ID: 1161029083

View in Genome Browser
Species Human (GRCh38)
Location 19:2049762-2049784
Sequence CTGCTGCCCTAGGGGAAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 160}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161029068_1161029083 19 Left 1161029068 19:2049720-2049742 CCTCTTTCCCGCCCAGCCCCTGA 0: 1
1: 0
2: 8
3: 61
4: 555
Right 1161029083 19:2049762-2049784 CTGCTGCCCTAGGGGAAAACTGG 0: 1
1: 0
2: 0
3: 13
4: 160
1161029074_1161029083 3 Left 1161029074 19:2049736-2049758 CCCCTGACACTCTGATGGTGCCA 0: 1
1: 0
2: 2
3: 20
4: 198
Right 1161029083 19:2049762-2049784 CTGCTGCCCTAGGGGAAAACTGG 0: 1
1: 0
2: 0
3: 13
4: 160
1161029071_1161029083 8 Left 1161029071 19:2049731-2049753 CCCAGCCCCTGACACTCTGATGG 0: 1
1: 0
2: 0
3: 23
4: 244
Right 1161029083 19:2049762-2049784 CTGCTGCCCTAGGGGAAAACTGG 0: 1
1: 0
2: 0
3: 13
4: 160
1161029067_1161029083 22 Left 1161029067 19:2049717-2049739 CCTCCTCTTTCCCGCCCAGCCCC No data
Right 1161029083 19:2049762-2049784 CTGCTGCCCTAGGGGAAAACTGG 0: 1
1: 0
2: 0
3: 13
4: 160
1161029070_1161029083 11 Left 1161029070 19:2049728-2049750 CCGCCCAGCCCCTGACACTCTGA 0: 1
1: 1
2: 2
3: 55
4: 475
Right 1161029083 19:2049762-2049784 CTGCTGCCCTAGGGGAAAACTGG 0: 1
1: 0
2: 0
3: 13
4: 160
1161029073_1161029083 7 Left 1161029073 19:2049732-2049754 CCAGCCCCTGACACTCTGATGGT 0: 1
1: 0
2: 1
3: 12
4: 217
Right 1161029083 19:2049762-2049784 CTGCTGCCCTAGGGGAAAACTGG 0: 1
1: 0
2: 0
3: 13
4: 160
1161029076_1161029083 1 Left 1161029076 19:2049738-2049760 CCTGACACTCTGATGGTGCCAGG 0: 1
1: 0
2: 1
3: 15
4: 157
Right 1161029083 19:2049762-2049784 CTGCTGCCCTAGGGGAAAACTGG 0: 1
1: 0
2: 0
3: 13
4: 160
1161029075_1161029083 2 Left 1161029075 19:2049737-2049759 CCCTGACACTCTGATGGTGCCAG 0: 1
1: 0
2: 1
3: 16
4: 167
Right 1161029083 19:2049762-2049784 CTGCTGCCCTAGGGGAAAACTGG 0: 1
1: 0
2: 0
3: 13
4: 160
1161029069_1161029083 12 Left 1161029069 19:2049727-2049749 CCCGCCCAGCCCCTGACACTCTG 0: 1
1: 1
2: 7
3: 71
4: 595
Right 1161029083 19:2049762-2049784 CTGCTGCCCTAGGGGAAAACTGG 0: 1
1: 0
2: 0
3: 13
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161029083 Original CRISPR CTGCTGCCCTAGGGGAAAAC TGG Intronic
900337815 1:2173402-2173424 CTGCTGTCCTTGGGCAAAACGGG + Intronic
900363631 1:2301616-2301638 CTGCTTCCCTAGGGGGAAGATGG - Intronic
900639892 1:3683702-3683724 CTGCTGGACTATGGGAAAAGAGG - Intronic
901400534 1:9012391-9012413 ATCCTGCCCCAGGGGAAAACTGG + Intronic
902033877 1:13442403-13442425 GTGCTCCCCAAGGGAAAAACAGG + Intergenic
902285436 1:15405401-15405423 ATGCTGTCCTCAGGGAAAACAGG + Intergenic
902811326 1:18889603-18889625 GTGCTGCCCTCGGGGACAGCCGG + Intronic
905102444 1:35536569-35536591 CTGGTCACCTAGGTGAAAACAGG + Intronic
908683916 1:66692886-66692908 CTGATGCCACAGGTGAAAACAGG + Intronic
910973749 1:92883977-92883999 CTTCTGCCTTAGAGGAGAACTGG + Intronic
915248661 1:154573029-154573051 CAGCTGTCCTAGAGGAAACCTGG - Intronic
915310978 1:155005675-155005697 CTCCCGCCCTAGGCCAAAACAGG - Intronic
916434279 1:164762279-164762301 CTGATGCCCTAGGTCAATACAGG + Intronic
917747090 1:178020870-178020892 CTGCTGCCCTTGGTGTAATCGGG - Intergenic
920301262 1:204990469-204990491 CTGCAGCCCCAGGGGACAAAAGG + Intronic
922222376 1:223618543-223618565 ATGGTGCGCTAGGGGAACACGGG - Intronic
924450991 1:244178849-244178871 CTGCTCCACGACGGGAAAACAGG + Intergenic
1064156834 10:12909533-12909555 CTGTTGCCCAAGGGAAGAACAGG + Intronic
1068776653 10:60874709-60874731 CTGGTGCCTTAGGGGACAATGGG + Intronic
1069724940 10:70571493-70571515 CTGCTGCCCTGGTGGAGACCCGG + Intergenic
1072696092 10:97603939-97603961 ATGTTGCCATTGGGGAAAACTGG - Intronic
1073123472 10:101135541-101135563 CTGCTGGCCTAGGGGAGGAGAGG + Intronic
1075924074 10:126236257-126236279 CTGGTGCCCTGGGGGAAGGCTGG + Intronic
1076133671 10:128030214-128030236 CTGCTGCCCTGGCGAACAACGGG + Intronic
1076801741 10:132834200-132834222 CTGCTGCCTTAGAGTGAAACAGG - Intronic
1077353474 11:2103791-2103813 CTGCTGGCCCAGGGAAAATCTGG + Intergenic
1078553147 11:12294118-12294140 CTGCTGCCCTAGGGAGCAGCAGG - Exonic
1079241146 11:18723024-18723046 CTGTTGCCATATGGGAATACAGG - Intronic
1082321745 11:50820329-50820351 TTGATGCCCTAGGTGGAAACGGG + Intergenic
1083379632 11:62254767-62254789 CTGCTGCCCTATGTGAACTCTGG - Intergenic
1083380683 11:62265897-62265919 CTGCTGCCCTATGAGAACTCTGG - Intergenic
1084620988 11:70270406-70270428 CTGCAGCCGTGGGGGGAAACTGG + Intergenic
1084674171 11:70624561-70624583 CTGCTGCCTTAAGGGAAAGACGG - Intronic
1084751323 11:71205904-71205926 CTGCAGCCCTGGGGGGACACAGG - Intronic
1085016774 11:73178958-73178980 CTCCTGCCCTGGGGGAAGAGGGG - Intergenic
1088821800 11:113463060-113463082 CTGCTTCCCTGTGAGAAAACGGG + Intronic
1089781349 11:120875331-120875353 CTGCTGCTGTTGGGGATAACTGG - Intronic
1090418086 11:126554753-126554775 CTGCAGCCCTTAGTGAAAACAGG + Intronic
1093691754 12:22116471-22116493 CTGCAGCCCTAAGTGAGAACAGG - Intronic
1097205139 12:57314602-57314624 CTGCTAACCTCTGGGAAAACTGG + Intronic
1098002083 12:65955536-65955558 CTTCTACCCAAAGGGAAAACAGG + Intronic
1105839746 13:24243802-24243824 TTGGTACCCTAGGAGAAAACTGG + Intronic
1107531432 13:41285777-41285799 CTCCAGCCCAATGGGAAAACTGG + Intergenic
1109795180 13:67302192-67302214 AGGCAGCCCTAGGGGAAAAGTGG - Intergenic
1114189405 14:20429394-20429416 GTGCTGGCCTAAGGGAGAACAGG + Exonic
1118297306 14:64582238-64582260 CTGCTGCTCTAGGTGAAATCAGG - Intronic
1122018979 14:98820762-98820784 CTGATGCTCTTGGGGAAAATGGG - Intergenic
1123736720 15:23191677-23191699 CTGCTGTCCCAGTGGAAAAAGGG + Intergenic
1124287421 15:28414652-28414674 CTGCTGTCCCAGTGGAAAAAGGG + Intergenic
1124287945 15:28420355-28420377 CTGCTGTCCCAGTGGAAAAAGGG + Intergenic
1124295281 15:28496972-28496994 CTGCTGTCCCAGTGGAAAAAGGG - Intergenic
1124853761 15:33366933-33366955 CTCCATCTCTAGGGGAAAACAGG + Intronic
1127487442 15:59432404-59432426 GTGCTGTCCTTGGGGAAGACAGG + Intronic
1132925634 16:2427993-2428015 CCTCTGCCCTAGGGGGAGACAGG + Intergenic
1133923169 16:10172653-10172675 CTGTTGCCATAGGGGGAATCGGG + Intronic
1134232529 16:12439794-12439816 CTACTGCCCTAGCAGAAAAGTGG - Intronic
1134257169 16:12622029-12622051 CTGCTACCCCAGCAGAAAACTGG + Intergenic
1141361885 16:83403052-83403074 CTGAAGCCCAAGGGGCAAACTGG + Intronic
1141486883 16:84346262-84346284 CTGCTGCTCTAGAGAGAAACAGG + Intergenic
1143786328 17:9258526-9258548 CAGCTGCGCCAGGGGAAACCAGG + Intronic
1144209006 17:12999342-12999364 CTGCTTCCCAAGGGGGAAACAGG + Intronic
1153545770 18:6203647-6203669 CTCCTGCCCTAGGAGCAAACAGG + Intronic
1155910406 18:31498418-31498440 CTGCTGCCCGAGGGGGGAAAAGG + Intronic
1156348120 18:36276617-36276639 ATTTTGCCCAAGGGGAAAACTGG + Intergenic
1156381437 18:36565056-36565078 CAGTTGCCCTTGGGGAAAACTGG + Intronic
1157406511 18:47426431-47426453 ATGCTGACCTAGAGTAAAACTGG - Intergenic
1157528836 18:48405625-48405647 CAGCTGCCCTAGGGGAATTTAGG - Intronic
1160146711 18:76371429-76371451 CTGCTCCCCTTGGGGATAGCTGG + Intronic
1160994295 19:1875469-1875491 CCTCTGCCCCAGGGGAGAACTGG + Intergenic
1161029083 19:2049762-2049784 CTGCTGCCCTAGGGGAAAACTGG + Intronic
1161607955 19:5225208-5225230 CTGGTGCAGTAGGGGAAGACAGG + Intronic
1164630769 19:29760213-29760235 CTCCTGCCCAAGGGCAAGACTGG + Intergenic
1164746539 19:30620229-30620251 GTGCTGCCATAAGGGAAAGCTGG + Intronic
1165278376 19:34774181-34774203 CTGCAGCCCTAAGGGAAGAGTGG + Intergenic
1168330452 19:55564679-55564701 CTGGTGCCCAAGGGGAAGCCGGG - Intergenic
928224738 2:29438906-29438928 CTGGAGCCCTAGGGAAGAACTGG - Intronic
929547677 2:42866385-42866407 CTGCTCCCATGGGGGAAAACAGG - Intergenic
930753529 2:54954269-54954291 CTGCTGGGCAAGTGGAAAACAGG + Intronic
937631692 2:124109196-124109218 CTGATGTCCCAGGGGAAAAAGGG + Intronic
937752257 2:125490392-125490414 CTGTGGCCAGAGGGGAAAACTGG - Intergenic
942017271 2:171829570-171829592 CTGCTTCCCTAAGGGATAGCAGG - Intronic
943120057 2:183724431-183724453 CTGCTGCCTTAGGAGAATTCAGG + Intergenic
945928262 2:215828603-215828625 ATGCTGCCCTAGGGGAAGGAGGG - Intergenic
946295105 2:218777789-218777811 CTGCTGCCCTTGGGCAACATGGG + Intergenic
1169799496 20:9500374-9500396 CTGCTGGCCTGGGGGAAGGCTGG - Intergenic
1170455673 20:16530599-16530621 CTGCAGCGCTAGGGGAGAGCCGG + Intronic
1172554913 20:35832429-35832451 CTGCTTCCCCAGGAGACAACAGG - Intronic
1173095334 20:40022476-40022498 ATGCTGCCACAGAGGAAAACTGG + Intergenic
1175507434 20:59495796-59495818 CTGCCCCCCTAGGGGACAACTGG + Intergenic
1175567672 20:59993808-59993830 GTGTTGCCCCTGGGGAAAACTGG - Intronic
1176429850 21:6568806-6568828 ATGATGCCCAAGGTGAAAACGGG - Intergenic
1179705244 21:43176268-43176290 ATGATGCCCAAGGTGAAAACGGG - Intergenic
1180042872 21:45288748-45288770 CTGGTGCCCTCGGGGAACAGCGG - Intergenic
1182523981 22:30904094-30904116 CTGCTCCCCAAAGGGAAGACTGG - Intronic
1184701303 22:46175211-46175233 ATGTTACCCTTGGGGAAAACTGG - Intronic
1184998532 22:48227679-48227701 AGGCTCCCCTAGGGGAAAAAGGG - Intergenic
1185205990 22:49539042-49539064 TTGCTGCCCTGGGAGAAAGCTGG - Intronic
949464718 3:4332791-4332813 CTGCGGCCCTAAGTGAGAACAGG + Intronic
949469975 3:4384334-4384356 ATGTTGCCATTGGGGAAAACTGG - Intronic
951032009 3:17893081-17893103 CACCTTCACTAGGGGAAAACAGG - Intronic
951693460 3:25421040-25421062 CTGCTGCCCCTGTGGAAGACAGG - Intronic
951738778 3:25897162-25897184 CTGCTGCCAGAGTGGAATACTGG - Intergenic
951964961 3:28371820-28371842 CTCCAGGCCTAGGGGAAAAGAGG + Intronic
954637636 3:52079854-52079876 CTGCTGACCTTGGAGAAACCAGG + Intronic
956557985 3:70542629-70542651 CTCCTGACATGGGGGAAAACAGG + Intergenic
960125646 3:113995554-113995576 GTGCTGACCTAGGGAAAAATAGG + Intronic
963851072 3:150210965-150210987 CTGCTGCCCCAAGGGCAAAATGG - Intergenic
967878456 3:194282265-194282287 CTGTTGCCGTAGGTGAAAAGAGG + Intergenic
968069025 3:195774407-195774429 CTGGGGCCCTCGGGGAACACAGG - Intronic
968592542 4:1466174-1466196 CTGCTGCACTTGGAGCAAACTGG - Intergenic
969496924 4:7531515-7531537 CTGATGACCTGGGGGAAAAGGGG - Exonic
970188325 4:13484997-13485019 CTGCTGCCTTAGGGTAAAGATGG - Intergenic
971705053 4:30030729-30030751 CTGCTGACTTCGGGGAAAAGTGG + Intergenic
972783444 4:42305965-42305987 CTACAGCACTAGGGGAAAAGAGG - Intergenic
977358835 4:95980054-95980076 CTGCTGCCCTGGGGGCCACCAGG + Intergenic
978717531 4:111864107-111864129 CAGCTGCTGTAGGGGAAAATGGG + Intergenic
983476870 4:168223133-168223155 TTGATGGCCTGGGGGAAAACGGG + Intronic
983802385 4:171949143-171949165 CTGATGGCCTTGGGGAAAGCAGG + Intronic
985771365 5:1813802-1813824 CTGTGGCCCAAGGGGAAAGCCGG + Intronic
986242166 5:5970918-5970940 CTGCAGCCAGAGGGGAGAACAGG - Intergenic
992178005 5:74169823-74169845 CTCCTGCCATATGGGAAAAGAGG - Intergenic
992884625 5:81145738-81145760 CTGCAGCCCTAGTGGACACCTGG + Intronic
995221613 5:109654747-109654769 CTGCTGCCCGAAGGGAAGAGAGG + Intergenic
999496199 5:152100858-152100880 CTGTTCCCCAAAGGGAAAACAGG + Intergenic
1003146273 6:3513012-3513034 CTGGTGGCCTGGGGGATAACTGG + Intergenic
1003528354 6:6917101-6917123 CTGCTGCCCTGGTGGGAAGCTGG + Intergenic
1004571155 6:16846610-16846632 CTTCTGCCCTAGGGAAAAAATGG - Intergenic
1006003934 6:30987840-30987862 CTGCTGACCTGCGGGAAAAGGGG + Intronic
1006680135 6:35791162-35791184 CCGCTGCCCTATGGGAAAAGTGG + Intronic
1006976322 6:38105688-38105710 ATGTTACCCTTGGGGAAAACTGG + Intronic
1007034304 6:38658981-38659003 CTGCTGTCCTAGGGTAGAAGTGG + Intergenic
1007101626 6:39251650-39251672 CTGTTGCCCTGGGGGAGAAGGGG + Intergenic
1010665902 6:78629591-78629613 CAGCTGCCCTGTGGGAAAAGCGG - Intergenic
1019435448 7:1020100-1020122 CTGCTGCTCTGCGGGAACACGGG + Intronic
1021190800 7:17617671-17617693 CTGCTGCACTAGGGTAAATAGGG + Intergenic
1022108127 7:27211182-27211204 CTGCTCCCCTAGGGAGAAAGGGG + Intergenic
1022144294 7:27521828-27521850 CTGCTGCCCTAGATAAGAACTGG + Intergenic
1023725886 7:43142338-43142360 AAGCTGCCCTAGGGGAACACTGG - Intronic
1024648133 7:51385593-51385615 CTGCTGTGCTGGGGGAAAGCTGG + Intergenic
1028553292 7:92095496-92095518 CCTCTTCCCTAGGAGAAAACAGG - Intronic
1028669959 7:93390487-93390509 ATGTTGCCATTGGGGAAAACTGG + Intergenic
1029126341 7:98297389-98297411 CTGCAGCCCAAGGGAAAAAGTGG - Intronic
1029504099 7:100951634-100951656 CTGCTCCCCTAGGAGCAGACAGG + Intronic
1030319181 7:108146277-108146299 CTGCTGCAACAGGGGAAAATGGG - Intergenic
1032410442 7:131690314-131690336 CTGCTGCCCTAGGGCCAGAGGGG - Intergenic
1033033076 7:137846247-137846269 CTCCTGCCACAGGGGAAAGCAGG + Intronic
1033416693 7:141167836-141167858 CTGCTTCCCTGGGGCACAACGGG - Intronic
1035715918 8:1754848-1754870 CTGGTGCCCTGGGGTCAAACAGG + Intergenic
1036051209 8:5200247-5200269 CTTGTGCCCGAGGAGAAAACTGG + Intergenic
1038102634 8:24395968-24395990 CTGCTGCTCTAGGAGAAGTCAGG + Intronic
1038931917 8:32202915-32202937 CTGCAGCCCTAAGTGAGAACAGG - Intronic
1039896596 8:41720833-41720855 CAGCTACCCTAGGGGAACCCAGG + Intronic
1041400023 8:57432953-57432975 CTGCTGCCCTAGAGAAATGCAGG + Intergenic
1043421380 8:80102194-80102216 CTGCAACCCCAGGGGAAATCCGG - Intronic
1043922325 8:85997434-85997456 ATGATGACCAAGGGGAAAACTGG + Intronic
1045193233 8:99904144-99904166 CTGCTGACCTAGGGGAACGCTGG + Intergenic
1049388550 8:142356419-142356441 CTGCTGCCCCAGGGGAGAGTGGG + Intronic
1049415522 8:142493174-142493196 CTGCTGCCCTGGAGGACAAAGGG - Intronic
1049933448 9:477900-477922 CAGGTGCCCTGGTGGAAAACTGG + Intronic
1053174725 9:35914530-35914552 CTCCTGCCCTTGGGGACAATAGG - Intergenic
1053563073 9:39216333-39216355 CAGCTGCCCCTGTGGAAAACTGG + Intronic
1053828863 9:42054277-42054299 CAGCTGCCCCTGTGGAAAACTGG + Intronic
1054134074 9:61402722-61402744 CAGCTGCCCCTGTGGAAAACTGG - Intergenic
1054601696 9:67133175-67133197 CAGCTGCCCCTGTGGAAAACTGG - Intergenic
1060037478 9:120268533-120268555 ATGCTGCCATTGGGGGAAACTGG + Intergenic
1060040117 9:120293131-120293153 CTACTTCCCCAGGGGCAAACAGG - Intergenic
1060146777 9:121259871-121259893 CTTCAGCTCTAGGGAAAAACAGG + Intronic
1186047458 X:5551999-5552021 CTGCTGACCTAAGTGATAACAGG + Intergenic
1186473071 X:9836226-9836248 CAGCTGCCCTTGGGTAAAAGTGG + Intronic
1188741656 X:33790760-33790782 CTCCTGTCCCAGGGAAAAACTGG + Intergenic
1189245166 X:39557705-39557727 CTGGTGGCCTAGAGGGAAACAGG + Intergenic
1192363995 X:70455772-70455794 CTGCAGCCCTAGGGGACAAAGGG - Intronic
1194600989 X:95921530-95921552 ATGCTGCCCTGTGGAAAAACAGG - Intergenic
1199577407 X:149326254-149326276 CTGCTGGCCAAAGTGAAAACTGG + Intergenic