ID: 1161027572

View in Genome Browser
Species Human (GRCh38)
Location 19:2043563-2043585
Sequence CAGATCATTGAGAAGCAGCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 668
Summary {0: 1, 1: 0, 2: 3, 3: 31, 4: 633}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161027572_1161027574 -9 Left 1161027572 19:2043563-2043585 CCTGGCTGCTTCTCAATGATCTG 0: 1
1: 0
2: 3
3: 31
4: 633
Right 1161027574 19:2043577-2043599 AATGATCTGAAACAGGCGAAAGG 0: 1
1: 0
2: 0
3: 13
4: 156
1161027572_1161027577 9 Left 1161027572 19:2043563-2043585 CCTGGCTGCTTCTCAATGATCTG 0: 1
1: 0
2: 3
3: 31
4: 633
Right 1161027577 19:2043595-2043617 AAAGGACACAGCACCTGGGTTGG 0: 1
1: 0
2: 4
3: 27
4: 247
1161027572_1161027575 4 Left 1161027572 19:2043563-2043585 CCTGGCTGCTTCTCAATGATCTG 0: 1
1: 0
2: 3
3: 31
4: 633
Right 1161027575 19:2043590-2043612 AGGCGAAAGGACACAGCACCTGG 0: 1
1: 0
2: 0
3: 11
4: 212
1161027572_1161027576 5 Left 1161027572 19:2043563-2043585 CCTGGCTGCTTCTCAATGATCTG 0: 1
1: 0
2: 3
3: 31
4: 633
Right 1161027576 19:2043591-2043613 GGCGAAAGGACACAGCACCTGGG 0: 1
1: 0
2: 0
3: 9
4: 127
1161027572_1161027578 12 Left 1161027572 19:2043563-2043585 CCTGGCTGCTTCTCAATGATCTG 0: 1
1: 0
2: 3
3: 31
4: 633
Right 1161027578 19:2043598-2043620 GGACACAGCACCTGGGTTGGTGG 0: 1
1: 0
2: 1
3: 48
4: 357
1161027572_1161027579 13 Left 1161027572 19:2043563-2043585 CCTGGCTGCTTCTCAATGATCTG 0: 1
1: 0
2: 3
3: 31
4: 633
Right 1161027579 19:2043599-2043621 GACACAGCACCTGGGTTGGTGGG 0: 1
1: 0
2: 1
3: 15
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161027572 Original CRISPR CAGATCATTGAGAAGCAGCC AGG (reversed) Exonic
900587076 1:3438117-3438139 AAGACCATTGAGAAGGAGGCTGG + Exonic
900828441 1:4945734-4945756 CTTACCTTTGAGAAGCAGCCCGG - Intergenic
901118268 1:6866937-6866959 GAGATCATGGAGAAGCACACGGG - Intronic
901653849 1:10758045-10758067 CAGATCAGTGAAGAGCAGGCTGG - Intronic
901957497 1:12797261-12797283 CAGATCTTGGAAAAACAGCCTGG - Intergenic
903100488 1:21024397-21024419 CAGCTCATTGAGAATGGGCCAGG + Intronic
903232692 1:21931521-21931543 CAGATACTTGGGAAGCTGCCGGG + Intronic
903323080 1:22554085-22554107 CAGATCATGGAGAAGGAGCCAGG - Intergenic
903485969 1:23689259-23689281 CAGCTCATTGAGAACGGGCCGGG + Intergenic
903525807 1:23993207-23993229 CAGCTCATTGAGAACGGGCCAGG - Intergenic
903531140 1:24031914-24031936 CAGCTCATTGAGAACGGGCCAGG - Intergenic
903634400 1:24800572-24800594 CAGTTCATTGAGAATGGGCCAGG + Intronic
903924095 1:26819170-26819192 CAGCTCATTGAGAACGGGCCAGG + Intergenic
903993192 1:27288838-27288860 CAGCTCATTGAGAACGGGCCAGG - Intronic
904078068 1:27854590-27854612 CAGCTCATTGAGAACGGGCCAGG + Intergenic
904795458 1:33052973-33052995 CAGCTCATTGAGAACGGGCCAGG + Intronic
905598992 1:39234277-39234299 CAGCTCATTGAGAACGGGCCAGG - Intronic
905699444 1:40000131-40000153 CAGCTCATTGAGAACGGGCCAGG + Intergenic
906136333 1:43502467-43502489 CAGCTCATTGAGAACGGGCCGGG + Intergenic
906353333 1:45081834-45081856 CAGCTCATTGAGAACGGGCCAGG + Intronic
906400049 1:45497887-45497909 CAGCTCATTGAGAACGGGCCAGG + Intronic
906487421 1:46242441-46242463 CAGCTCATTGAGAACGGGCCAGG + Intergenic
906539802 1:46576635-46576657 CAGATCATCGAGAAACAAGCAGG - Exonic
906742202 1:48193135-48193157 CAGCTCATTGAGAACGGGCCAGG + Intergenic
906770714 1:48479744-48479766 CAGCTCATTGAGAACGGGCCGGG + Intergenic
907089474 1:51711194-51711216 CAGCTCATTGAGAACGGGCCAGG - Intronic
907453368 1:54561590-54561612 CAGCTCATTGAGAACGGGCCAGG - Intronic
908468259 1:64416028-64416050 CAGCTCATTGAGAACGGGCCGGG + Intergenic
910344171 1:86216824-86216846 CAGCTCATTGAGAACGGGCCAGG + Intergenic
912302892 1:108535964-108535986 CAGCTCATTGAGAACGGGCCAGG - Intergenic
912690317 1:111800048-111800070 CAGCTCATTGAGAACGGGCCAGG + Intronic
912790084 1:112640728-112640750 CAGCTCATTGAGAACGGGCCAGG + Intronic
912808400 1:112774467-112774489 CAGCTCATTGAGAACGGGCCTGG + Intergenic
912825053 1:112898111-112898133 CAGCTCATTGAGAACGGGCCAGG - Intergenic
912845383 1:113070639-113070661 CAGCTCATTGAGAACGGGCCAGG + Intergenic
913021056 1:114790449-114790471 CAGCTCATTGAGAACGGGCCAGG - Intergenic
914774960 1:150728436-150728458 CAGCTCATTGAGAACGGGCCAGG - Intergenic
914893697 1:151651089-151651111 CAGCTCATTGAGAACGGGCCAGG - Intronic
915131443 1:153698074-153698096 CAGATCCTTCCGAGGCAGCCTGG + Intergenic
915411092 1:155701185-155701207 CAGCTCATTGAGAACGGGCCAGG + Intronic
916271137 1:162942889-162942911 GAGAGCAGTGAGAAGCAGCATGG - Intergenic
916488592 1:165281025-165281047 CAGAACATGGAGAAGTAGTCTGG + Intronic
917375517 1:174348946-174348968 CAGCTCATTGAGAACGGGCCAGG - Intronic
918228486 1:182509174-182509196 CAGCTCATTGAGAACGGGCCAGG - Intronic
919784735 1:201252018-201252040 CAGAGGGTTCAGAAGCAGCCCGG + Intergenic
919925750 1:202191310-202191332 CAGCTCATTGAGAACGGGCCAGG - Intergenic
919994850 1:202739962-202739984 CAGCTCATTGAGAACGGGCCGGG - Intronic
920008564 1:202851292-202851314 CACATTATTTAAAAGCAGCCTGG + Intergenic
920451763 1:206064783-206064805 CAGCTCATTGAGAACGGGCCAGG + Intronic
920749371 1:208659424-208659446 CAGCTCATTGAGAACGGGCCAGG - Intergenic
921902569 1:220466171-220466193 CAGCTCATTGAGAACGGGCCAGG - Intergenic
922102925 1:222488875-222488897 CAGCTCATTGAGAACGGGCCGGG + Intergenic
922221767 1:223613726-223613748 CTGCTGACTGAGAAGCAGCCAGG - Intronic
923711127 1:236387505-236387527 CAGCTCATTGAGAACGGGCCAGG + Intronic
923771192 1:236939035-236939057 GAGAGCTTTGAGAAGCAGCTGGG - Intergenic
923792882 1:237127272-237127294 CAGCTCATTGAGAACGGGCCAGG - Intronic
924178326 1:241415745-241415767 CAGCTCATTGAGAACGGGCCAGG + Intergenic
924818160 1:247460959-247460981 TAGAACATTGAGAAGGAGCCAGG + Intergenic
924925677 1:248677068-248677090 CAGCTCATTGAGAACGGGCCGGG + Intergenic
924954197 1:248911605-248911627 CAGCTCATTGAGAACGGGCCAGG - Intronic
1064061861 10:12144753-12144775 AAGATCATTGAGGAGGGGCCAGG + Intronic
1064663399 10:17628837-17628859 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1064844594 10:19637750-19637772 CACTTCCTTGAAAAGCAGCCAGG + Intronic
1065012316 10:21430706-21430728 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1065336480 10:24657557-24657579 CAGCTCATTGAGAACGGGCCAGG + Intronic
1065594150 10:27296049-27296071 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1067026007 10:42844923-42844945 CAGTCCATTGTGAAGCAGCAGGG + Intergenic
1067354668 10:45512731-45512753 CAGCTCATTGAGAACGGGCCGGG + Intronic
1068668430 10:59700104-59700126 TAGATCATTGAAAAGCCCCCAGG + Intronic
1069369044 10:67724431-67724453 CAGATAATTTGAAAGCAGCCGGG + Intergenic
1069532510 10:69229660-69229682 CTGAACCTTCAGAAGCAGCCAGG - Intronic
1069740899 10:70686773-70686795 CAGCTCATTGAGAACGGGCCAGG - Intronic
1070317812 10:75332963-75332985 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1071868245 10:89762301-89762323 GAGATCTTTGACAAACAGCCTGG - Intronic
1072117381 10:92376939-92376961 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1072149470 10:92674218-92674240 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1072153001 10:92698532-92698554 CCAATCATTTAGAAGCATCCTGG - Intergenic
1072648873 10:97277103-97277125 CAGCTCATTGAGAACGGGCCAGG + Intronic
1072949240 10:99837960-99837982 CAGCTCATTGAGAACGGGCCAGG - Intronic
1072956616 10:99892264-99892286 CAGCTCATTGAGAACGGGCCAGG + Intronic
1072980628 10:100094051-100094073 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1073386562 10:103130061-103130083 CAGCTCATTGAGAACGGGCCAGG + Intronic
1073594282 10:104784934-104784956 CAGCTCATTGAGAACGGGCCAGG - Intronic
1074826343 10:117217751-117217773 CAGATCACTGAGAACCACACGGG - Intergenic
1074945040 10:118273283-118273305 GAGATCCTTGAGAAGGGGCCAGG + Intergenic
1075128995 10:119722582-119722604 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1075477040 10:122744955-122744977 CAGAAGATTGAGAAACATCCTGG - Intergenic
1077078314 11:711105-711127 CTGAGCCCTGAGAAGCAGCCCGG - Intronic
1077397713 11:2332970-2332992 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1078095674 11:8295228-8295250 GAGAGCATGGGGAAGCAGCCGGG + Intergenic
1078472721 11:11604635-11604657 CAGAGCTTTGAGAAGCTTCCTGG + Intronic
1079039614 11:17050089-17050111 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1079174025 11:18121506-18121528 CAGCTCATTGAGAACGGGCCAGG + Intronic
1079357715 11:19743779-19743801 CAGGACAGTGAGAAGCTGCCGGG - Intronic
1080098409 11:28431286-28431308 CAGCTCATTGAGAACAGGCCAGG + Intergenic
1080454369 11:32404846-32404868 CAGATCTTTGAGAACAAGCTGGG - Intronic
1081289318 11:41305410-41305432 CAGCTCATTGAGAACGGGCCAGG + Intronic
1081784546 11:45738014-45738036 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1081956594 11:47097813-47097835 CAGCTCATTGAGAACGGGCCAGG + Intronic
1082844431 11:57716070-57716092 CAGCTCATTGAGAACGGGCCGGG - Intronic
1083115159 11:60451904-60451926 CAGCTCATTGAGAACGGGCCAGG + Intronic
1083154835 11:60815863-60815885 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1083382759 11:62279801-62279823 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1083645594 11:64171239-64171261 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1083832205 11:65239809-65239831 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1084049258 11:66588601-66588623 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1084140178 11:67222561-67222583 CAGCTCATTGAGAACGGGCCAGG - Intronic
1084624102 11:70295042-70295064 CAGCTCATTGAGAACGGGCCAGG - Intronic
1084924506 11:72502001-72502023 CAGCTCATTGAGAATGGGCCAGG - Intergenic
1085512976 11:77097958-77097980 CAGCTCATTGAGAACGGGCCAGG - Intronic
1085563354 11:77490635-77490657 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1086259073 11:84916047-84916069 CAGAGGATTAAGAAGCAGGCCGG + Intronic
1086366449 11:86111632-86111654 CAGCTCATTGAGAACGGGCCGGG + Intergenic
1087057010 11:93946575-93946597 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1087214871 11:95482912-95482934 CAGCTCATTGAGAACAGGCCAGG + Intergenic
1087948838 11:104195133-104195155 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1089313763 11:117576847-117576869 CAGATAATTGAGAACCAGGCAGG + Intronic
1089420624 11:118330773-118330795 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1089585393 11:119507477-119507499 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1090181651 11:124704836-124704858 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1090323421 11:125864177-125864199 CAGCTCATTGAGAATGGGCCAGG + Intergenic
1090605088 11:128413556-128413578 CAAATCTTTGAGATCCAGCCCGG + Intergenic
1091586218 12:1818277-1818299 CAGCTCATTGAGAACGGGCCAGG + Intronic
1091762232 12:3095358-3095380 CAGCTCATTGAGAACGGGCCAGG - Intronic
1092579422 12:9821765-9821787 CAGAGCATTGAGAGGCAGCATGG + Intergenic
1092591273 12:9953716-9953738 CAGCTCATTGAGAACGGGCCAGG + Intronic
1092813380 12:12291953-12291975 CAGAACGTTGAGAAGCATCTGGG + Intergenic
1094209505 12:27874368-27874390 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1094520371 12:31180731-31180753 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1094670227 12:32562901-32562923 CAGCTCATTGAGAACGGGCCGGG - Intronic
1095068449 12:37814198-37814220 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1095241571 12:39866197-39866219 AAGAACATTGAGAAGCATCGTGG + Intronic
1096021879 12:48332189-48332211 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1096039238 12:48500212-48500234 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1096092931 12:48915599-48915621 CAGCTCATTGAGAACGGGCCAGG - Intronic
1096856468 12:54487969-54487991 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1097028399 12:56075583-56075605 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1098537723 12:71613651-71613673 CAGAACACTGACAAGAAGCCAGG + Intronic
1100345667 12:93727701-93727723 CAGTTCAGTGACAGGCAGCCAGG + Intronic
1100582543 12:95948637-95948659 CAGCTCATTGAGAACGGGCCAGG + Intronic
1100845631 12:98655317-98655339 CAGCTCATTGAGAACGGGCCAGG - Intronic
1100945427 12:99777901-99777923 AAGTTCAGTGAGAGGCAGCCGGG + Intronic
1100994887 12:100294016-100294038 CAGCTCATTGAGAACGGGCCAGG - Intronic
1101003166 12:100376427-100376449 AAGATCATTGAGAAGGAGCATGG + Intronic
1101393309 12:104323291-104323313 CAGCTCATTGAGAACGGGCCAGG - Intronic
1102174536 12:110866806-110866828 CAGCTCATTGAGAACGGGCCAGG - Intronic
1102293775 12:111722873-111722895 CAGCTCATTGAGAACGGGCCAGG - Intronic
1102578874 12:113873186-113873208 CAGCTCATTGAGAACGGGCCAGG + Intronic
1102736438 12:115164953-115164975 GAGATGATGGGGAAGCAGCCTGG + Intergenic
1103234350 12:119360021-119360043 CAGCTCATTGAGAACGGGCCAGG - Intronic
1103299626 12:119918293-119918315 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1103379160 12:120480485-120480507 CAGATCCCAGAGAAGCTGCCAGG - Intronic
1103585087 12:121946880-121946902 CACATCATTGAAAAGCTGCTGGG - Intronic
1103591571 12:121994464-121994486 CAGCTCATTGAGAACGGGCCAGG + Intronic
1104712404 12:130996264-130996286 CAGCTCATTGAGAACGGGCCAGG - Intronic
1105368190 13:19780318-19780340 CAGCTCATTGAGAACGGGCCAGG + Intronic
1105556225 13:21448724-21448746 CAGCTCATTGAGAACGGGCCAGG + Intronic
1106680304 13:32000630-32000652 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1106885672 13:34181632-34181654 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1106918938 13:34541475-34541497 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1107692549 13:42966785-42966807 CAGCTCATTGAGAACGGGCCAGG + Intronic
1108024479 13:46163144-46163166 CAGCTCATTGAGAACGGGCCAGG + Intronic
1108059091 13:46515382-46515404 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1108330666 13:49379202-49379224 CAGCTCATTGAGAACGGGCCAGG + Intronic
1108341856 13:49504721-49504743 CAGCTCATTGAGAACGGGCCAGG + Intronic
1108351651 13:49593730-49593752 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1108608892 13:52064628-52064650 CAGCTCATTGAGAACGGGCCGGG + Intronic
1110269711 13:73575713-73575735 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1111418097 13:87976098-87976120 CAGCTCATTGAGAATGGGCCAGG - Intergenic
1111604610 13:90520721-90520743 CAGAGCATTGAGAGGTAGCATGG + Intergenic
1112590776 13:100761998-100762020 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1115610003 14:35039765-35039787 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1115688804 14:35824442-35824464 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1116005161 14:39285238-39285260 CAGCTCATTGAGAACGGGCCAGG - Intronic
1116480826 14:45390336-45390358 CAGCTCATTGAGAATGGGCCAGG + Intergenic
1116871767 14:50074418-50074440 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1116959595 14:50956429-50956451 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1117498318 14:56327722-56327744 CAGACCAATGAGAAGCTGCTAGG - Intergenic
1117716721 14:58588655-58588677 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1118148884 14:63166324-63166346 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1119231718 14:72985103-72985125 CATATCTTTGAGAAACAGCCTGG - Intronic
1119254137 14:73183785-73183807 CAGCTCATTGAGAACGGGCCAGG - Intronic
1119659493 14:76440026-76440048 CATACCAGTGAGAAGCACCCAGG - Intronic
1119700485 14:76750879-76750901 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1119711053 14:76822228-76822250 CAGCTCATTGAGAACGGGCCGGG + Intronic
1119854184 14:77887027-77887049 CAGTTCAGTGAGAGGGAGCCAGG - Intronic
1120893121 14:89506632-89506654 CAGCTCATTGAGAACGGGCCAGG + Intronic
1121039458 14:90733357-90733379 CAGATGAAGGAGAAGGAGCCGGG - Intronic
1121142670 14:91557021-91557043 CAGCTCATTGAGAAAGGGCCGGG - Intergenic
1121306511 14:92911200-92911222 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1122212472 14:100181436-100181458 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1122406157 14:101502308-101502330 CAGATGATGGAGCAGCAGCAAGG + Intergenic
1122963492 14:105111270-105111292 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1123426621 15:20176259-20176281 CAGTCCATTGTGAAGCAGCAGGG + Intergenic
1123535852 15:21182786-21182808 CAGTCCATTGTGAAGCAGCAGGG + Intergenic
1124245999 15:28070669-28070691 CAGCTCATTGAGAACGGGCCAGG + Intronic
1125079605 15:35657078-35657100 CAGCTCATTGAGAAGGGGCCAGG + Intergenic
1125459309 15:39893591-39893613 CAGCTCATTGAGAACAGGCCAGG - Intronic
1125659614 15:41383541-41383563 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1126001862 15:44218259-44218281 CACATCATTTAGAAGTAGCCAGG + Intergenic
1126233584 15:46355162-46355184 CAGAACATTGAGACGGAGCATGG + Intergenic
1127073362 15:55303969-55303991 CAGCTCATTGAGAACAGGCCAGG + Intronic
1127154648 15:56111154-56111176 CAGCTCATTGAGAACGGGCCAGG + Intronic
1127782793 15:62332062-62332084 CAGCTCATTGAGAACGGGCCGGG - Intergenic
1128135247 15:65258348-65258370 CAGGTCTTTGAGACTCAGCCTGG - Exonic
1128706437 15:69840502-69840524 CAGGTCATTGTGAAGCATCTTGG + Intergenic
1128938706 15:71769423-71769445 CAGCTCATTGAGAACGGGCCAGG + Intronic
1128970662 15:72101995-72102017 CAGCTCATTGAGAACGGGCCAGG + Intronic
1129246979 15:74285308-74285330 CAGAGCTTTCAGAAGCAGCATGG + Intronic
1129344989 15:74911735-74911757 GAGATAAATGAGAAGCAGGCAGG + Intergenic
1129428687 15:75481964-75481986 CAGCTCATTGAGAACGGGCCAGG + Intronic
1129431874 15:75504967-75504989 CAGCTCATTGAGAACGGGCCAGG + Intronic
1130036170 15:80363375-80363397 CAGAACAGTGAGGAGCAGCAGGG - Intronic
1130340559 15:82997690-82997712 CAGCTCATTGAGAACGGGCCAGG - Intronic
1131001124 15:88941236-88941258 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1131125705 15:89855033-89855055 CAGCTCATTGAGAACGGGCCAGG + Intronic
1131141242 15:89978258-89978280 CAGCTCATTGAGAAGGGGCCAGG + Intergenic
1131479182 15:92767960-92767982 CAGCTCATTGAGAACGGGCCAGG - Intronic
1132036915 15:98492883-98492905 CAGCTCATTGAGAACGGGCCGGG - Intronic
1132777048 16:1599959-1599981 CAGCTCATTGAGAACGGGCCAGG + Intronic
1133659558 16:7903242-7903264 CAGCTCATTGAGAACGGGCCGGG - Intergenic
1133751923 16:8732709-8732731 CAGCTCATTGAGAACGGGCCAGG - Intronic
1134899969 16:17928929-17928951 CATATCATGGAGAATCACCCAGG - Intergenic
1135026601 16:19003538-19003560 CAGCTCATTGAGAACGGGCCAGG + Intronic
1135639498 16:24108840-24108862 CAGCTCATTGAGAACGGGCCAGG - Intronic
1135915637 16:26603219-26603241 CAGGTCATTGAGAAACAACAGGG + Intergenic
1136160831 16:28417323-28417345 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1136197653 16:28665947-28665969 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1136202135 16:28697677-28697699 CAGCTCATTGAGAACGGGCCAGG - Intronic
1136426412 16:30170419-30170441 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1136857623 16:33673246-33673268 CAGTCCATTGTGAAGCAGCAGGG - Intergenic
1137244842 16:46694347-46694369 CAGCTCATTGAGAACGGGCCAGG - Intronic
1137284089 16:47000797-47000819 CAGCTCATTGAGAATGGGCCAGG + Intergenic
1138400127 16:56739203-56739225 CAGCTCATTGAGAACGGGCCAGG - Intronic
1138642078 16:58395819-58395841 CAGCTCATTGAGAACGGGCCAGG - Intronic
1138749217 16:59398631-59398653 CTGAGGATTGAGAAGGAGCCAGG - Intergenic
1139885744 16:70205460-70205482 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1141305796 16:82862787-82862809 CAGATCATGCAGATGCAGTCGGG + Intronic
1141917652 16:87110893-87110915 CAGATCATCAGGCAGCAGCCAGG - Intronic
1142704918 17:1689063-1689085 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1143115219 17:4578295-4578317 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1143277243 17:5721333-5721355 CAGCTCATTGAGAATGGGCCGGG - Intergenic
1143342856 17:6226585-6226607 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1143576029 17:7793757-7793779 CTGATTAAAGAGAAGCAGCCGGG - Intronic
1144482238 17:15637754-15637776 CAGCTCATTGAGAACGGGCCAGG + Intronic
1144541409 17:16145803-16145825 CAGCTCATTGAGAGCCGGCCAGG + Intronic
1144716812 17:17442147-17442169 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1144934636 17:18888334-18888356 CAGCTCATTGAGAACGGGCCAGG - Intronic
1145047085 17:19627611-19627633 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1145206321 17:20985705-20985727 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1145684647 17:26639353-26639375 CAGCTCATTGAGAACGGGCCGGG + Intergenic
1145717353 17:27034332-27034354 CAGCTCATTGAGAATGGGCCAGG + Intergenic
1145863206 17:28224785-28224807 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1145895566 17:28455898-28455920 CAGCTCATTGAGAACGGGCCAGG - Intronic
1146849869 17:36212611-36212633 CGGCTCATGGAGAAGCATCCAGG - Exonic
1147024282 17:37566141-37566163 CCGCTCATTGAGAAGGGGCCAGG + Intronic
1147109803 17:38253527-38253549 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1147963671 17:44181333-44181355 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1148224032 17:45885743-45885765 CAATTGATTGAGAAGAAGCCTGG - Intergenic
1148267459 17:46238066-46238088 CAGCTCATTGAGAATGGGCCAGG - Intergenic
1148567091 17:48639887-48639909 TAGACAATTGAGGAGCAGCCAGG + Intergenic
1149793764 17:59500656-59500678 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1150380665 17:64716857-64716879 CAGCTCATTGAGAACGGGCCGGG + Intergenic
1150703936 17:67470709-67470731 CAGCTCATTGAGAACAGGCCAGG + Intronic
1150815015 17:68385985-68386007 CAGCTCATTAAGAAGCATCATGG - Intronic
1151848984 17:76678550-76678572 CAGAAGAGTGAGATGCAGCCAGG - Intronic
1152487163 17:80602055-80602077 CAGCTCATTGAGAACGGGCCAGG - Intronic
1154398088 18:14010445-14010467 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1156278631 18:35610281-35610303 CAGGGCAATGAGAAGCAGCCTGG - Intronic
1157629143 18:49079892-49079914 CAGCTCATTGAGAACGGGCCGGG - Intronic
1157640062 18:49203360-49203382 CAGCTCATTGAGAACGGGCCAGG + Intronic
1157677135 18:49577505-49577527 CAGCTCATTGAGAACGGGCCAGG - Intronic
1157719129 18:49910095-49910117 CCGAGCACTGAGAAGCAGGCAGG + Intronic
1158148895 18:54344080-54344102 CAGCTCATTGAGAACGGGCCAGG + Intronic
1158281971 18:55838408-55838430 CAGTTCATTGAGAGGCAGCGAGG - Intergenic
1158987688 18:62835491-62835513 AAGATCATTGATAAGGAGCCAGG - Intronic
1159157981 18:64608815-64608837 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1159340365 18:67126674-67126696 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1160252716 18:77217489-77217511 CAGCTCATTTACAAGCTGCCTGG - Intergenic
1160494947 18:79367853-79367875 CGGAGCTTTGAGGAGCAGCCAGG + Intronic
1161027572 19:2043563-2043585 CAGATCATTGAGAAGCAGCCAGG - Exonic
1161434846 19:4257076-4257098 CACAGCACTGGGAAGCAGCCAGG + Intronic
1162309800 19:9899455-9899477 GAGCTGATTGAGAAGGAGCCAGG - Intronic
1162519726 19:11172740-11172762 CAGTTCATTGAGCAGCAGCTGGG - Intronic
1162542076 19:11303063-11303085 CAGCTCATTGAGAACGGGCCAGG + Intronic
1162714572 19:12621862-12621884 CAGCTCATTGAGAACGGGCCAGG + Intronic
1162887147 19:13704033-13704055 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1163193613 19:15697672-15697694 CAGCTGATGGACAAGCAGCCTGG - Intergenic
1163904367 19:20138115-20138137 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1163905548 19:20149261-20149283 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1164081467 19:21865233-21865255 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1164105545 19:22106596-22106618 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1164192947 19:22928093-22928115 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1164652153 19:29898827-29898849 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1164798171 19:31053385-31053407 CAGAGCATTGAGAGGGAGCATGG - Intergenic
1164905898 19:31967756-31967778 CAGATCAATCAGGAGAAGCCAGG - Intergenic
1165192736 19:34078976-34078998 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1166028114 19:40107704-40107726 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1166030156 19:40118872-40118894 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1166192059 19:41181331-41181353 CAGCTCATTGAGAACGGGCCGGG + Intergenic
1166261836 19:41645364-41645386 CAGCTCATTGAGAACGGGCCAGG + Intronic
1166417872 19:42610153-42610175 CAGCTCATTGAGAACGGGCCGGG - Intronic
1166708354 19:44921601-44921623 CAGCTCATTGAGAACCGGCCAGG - Intergenic
1167038881 19:47010118-47010140 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1167907840 19:52676633-52676655 CAGCTCATTGAGAACGGGCCAGG + Intronic
1167980240 19:53269875-53269897 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1168572780 19:57483723-57483745 CAGCTCATTGAGAACGGGCCGGG + Intergenic
925819690 2:7787837-7787859 CAGATGACTGAGAAGCAGCCAGG + Intergenic
925962698 2:9033509-9033531 CAGAGCATTGGGAAGGACCCAGG + Intergenic
926215252 2:10902437-10902459 CAGCTCATTGAGAACGGGCCAGG - Intergenic
926906465 2:17810337-17810359 CAGACCTTTGAGAAGCATCAAGG - Intergenic
927747485 2:25634563-25634585 CAGCTCATTGAGAACGGGCCAGG + Intronic
927832999 2:26370346-26370368 CAGCTCATTGAGAACGGGCCAGG - Intronic
927978816 2:27359746-27359768 CAGCTCATTGAGAACGGGCCAGG + Intergenic
928597519 2:32870039-32870061 CAGCTCATTGAGAACGGGCCAGG + Intergenic
929340681 2:40813201-40813223 CAGGTGATTCAGATGCAGCCGGG - Intergenic
929402371 2:41599647-41599669 CAGATCATCAAGAAGCATCTAGG + Intergenic
929416569 2:41748203-41748225 CAGCTCATTGAGAACGGGCCAGG + Intergenic
929447632 2:42014218-42014240 CAGCTCATTGAGAACGGGCCAGG - Intergenic
929515752 2:42605071-42605093 CAGCTCATTGAGAACGGGCCAGG - Intronic
929614825 2:43298104-43298126 CAGCTCATTGAGAACGGGCCAGG + Intronic
929955361 2:46454121-46454143 GAGACCATTGAGGAGCAGCCAGG - Intronic
930201439 2:48555214-48555236 CAGCTCATTGAGAACGGGCCAGG - Intronic
930704046 2:54486227-54486249 CAGCTCATTGAGAACGGGCCAGG + Intronic
930833746 2:55773422-55773444 CAGCTCATTGAGAACGGGCCAGG - Intergenic
931576536 2:63722791-63722813 CAGCTCATTGAGAACGGGCCAGG + Intronic
931655902 2:64511436-64511458 CAGCTCATTGAGAACGGGCCAGG - Intergenic
931786401 2:65622919-65622941 CAGATCAGTGAGAGGCAACTCGG + Intergenic
932367406 2:71161586-71161608 CAGCTCATTGAGAACGGGCCGGG + Intergenic
932434263 2:71694036-71694058 CAGATCATGGGGCAGCAGCAAGG + Intergenic
932978893 2:76639077-76639099 CAGATCTTTGAGGAGCGACCAGG + Intergenic
933438322 2:82277344-82277366 CAGAGCATTGAGAGGGAGCACGG - Intergenic
934309909 2:91852491-91852513 CAGCTCATTGAGAACGGGCCAGG + Intergenic
934703886 2:96462608-96462630 CAGCTCATTGAGAACGGGCCAGG + Intergenic
934752951 2:96805935-96805957 CAGCTCATTGAGAACGGGCCAGG - Intronic
934810617 2:97273477-97273499 CAGATCATTGAGAGGGAACATGG + Intergenic
934827075 2:97434462-97434484 CAGATCATTGAGAGGGAACATGG - Intergenic
934905274 2:98195382-98195404 CAGATCATTGAGATGCACCAGGG + Intronic
935809631 2:106784989-106785011 CAGCTCCTTTAGAAACAGCCAGG + Intergenic
936546636 2:113395511-113395533 CAGCTCATTGAGAACGGGCCAGG + Intergenic
937168351 2:119843477-119843499 CAGCTCATTGAGAACGGGCCAGG - Intronic
937919313 2:127119388-127119410 CAGCTCATTGAGAACGGGCCAGG - Intergenic
938005509 2:127787345-127787367 CAGCTCATTGAGAACGGGCCAGG - Intronic
938781409 2:134588185-134588207 CAGATCCTGGAGAATCAGCCAGG + Intronic
940019556 2:149142448-149142470 CAGATCACTGATAAGGGGCCTGG + Intronic
941769340 2:169328417-169328439 CAGCTCATTGAGAACGGGCCGGG + Intronic
941814362 2:169785514-169785536 CAGCTCATTGAGAACGGGCCAGG - Intergenic
942096420 2:172538568-172538590 CAGCTCATTGAGAACGGGCCAGG + Intergenic
942620955 2:177845026-177845048 CAGCTCATTGAGAACGGGCCAGG - Intronic
942630871 2:177947273-177947295 CAGCTCATTGAGAACGGGCCAGG + Intronic
943587361 2:189757381-189757403 CAGATCATTGTGAAACAGCATGG - Intronic
944283212 2:197922500-197922522 CAGCTCATTGAGAACGGGCCAGG - Intronic
944625178 2:201563003-201563025 CAGCTCATTGAGAACGGGCCAGG - Intronic
944656467 2:201880962-201880984 CAGAAGAGAGAGAAGCAGCCAGG + Intronic
944732831 2:202534748-202534770 CAGCTCATTGAGAACGGGCCAGG - Intronic
944815475 2:203372416-203372438 CAGCTCATTGAGAACGGGCCGGG - Intronic
945114760 2:206400497-206400519 CAGCTCATTGAGAACGGGCCAGG - Intergenic
945289577 2:208113702-208113724 CAGGACATTGAGCAGCATCCTGG + Intergenic
946321362 2:218956264-218956286 CAGATTAGGGAGAAGCAGACAGG + Intergenic
946359932 2:219213169-219213191 CAGAGCACTGAGAAGCAGGAAGG + Intronic
946742901 2:222817099-222817121 CAGCTCATTGAGAACGGGCCAGG + Intergenic
947065724 2:226222746-226222768 CACATCTTTGAGATGCATCCTGG - Intergenic
947901237 2:233724018-233724040 CAGCTCATTGAGAACGGGCCAGG - Intronic
1168741977 20:199900-199922 CAGGGCCTTGAGAAGTAGCCAGG - Intergenic
1169263758 20:4155424-4155446 CAGAGCAGAGAGAAGCATCCAGG - Intronic
1169371039 20:5028160-5028182 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1169718374 20:8644834-8644856 CAGCTCATTGAGAACGGGCCAGG + Intronic
1170031593 20:11949667-11949689 TGGAGCATTGAGAAGCTGCCAGG + Intergenic
1170063845 20:12289158-12289180 TAAATTATTGAGAAGCAGGCTGG - Intergenic
1170424669 20:16227025-16227047 CAGCTCATTGAGAATGGGCCAGG - Intergenic
1170524611 20:17226202-17226224 CAGATCTTGGAGGTGCAGCCAGG + Intronic
1170622874 20:18010077-18010099 CAGCTCATTGAGAACGGGCCGGG - Intronic
1170811413 20:19678195-19678217 CAGCTCATTGAGAACGGGCCAGG - Intronic
1171951979 20:31427927-31427949 CAGCTCATTGAGAACCGGCCGGG + Intergenic
1171956778 20:31469936-31469958 CAGCTCATTGAGAACGGGCCGGG - Intronic
1172059594 20:32177428-32177450 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1172141389 20:32724447-32724469 CAGCTCATTGAGAACGGGCCAGG + Intronic
1172199703 20:33115967-33115989 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1172257920 20:33536157-33536179 CAGCTCATTGAGAATGGGCCGGG - Intronic
1172348671 20:34223725-34223747 CAGCTCATTGAGAACGGGCCAGG + Intronic
1172349188 20:34229072-34229094 CAGCTCATTGAGAACGGGCCAGG - Intronic
1172402269 20:34659558-34659580 CAGCTCATTGAGAACGGGCCAGG + Intronic
1172465946 20:35154554-35154576 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1172729020 20:37069976-37069998 CAGCTCATTGAGAACGGGCCAGG + Intronic
1172736082 20:37126641-37126663 CAGCTCATTGAGAACGGGCCAGG + Intronic
1175346227 20:58278437-58278459 CAGGTCATTGCAAAGCAGCCAGG - Intergenic
1175361111 20:58413633-58413655 CAGCTCATTGAGAACGGGCCAGG - Intronic
1177134076 21:17291998-17292020 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1177177865 21:17719132-17719154 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1178034491 21:28564295-28564317 CAGCTCATTGAGAACCGGCCGGG + Intergenic
1180039707 21:45269294-45269316 CAGCTCATTGAGAACAGGCCAGG + Intronic
1181112348 22:20609538-20609560 CACATCTTTGAGAAGCAAGCAGG - Intergenic
1181881159 22:25981356-25981378 CAGATCACTGAGAACCATCTGGG - Intronic
1181970601 22:26687055-26687077 CAGTTCAATAAGCAGCAGCCAGG - Intergenic
1181981842 22:26772636-26772658 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1182052561 22:27324305-27324327 CAGACCCTTGAGAGGCAGACAGG - Intergenic
1182343487 22:29643778-29643800 CAGCTCATTGAGAACGGGCCAGG - Intronic
1182976124 22:34625763-34625785 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1183595608 22:38808045-38808067 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1183840953 22:40500881-40500903 CAGCTCATTGAGAATGGGCCAGG - Intronic
1183845710 22:40538074-40538096 CAGCTCATTGAGAACGGGCCAGG + Intronic
1183941104 22:41295205-41295227 CAGCTCATTGAGAACAGGCCAGG + Intergenic
1185027706 22:48425115-48425137 CCGATCCTGGAGGAGCAGCCGGG - Intergenic
949650833 3:6157141-6157163 CAAAGCATAGAGAAGCAGCCTGG + Intergenic
950044214 3:9939820-9939842 CAGCTCATTGAGAACGGGCCAGG - Intronic
950060976 3:10070635-10070657 CAGCTCATTGAGAACAGGCCGGG + Intronic
950253542 3:11487322-11487344 CAGCTCATTGAGAACGGGCCAGG - Intronic
950422648 3:12907832-12907854 GAGGCCATTGAGCAGCAGCCAGG - Intronic
950493929 3:13322477-13322499 CAAAGCTTTGAGATGCAGCCAGG + Intronic
950600916 3:14035054-14035076 CAGAGCATTGAGAGGGAGCATGG - Intronic
950969916 3:17176039-17176061 GAGAACATGGAGAGGCAGCCTGG + Intronic
951013174 3:17704409-17704431 CAGCTCATTGAGAACGGGCCAGG - Intronic
952538120 3:34335566-34335588 CAGGTACTTGTGAAGCAGCCAGG + Intergenic
952896280 3:38081303-38081325 CAGCTCATTGAGAACGGGCCAGG - Intronic
953407973 3:42669184-42669206 AAGATCGTTGAGTAGCTGCCAGG + Intergenic
953426451 3:42798794-42798816 CAGCTCATTGAGAACGGGCCAGG + Intronic
953855310 3:46495188-46495210 CAGCTCATTGAGAACGGGCCAGG + Intergenic
954081184 3:48212586-48212608 CAGCTCATTGAGAACGGGCCAGG + Intergenic
954483444 3:50823653-50823675 CAGCTCATTGAGAATGGGCCAGG - Intronic
954523668 3:51249781-51249803 CAGCTCATTGAGAACGGGCCAGG + Intronic
954791995 3:53140078-53140100 CAGATCAGTGAGAAGACTCCTGG - Intergenic
955097436 3:55813502-55813524 AAGATCACTGAGAAGCAGTGTGG - Intronic
955297696 3:57748265-57748287 CAGCTCATTGAGAACGGGCCAGG + Intergenic
955394599 3:58549558-58549580 CAGCTCATTGAGAACGGGCCAGG - Intergenic
955434698 3:58890040-58890062 CAGCTCATTGAGAACGGGCCAGG - Intronic
957168912 3:76711724-76711746 CAGGTAAGTGAGAAGCAGCATGG - Intronic
957316568 3:78582969-78582991 CAGCTCATTGAGAACGGGCCAGG - Intergenic
958808186 3:98836581-98836603 CAGCTCATTGAGAACGGGCCAGG - Intronic
959042932 3:101440078-101440100 CAGCTCATTGAGAACGGGCCAGG + Intronic
959419001 3:106111020-106111042 CAGCTCATTGAGAACGGGCCAGG - Intergenic
959520112 3:107316146-107316168 CAGAGCATTGAGAGGGAGCATGG - Intergenic
959683959 3:109124636-109124658 CAGCTCATTGAGAACGGGCCGGG + Intergenic
960698056 3:120414497-120414519 CAGCTCATTGAGAACGGGCCAGG + Intronic
960862380 3:122165410-122165432 CAGCTCATTGAGAACGGGCCAGG + Intergenic
961120073 3:124366692-124366714 CAGCTCATTGAGAACGGGCCAGG - Intronic
961729756 3:128955681-128955703 CAGCTCATTGAGAACGGGCCAGG + Intronic
962063345 3:131952748-131952770 CAGCTCATTGAGAACGGGCCAGG + Intronic
962112656 3:132470474-132470496 CAGCTCATTGAGAACGGGCCAGG - Intronic
962245315 3:133785719-133785741 CAGCTCATTGAGAACGGGCCAGG + Intronic
963770403 3:149380906-149380928 CAGCTCATTGAGAACGGGCCAGG + Intergenic
964003019 3:151799001-151799023 CACTTCATTGAGAAGCTGACAGG - Intergenic
966015007 3:175131630-175131652 CAGCTCATTGAGAACGGGCCAGG - Intronic
966360266 3:179121587-179121609 CAGCTCATTGAGAACGGGCCAGG + Intergenic
966375312 3:179290785-179290807 CAGCTCATTGAGAAAGGGCCAGG - Intergenic
966593415 3:181704948-181704970 CAGATTATTGACAAGCACCGTGG - Intergenic
967959543 3:194909525-194909547 CAGCTCATTGACAAACACCCGGG + Intergenic
968201722 3:196761644-196761666 CAGCTCATTGAGAACGGGCCAGG - Intronic
968666931 4:1827776-1827798 CAGCTCATTGAGAACGGGCCAGG - Intronic
970102236 4:12537798-12537820 AAGATCATTCAAAAGCAGCCAGG + Intergenic
970757124 4:19439924-19439946 CAGATCCTTTAGAAGCAGCATGG + Intergenic
972092028 4:35298841-35298863 CAGGGAATTGAGAAGCAGCCAGG - Intergenic
973281173 4:48363249-48363271 CAGCTCATTGAGAACGGGCCAGG - Intronic
973593924 4:52466093-52466115 CAGCTCATTGAGAACGGGCCAGG + Intergenic
973672646 4:53237327-53237349 CAGCTCATTGAGAACGGGCCAGG - Intronic
973784878 4:54325281-54325303 CAGCTCATTGAGAACGGGCCAGG - Intergenic
974184534 4:58429804-58429826 CAGATCATTGAGAAGCATCATGG - Intergenic
974661841 4:64900328-64900350 CAGCTCATTGAGAACGGGCCGGG + Intergenic
976265320 4:83182867-83182889 CAGCTCATTGAGAACGGGCCGGG + Intergenic
977205219 4:94158353-94158375 CAGCTCATTGAGAACGGGCCAGG + Intergenic
977971628 4:103219280-103219302 CAGAGCATAGAGAGGCAGCATGG + Intergenic
978518800 4:109597220-109597242 CAGCTCATTGAGAACGGGCCAGG - Intronic
979248353 4:118535458-118535480 CAGCTCATTGAGAACGGGCCAGG + Intergenic
980056304 4:128083304-128083326 CAGCTCATTGAGAACGGGCCAGG - Intronic
980895367 4:138854772-138854794 CAGCTCATTGAGAACGGGCCAGG + Intergenic
981523919 4:145693520-145693542 CAGCTCATTGAGAACGGGCCAGG - Intronic
981970873 4:150660575-150660597 CAGCTCATTGAGAACGGGCCAGG + Intronic
982025998 4:151254809-151254831 CAGCTCATTGAGAACGGGCCAGG - Intronic
982615570 4:157636312-157636334 CAGCTCATTGAGAACGGGCCAGG - Intergenic
982713083 4:158778141-158778163 AAGATCTCTGAGAAGCAGTCTGG - Intronic
983190250 4:164747238-164747260 CAGCTCATTGAGAACGGGCCAGG - Intergenic
984533716 4:180945443-180945465 CAGCTCATTGAGAACGGGCCAGG + Intergenic
984982032 4:185291594-185291616 CAGCGCATTCAGAAGCAGCGTGG - Intronic
985255719 4:188068230-188068252 CAGCTCATTGAGAATGGGCCAGG + Intergenic
985756983 5:1725092-1725114 CAGATCAGGGAGGAGCTGCCGGG - Intergenic
986014361 5:3744963-3744985 CAGATGATGGAGAACCAGCTCGG - Intergenic
986310568 5:6547803-6547825 CAGGTCATTTACAAGCAACCTGG + Intergenic
987267834 5:16276666-16276688 CAGCTCATTGAGAACGGGCCAGG - Intergenic
988134753 5:27156856-27156878 CACATGATGGAGAAGCAGCCTGG + Intergenic
988239950 5:28596726-28596748 CAGCTCATTGAGAACGGGCCGGG - Intergenic
988760077 5:34305502-34305524 CAGCTCATTGAGAACGGGCCAGG - Intergenic
990426583 5:55695755-55695777 CAGCTCATTGAGAACGGGCCAGG - Intronic
990458784 5:56014408-56014430 CAGCTCATTGAGAACGGGCCGGG - Intergenic
991707936 5:69377247-69377269 CAAATCAATGAGAAAAAGCCTGG - Intronic
992374262 5:76172553-76172575 CAGCTCATTGAGAACGGGCCAGG + Intronic
992469459 5:77042298-77042320 CAGCTCATTGAGAACGGGCCAGG - Intronic
992978479 5:82140730-82140752 CAGCTCATTGAGAACGGGCCAGG + Intronic
993413570 5:87600354-87600376 CAGAGCATTGAGAAGGAGCATGG - Intergenic
993657450 5:90594972-90594994 CAGCTCATTGAGAACGGGCCAGG - Intronic
995193994 5:109343013-109343035 CAGCTCATTGAGAACGGGCCAGG + Intronic
995516090 5:112955299-112955321 CAGCTCATTGAGAACGGGCCAGG + Intergenic
996069758 5:119121769-119121791 CAGCTCATTGAGAACGGGCCAGG - Intronic
997336061 5:133109281-133109303 CAGCTCATTGAGAACGGGCCAGG + Intergenic
997726410 5:136124042-136124064 AAGATCCTTGAGGATCAGCCAGG + Intergenic
998067655 5:139171207-139171229 CAGCTCATTGAGAACGGGCCGGG + Intronic
998431569 5:142075137-142075159 CAGCTCATTGAGAACGGGCCAGG - Intergenic
999580886 5:153036790-153036812 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1000718128 5:164672426-164672448 CAGATGCTTGAGAGGCAGGCCGG + Intergenic
1000963091 5:167623610-167623632 GAGAACAATGTGAAGCAGCCAGG - Intronic
1000985905 5:167860549-167860571 CAGCTCATTGAGAACGGGCCAGG + Intronic
1001077701 5:168643142-168643164 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1001393893 5:171403494-171403516 CAGCTCATTGAGAACGGGCCAGG - Intronic
1001818254 5:174689529-174689551 AAAATCATTGAGAAGCATCATGG + Intergenic
1002014240 5:176306419-176306441 CAGCTCATTGAGAACGGGCCAGG + Intronic
1002116280 5:176962654-176962676 CAGCTCATTGAGAACGGGCCAGG + Intronic
1002156470 5:177284889-177284911 CAGGAGTTTGAGAAGCAGCCTGG + Intronic
1002205423 5:177559954-177559976 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1002341295 5:178518384-178518406 CAGCTCATTGAGAACGGGCCAGG - Intronic
1002770935 6:290673-290695 CAGGTGACTGAGAAGCAGGCGGG + Intergenic
1003005811 6:2380491-2380513 CAGCCCATTGAGAAGCAGGAGGG - Intergenic
1003803769 6:9702120-9702142 CAGTTCACTGAGAATCAGCAGGG + Intronic
1004388560 6:15190077-15190099 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1004448636 6:15726045-15726067 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1004849160 6:19678517-19678539 CAGATCATTAAGAAGCAATATGG + Intergenic
1005606597 6:27484589-27484611 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1005644280 6:27826665-27826687 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1005899581 6:30205981-30206003 CATATGCTTGAGAAGCAGCTTGG - Intronic
1005929915 6:30475492-30475514 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1006040058 6:31244809-31244831 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1006064474 6:31454235-31454257 CAGCTCATTGAGAACGGGCCGGG - Intergenic
1006128192 6:31853771-31853793 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1006231805 6:32594670-32594692 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1006351738 6:33525655-33525677 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1006617674 6:35340822-35340844 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1006624105 6:35385142-35385164 CAGCTCATTGAGAACGGGCCAGG + Intronic
1007063346 6:38964184-38964206 CAGCTCATTGAGAACGGGCCAGG - Intronic
1008015260 6:46511436-46511458 CAGACCATTGGGATGTAGCCAGG + Intergenic
1010513373 6:76745004-76745026 CAGCTCATTGAGAACTGGCCAGG + Intergenic
1010761200 6:79725110-79725132 AATATCATTGAGCTGCAGCCGGG - Intergenic
1011404954 6:87009549-87009571 CAGCTCATTGAGAACGGGCCAGG - Intronic
1011588526 6:88948618-88948640 CAGCTCATTGAGAACGGGCCAGG + Intronic
1012295285 6:97514144-97514166 CAGATGCTTGTGAAGCAGCCTGG - Intergenic
1013326288 6:109047601-109047623 CAGCTCATTGAGAACGGGCCAGG + Intronic
1013679517 6:112508823-112508845 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1014530572 6:122554296-122554318 CAGATCATTGAGACAATGCCTGG - Intronic
1014556614 6:122848274-122848296 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1014983795 6:127978133-127978155 GAGGTCATTTAGAAGTAGCCAGG - Intronic
1015477035 6:133665690-133665712 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1016288868 6:142506282-142506304 CAGAGGATTGAGAGGCACCCTGG - Intergenic
1016348693 6:143144006-143144028 GAGATGATTGAGAAGCAACCTGG - Intronic
1016973347 6:149785895-149785917 CAGCTCATTGAGAACGGGCCAGG - Intronic
1017037627 6:150280624-150280646 CAGCTCATTAAGAAGGAGGCAGG + Intergenic
1017420005 6:154263733-154263755 CAGCTCATTGAGAACGGGCCAGG - Intronic
1017830899 6:158127503-158127525 CAGCTCATTGAGAACGGGCCAGG + Intronic
1017843177 6:158238915-158238937 CAGCTCATTGAGAACGGGCCAGG - Intronic
1018574429 6:165244384-165244406 CAGATCCTTGACATGTAGCCTGG - Intergenic
1019345226 7:526495-526517 CTGAGCTTTGAGAAGCAGCCAGG + Intergenic
1019439792 7:1039679-1039701 CAGCTCATTGAGAACGGGCCAGG + Intronic
1019669391 7:2269036-2269058 CAGCTCATTGAGAACGGGCCAGG + Intronic
1019674654 7:2303461-2303483 CAGCTCATTGAGAACAGGCCAGG + Intronic
1020498920 7:8890792-8890814 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1020616190 7:10465211-10465233 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1021872803 7:25019722-25019744 CAGCTCATTGAGAACAGGCCAGG + Intergenic
1022005585 7:26262526-26262548 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1022415278 7:30171951-30171973 CAGAGCAGTGAGCAGGAGCCTGG - Intergenic
1022944627 7:35270022-35270044 CAGGTCACTCAGAAGGAGCCAGG - Intergenic
1024595530 7:50932394-50932416 CAGATCACTGTGAAACAGGCTGG + Intergenic
1024988859 7:55219564-55219586 CAGCTCATTGAGAACGGGCCAGG - Intronic
1025162541 7:56675326-56675348 CATATCAGTGAAAAGCAGGCCGG + Intergenic
1025803413 7:64809072-64809094 CAGCTCATTGAGAACGGGCCAGG - Intronic
1026783136 7:73283776-73283798 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1026868552 7:73836789-73836811 CAGCTCATTGAGAACGAGCCAGG + Intronic
1027087576 7:75275235-75275257 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1027371441 7:77510085-77510107 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1029468419 7:100740788-100740810 CAGCTCATTGAGAACGGGCCAGG - Intronic
1029568898 7:101358485-101358507 CAGCTCATTGAGAACGGGCCGGG - Intergenic
1030603006 7:111610661-111610683 CAGCTCATTGAGAACGGGCCGGG + Intergenic
1030652267 7:112128424-112128446 CAGCTCATTGAGAACGGGCCAGG + Intronic
1031953999 7:127923437-127923459 CAAAGCATTGATAACCAGCCAGG + Intronic
1032694378 7:134321275-134321297 TGGTTCATTGAAAAGCAGCCAGG - Intergenic
1032923937 7:136580409-136580431 CAGATGCTTGTGAAGCAGCTGGG + Intergenic
1033114322 7:138611902-138611924 CAGCTCATTGAGAACGGGCCAGG + Intronic
1034200290 7:149279956-149279978 CAGCTCATTGAGAACGGGCCGGG - Intronic
1034234411 7:149555352-149555374 CAGCTCATTGAGAACGGGCCGGG + Intergenic
1034322700 7:150199112-150199134 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1034776166 7:153828702-153828724 CTGATAATTGAGAAGAAGCTAGG + Intergenic
1035507657 8:149334-149356 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1036286795 8:7449751-7449773 CAGCTCATTCAGAAGCACACTGG + Intronic
1036334683 8:7861772-7861794 CAGCTCATTCAGAAGCACACTGG - Intronic
1036482907 8:9153892-9153914 CAGCTCATTGAGAACGGGCCAGG - Intronic
1036506872 8:9364862-9364884 CAGCTCATTGAGAATGGGCCAGG - Intergenic
1036536454 8:9657108-9657130 CAGCTCATTGAGAACGGGCCAGG - Intronic
1037628842 8:20633829-20633851 CAGAGGATTCAGAATCAGCCTGG - Intergenic
1039201442 8:35097966-35097988 CAATTCAATGAGCAGCAGCCTGG + Intergenic
1039881071 8:41626198-41626220 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1040385035 8:46909355-46909377 CAGGGCATTAGGAAGCAGCCAGG + Intergenic
1040981973 8:53253104-53253126 CAGAGCATTGAGAAGCCCTCAGG + Intergenic
1041071011 8:54125947-54125969 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1041796268 8:61752360-61752382 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1041893874 8:62901971-62901993 CTGCTCAGTGAGAAGCAGACAGG + Intronic
1042049348 8:64686635-64686657 CAGCTCATTGAGAACGGGCCAGG + Intronic
1042303893 8:67311744-67311766 CAGCTCATTGAGAACGGGCCAGG + Intronic
1042319638 8:67461549-67461571 CAGCTCATTGAGAACGGGCCGGG - Intronic
1042475908 8:69246367-69246389 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1042892170 8:73624682-73624704 CAGTTCATTCAGAGGCAGCATGG - Intronic
1044661075 8:94591862-94591884 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1045671295 8:104556588-104556610 CAGATCAATAACAAGCAGCAAGG + Intronic
1045899144 8:107254813-107254835 CTGATCATGGACAAGCAGGCTGG - Intronic
1046419306 8:113958993-113959015 CAGATCACTGAGAAGCAAAGTGG - Intergenic
1046452250 8:114408550-114408572 CATATCAGGGAGAAACAGCCTGG - Intergenic
1046999353 8:120558128-120558150 CAGATCATTGGGAAGAATCTTGG - Intronic
1047267129 8:123316090-123316112 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1047448018 8:124937357-124937379 CACATGTTTGAGAAGCTGCCAGG - Intergenic
1047687676 8:127317387-127317409 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1047847634 8:128825469-128825491 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1048061485 8:130923625-130923647 CTGATCGTTGAGAAGATGCCAGG - Intronic
1048310578 8:133319588-133319610 CAGATTCTTGGGAATCAGCCAGG - Intergenic
1049337895 8:142096220-142096242 CAGAGCAGTGAGGAGGAGCCAGG - Intergenic
1050352393 9:4752859-4752881 CAGGACTTTGAGAACCAGCCTGG + Intergenic
1050558382 9:6808200-6808222 CAGCTCATTGAGAACGGGCCAGG + Intronic
1051277110 9:15407235-15407257 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1051661749 9:19433642-19433664 CAGCTCATTGAGAACGGGCCAGG - Intronic
1051823562 9:21194090-21194112 CATAGCATTGAGAAGGAGCACGG + Intergenic
1053255654 9:36614925-36614947 CAGCTCATTGAGAACGGGCCAGG - Intronic
1053457649 9:38243096-38243118 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1053468288 9:38325473-38325495 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1053634544 9:39983375-39983397 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1054209343 9:62267322-62267344 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1054950704 9:70848295-70848317 AAGATAAATGAGATGCAGCCAGG + Intronic
1055133760 9:72806032-72806054 CAGCTCATTGAGAATGGGCCCGG - Intronic
1055136904 9:72840079-72840101 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1055373261 9:75623716-75623738 CAGAGCATTGAGAGGGAGCATGG - Intergenic
1055414029 9:76063817-76063839 CAGCTCATTGAGAACGGGCCAGG - Intronic
1055948748 9:81711416-81711438 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1056152899 9:83804975-83804997 CAGCTCATTGAGAACGGGCCGGG + Intronic
1056670973 9:88626533-88626555 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1056779585 9:89539175-89539197 CAGAGCAAGGAGAGGCAGCCAGG - Intergenic
1057629298 9:96707325-96707347 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1058072144 9:100612175-100612197 TAGAACATTGAGCACCAGCCAGG - Intergenic
1058659447 9:107256542-107256564 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1058723220 9:107777785-107777807 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1059211502 9:112515391-112515413 CAGCTCATTGAGAACGGGCCAGG + Intronic
1059441902 9:114312528-114312550 CTGAGCTTTGAGAAGCAGCACGG - Intergenic
1059707701 9:116840364-116840386 CAGCTCATTGAGAACAGGCCAGG - Intronic
1060065492 9:120496917-120496939 CAGCTCATTGAGAACGGGCCAGG + Intronic
1060249247 9:121971576-121971598 CAGCTCATTGAGAACGGGCCAGG + Intronic
1060304924 9:122402768-122402790 CAGATCCTTGAGCATCAGCCTGG - Intergenic
1060442984 9:123658919-123658941 CTGAGCATTGAGATGCTGCCTGG - Intronic
1060651173 9:125328688-125328710 CAGCTCATTGAGAACGGGCCAGG - Intronic
1060669665 9:125458704-125458726 CAGCTCATTGAGAACAGGCCAGG - Intronic
1060703452 9:125779747-125779769 CAGCTCATTGAGAACGGGCCGGG - Intronic
1060759218 9:126234279-126234301 CAGAGCATGGAGGGGCAGCCAGG + Intergenic
1061982567 9:134115270-134115292 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1062593904 9:137288654-137288676 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1186787114 X:12963926-12963948 CAGCTCATTGAGAACGGGCCGGG + Intergenic
1187976277 X:24708873-24708895 CAGCTCATTGAGAACGGGCCAGG - Intronic
1188477553 X:30603387-30603409 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1188791839 X:34414625-34414647 CAGAGCATTGAGAGGGAGCAAGG + Intergenic
1189956065 X:46276149-46276171 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1190521263 X:51280476-51280498 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1190891414 X:54572493-54572515 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1191617868 X:63189099-63189121 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1191987766 X:67000891-67000913 CAGTTTTGTGAGAAGCAGCCTGG - Intergenic
1192369586 X:70502210-70502232 CAAATCATTGAGGACCAGTCTGG + Exonic
1192409990 X:70925631-70925653 GACATCATTTAGAAGCAGACGGG + Exonic
1192621684 X:72682431-72682453 CAGCTCATTGAGAACGGGCCAGG + Intronic
1192696549 X:73422236-73422258 CAGAGCATTGAGAAGAAACATGG - Intergenic
1192768999 X:74167636-74167658 CAGCTCATTGAGAACAGGCCGGG + Intergenic
1192969573 X:76217641-76217663 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1193132160 X:77931501-77931523 CAGCTCATTGAGAACGGGCCGGG - Intronic
1193283881 X:79688880-79688902 CAGGTCATTGGGGAGCAGTCTGG + Intergenic
1194508368 X:94761392-94761414 CAGATAATTGAGAAACAGGATGG + Intergenic
1195035926 X:100972217-100972239 CAGCTCATTGAGAACGGGCCAGG - Intronic
1195545791 X:106110963-106110985 CAGATCATTGGGTATCAGGCAGG - Intergenic
1196404160 X:115346986-115347008 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1199098431 X:143768628-143768650 CAGTCCTTTCAGAAGCAGCCAGG - Intergenic
1199202512 X:145109038-145109060 CAAATCATTGATAATCAGCTAGG - Intergenic
1199586584 X:149421276-149421298 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1200280527 X:154773789-154773811 CAGCTCATTGAGAACGGGCCAGG - Intronic