1051872086 9:21749627-21749649 AAGAGGTACAGGGGTGTTGAAGG - Intergenic
1052880610 9:33599162-33599184 AAGCGGGACCCGGGAGAAGAGGG - Intergenic
1052951862 9:34219835-34219857 GAGAGGGAAGGGGGAGGGGAAGG - Intronic
1052951873 9:34219858-34219880 GAGAGGGAAGGGGGAGGGGAAGG - Intronic
1052951919 9:34219955-34219977 GAGAGGGAAGGGGGAGGGGAGGG - Intronic
1053152172 9:35750047-35750069 AAGGGGAACGGGGGAGGGGAAGG - Intronic
1053666825 9:40322974-40322996 AAGCGGGACCTGGGAGTAGAGGG - Intronic
1053916421 9:42948081-42948103 AAGCGGGACCTGGGAGTAGATGG - Intergenic
1054377977 9:64463002-64463024 AAGCGGGACCTGGGAGTAGAGGG - Intergenic
1054517784 9:66053309-66053331 AAGCGGGACCTGGGAGTAGAGGG + Intergenic
1055048935 9:71960206-71960228 AGGAGGGACCAGGGAATGGAGGG + Intronic
1055580753 9:77703899-77703921 GAGAGGGAGAGGGGAGGGGAGGG + Intergenic
1055985862 9:82056251-82056273 AAGTGGGACCTGGGAGAAGAGGG - Intergenic
1056539230 9:87557064-87557086 AAGAGGGAAGGGTGAGGGGAAGG - Intronic
1056897257 9:90562607-90562629 AAGAGGGAGGGAGGACTGGATGG - Intergenic
1057908704 9:99002080-99002102 GAGAGGGAAAGGGGAGAGGAGGG - Intronic
1058163518 9:101595093-101595115 GAGAGGGAGCGGAGAGAGGAGGG + Intronic
1059657160 9:116367544-116367566 ACCAGGGACCAGGGAGTGGGAGG + Intronic
1060290855 9:122301221-122301243 ATGAGGGACGGCGGGGTGGAGGG - Intronic
1060304877 9:122402399-122402421 AGTAGGGATGGGGGAGTGGAGGG + Intergenic
1061357967 9:130120625-130120647 CAGAGCGATCGAGGAGTGGATGG - Intronic
1061540837 9:131277292-131277314 CGGAGGGACCGGGGTGGGGAAGG - Intergenic
1061584500 9:131557159-131557181 TAGAGGGATGGGTGAGTGGATGG - Intergenic
1061941591 9:133887007-133887029 AGGAGGGCCCGGGGTGGGGAGGG - Intronic
1062074765 9:134579835-134579857 GAGAAGGAGCGGGGAGGGGAAGG + Intergenic
1062123619 9:134847862-134847884 CAGAGGGAGTGGGGAGAGGAAGG + Intergenic
1062194744 9:135266758-135266780 AAGGGGGACAGGGGAGTGACAGG - Intergenic
1203624602 Un_KI270750v1:1394-1416 AAGAGGGAGAGGTGGGTGGAGGG + Intergenic
1187039291 X:15576614-15576636 AAGAGGGAGGGAGGAATGGAAGG + Intronic
1187685459 X:21811553-21811575 AAGAGGAAAAGGGGAGTAGAGGG - Intergenic
1190421305 X:50287334-50287356 AGGAGGGGCCGGGGAAGGGAAGG - Intronic
1190642768 X:52496094-52496116 AAGGAGGGCCGAGGAGTGGAGGG + Intronic
1190644905 X:52516773-52516795 AAGGAGGGCCGAGGAGTGGAGGG - Intronic
1190757722 X:53415177-53415199 AAGAGGGACGAGGCAGTAGAGGG + Intronic
1192335970 X:70220074-70220096 AAGAGGGACAAGGGAGAGGTTGG + Intergenic
1193336139 X:80291561-80291583 AAGAAGGGACGGGGAGGGGAGGG + Intergenic
1195017104 X:100790900-100790922 AAGAGGGAATGGAGGGTGGAAGG + Intergenic
1197727453 X:129785868-129785890 AAGAGGGAACGGAGAGAGGGTGG - Intronic
1201549927 Y:15209215-15209237 AAGGGGGAGCAGGGAGAGGAGGG + Intergenic