ID: 1161036564

View in Genome Browser
Species Human (GRCh38)
Location 19:2088206-2088228
Sequence GGCTGATTAGTCTCTGGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 194}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161036564_1161036573 2 Left 1161036564 19:2088206-2088228 CCCACCCCAGAGACTAATCAGCC 0: 1
1: 0
2: 0
3: 12
4: 194
Right 1161036573 19:2088231-2088253 GAATGTCCACAGTGCCGAGGGGG 0: 1
1: 0
2: 5
3: 35
4: 139
1161036564_1161036572 1 Left 1161036564 19:2088206-2088228 CCCACCCCAGAGACTAATCAGCC 0: 1
1: 0
2: 0
3: 12
4: 194
Right 1161036572 19:2088230-2088252 TGAATGTCCACAGTGCCGAGGGG 0: 1
1: 0
2: 0
3: 12
4: 104
1161036564_1161036577 29 Left 1161036564 19:2088206-2088228 CCCACCCCAGAGACTAATCAGCC 0: 1
1: 0
2: 0
3: 12
4: 194
Right 1161036577 19:2088258-2088280 AGCTTGTCCTGCGAGTGGCAAGG 0: 1
1: 0
2: 0
3: 2
4: 94
1161036564_1161036570 -1 Left 1161036564 19:2088206-2088228 CCCACCCCAGAGACTAATCAGCC 0: 1
1: 0
2: 0
3: 12
4: 194
Right 1161036570 19:2088228-2088250 CTTGAATGTCCACAGTGCCGAGG 0: 1
1: 0
2: 1
3: 18
4: 142
1161036564_1161036571 0 Left 1161036564 19:2088206-2088228 CCCACCCCAGAGACTAATCAGCC 0: 1
1: 0
2: 0
3: 12
4: 194
Right 1161036571 19:2088229-2088251 TTGAATGTCCACAGTGCCGAGGG No data
1161036564_1161036576 24 Left 1161036564 19:2088206-2088228 CCCACCCCAGAGACTAATCAGCC 0: 1
1: 0
2: 0
3: 12
4: 194
Right 1161036576 19:2088253-2088275 GACAAAGCTTGTCCTGCGAGTGG 0: 1
1: 0
2: 0
3: 8
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161036564 Original CRISPR GGCTGATTAGTCTCTGGGGT GGG (reversed) Intronic
902954414 1:19915229-19915251 GGCTTTTTAGTGTCTGGAGTTGG + Intergenic
906095127 1:43217721-43217743 GGATGATGAGTTGCTGGGGTGGG - Intronic
923937827 1:238783638-238783660 GGCTGATGGGTCTCTGGGTCTGG + Intergenic
1067893913 10:50159685-50159707 CACTGATTATTCTCTTGGGTTGG - Intergenic
1067909504 10:50331884-50331906 GGCTGATTAGTATCTAGTGAGGG - Intronic
1074425550 10:113348048-113348070 GGCTGATTGGTCTCTGTCATAGG + Intergenic
1076705598 10:132299713-132299735 GGCTGATAAGTCACTAGTGTAGG + Intronic
1079330015 11:19525569-19525591 GGCTGGGTAGTCCCTGAGGTAGG + Intronic
1079920456 11:26427612-26427634 TGCTGATTAGTCACTGGTTTTGG - Intronic
1080687911 11:34530787-34530809 GATGGATGAGTCTCTGGGGTTGG + Intergenic
1082123831 11:48409106-48409128 GGCAGAGTGGTATCTGGGGTTGG - Intergenic
1084209013 11:67612362-67612384 GGCGGATCAGACCCTGGGGTCGG - Exonic
1088480738 11:110294604-110294626 GTCTCATTAGTCTCCGGGATGGG - Intronic
1089698713 11:120231314-120231336 GGCTCCTTAGTCTCAGGGGATGG + Intergenic
1092290471 12:7157101-7157123 GGCTGAGTGGTCTCTGGGGAAGG + Intronic
1093196428 12:16135005-16135027 TGCTGATTTATCTCAGGGGTAGG - Intergenic
1097052268 12:56230637-56230659 GGTTCACTGGTCTCTGGGGTAGG - Exonic
1100734867 12:97515736-97515758 GGGTGATAAGTCCCAGGGGTGGG + Intergenic
1104877344 12:132044881-132044903 GGCAGCTTAGCCTCTGGGATGGG - Exonic
1112159058 13:96849481-96849503 GGCTGATTTATTTCTAGGGTAGG - Intergenic
1114278741 14:21170441-21170463 GGGTGATAAGTGTGTGGGGTAGG - Intergenic
1115671973 14:35623559-35623581 GGGTGATTAGTATCTGGTGATGG + Intronic
1120210672 14:81630588-81630610 GGCTTATTAGTCTCTGAGGGAGG + Intergenic
1122181070 14:99955099-99955121 GGCTGATGAGCCTGTGAGGTGGG - Intergenic
1131390408 15:92043524-92043546 GCATGTTTAGGCTCTGGGGTTGG - Intronic
1131879927 15:96851709-96851731 GGCTCATGAGGCTCTGGGATAGG + Intergenic
1132981504 16:2740602-2740624 GGATGAGGAGTCTCTGGGGATGG - Intergenic
1135837350 16:25838594-25838616 GGCTATTTAGGATCTGGGGTGGG + Intronic
1139429996 16:66905979-66906001 AGCTGATTGGTCTCTAGGCTTGG - Intergenic
1142226395 16:88879818-88879840 GGCTGACCAGGCCCTGGGGTGGG - Intronic
1144505687 17:15828534-15828556 TGCTTATTACTCTCTGAGGTGGG + Intergenic
1145117668 17:20226523-20226545 TGCTTATTACTCTCTGAGGTAGG + Intronic
1145169859 17:20646468-20646490 TGCTTATTACTCTCTGAGGTGGG + Intergenic
1147142684 17:38468216-38468238 GTCTCATTAGTCACTGGGGTTGG + Intronic
1149010043 17:51846779-51846801 GGCTGATTTGTGTCTGTGCTGGG + Intronic
1150925123 17:69524823-69524845 AGCTCAATAGTCTCTGGGGATGG - Intronic
1151111962 17:71689074-71689096 AGATGATTAGTCTCTGGGTTAGG - Intergenic
1151192171 17:72406640-72406662 GGCAGATTCCTCTCTGGGGAGGG - Intergenic
1151707069 17:75774725-75774747 GACTGATCAGTGCCTGGGGTGGG + Intergenic
1152932221 17:83115760-83115782 GGCTGAGGGGTCTCTGTGGTTGG + Intergenic
1153653153 18:7259330-7259352 GGCAGATTAGTGTCTGGTGTGGG - Intergenic
1155932763 18:31724332-31724354 GGCGGCTTAGCCTCTGGAGTGGG + Intergenic
1160677396 19:398779-398801 AGCTGATCATTCCCTGGGGTGGG + Intergenic
1160996234 19:1883344-1883366 GCCTGATCATTCTTTGGGGTGGG - Intronic
1161036564 19:2088206-2088228 GGCTGATTAGTCTCTGGGGTGGG - Intronic
1161050388 19:2160793-2160815 GCCAGATTGTTCTCTGGGGTGGG + Intronic
1161138423 19:2634246-2634268 GCCCGATTGTTCTCTGGGGTGGG + Intronic
1161138574 19:2635054-2635076 GCCGGATTGTTCTCTGGGGTGGG + Intronic
1161139161 19:2637699-2637721 GCCTGATGATTCTCTGGGGTGGG + Intronic
1161141988 19:2653603-2653625 GCCGGATCATTCTCTGGGGTGGG + Intronic
1161143556 19:2663856-2663878 GCTTGATTATTCTCTGGGGTGGG + Intronic
1161286263 19:3469926-3469948 TGTGGATCAGTCTCTGGGGTGGG - Intergenic
1161494590 19:4580504-4580526 CGCTGATTGGTCCCCGGGGTGGG - Intergenic
1161542585 19:4861066-4861088 GGATGATTTGGCTCAGGGGTTGG + Intronic
1161552875 19:4923803-4923825 GTCTGATCACTCTCTGGGGTGGG - Intronic
1162374329 19:10296012-10296034 GGCTGGGTTCTCTCTGGGGTCGG + Intronic
1162503434 19:11067947-11067969 GGCTGTTTTGTGTTTGGGGTGGG - Intergenic
1163414690 19:17179075-17179097 GCCAGATCATTCTCTGGGGTGGG + Intronic
1163688192 19:18724214-18724236 AGCTGATCAGTCTGTGGGGTGGG + Intronic
1164033871 19:21436209-21436231 TCCTGATTAGTTTCAGGGGTTGG + Intronic
1165709974 19:38004031-38004053 GGCTGATTGCTCACTGGGATTGG + Intronic
1166167619 19:41003356-41003378 GGATGATTCGTGTCCGGGGTGGG + Intronic
1166414322 19:42582379-42582401 GGCTGTATGTTCTCTGGGGTAGG + Intronic
1167140871 19:47649850-47649872 AGCTGCTTAGACTTTGGGGTAGG + Intronic
1167422128 19:49410052-49410074 GGCAGGTCAGTCCCTGGGGTAGG - Intronic
1168282814 19:55314607-55314629 GACTCAGTAGTCTCTTGGGTGGG - Intronic
925981356 2:9179997-9180019 GGAGGATTAGTCACTGGGGCAGG + Intergenic
926298189 2:11583282-11583304 GGCTGCTTAGCCTCTGTGGGGGG + Intronic
926785972 2:16518827-16518849 AGTTGATTAGTCTCCAGGGTGGG + Intergenic
929070797 2:38028918-38028940 GGCAGATTTGACTCTGGGGATGG - Intronic
931714038 2:65014462-65014484 GGCTGATCAGTCTTTGTGGGAGG + Intronic
932335848 2:70930996-70931018 GCCTGATGAGTTTCTGGAGTGGG + Intronic
932501230 2:72184205-72184227 GTCTGACTAATCCCTGGGGTGGG - Intronic
932593793 2:73081887-73081909 AGATGATTTCTCTCTGGGGTTGG - Intronic
934750584 2:96791323-96791345 GGCTGATTAGATTTTGGGGGTGG + Intronic
935160288 2:100523922-100523944 GGCTGCATGGTCTCTGGGGAGGG - Intergenic
935657965 2:105441132-105441154 AGCTGGCTAGTCTCTGAGGTAGG - Intergenic
937477668 2:122229598-122229620 GGCTTTTTAGTCCCTGAGGTTGG - Intergenic
937886100 2:126900960-126900982 GGCTGACAAGCCTCTGGGGTGGG - Intronic
938645704 2:133327966-133327988 GGCTCAATAATCTCTGCGGTGGG - Intronic
938711793 2:133981491-133981513 GGCTATTTAGGCTCTGGGGAAGG + Intergenic
939891124 2:147737622-147737644 TGATGAGTATTCTCTGGGGTGGG - Intergenic
942925369 2:181425866-181425888 CCCTGATTTGTCTCTTGGGTTGG - Intergenic
948905097 2:240976141-240976163 CCCTGCTCAGTCTCTGGGGTAGG + Intronic
948905107 2:240976186-240976208 CCCTGCTCAGTCTCTGGGGTAGG + Intronic
948905118 2:240976231-240976253 CCCTGCTCAGTCTCTGGGGTAGG + Intronic
948905129 2:240976276-240976298 CCCTGCTCAGTCTCTGGGGTAGG + Intronic
948905140 2:240976321-240976343 CCCTGCTCAGTCTCTGGGGTAGG + Intronic
948905151 2:240976366-240976388 CCCTGCTCAGTCTCTGGGGTAGG + Intronic
948905162 2:240976411-240976433 CCCTGCTCAGTCTCTGGGGTAGG + Intronic
948905173 2:240976456-240976478 CCCTGCTCAGTCTCTGGGGTAGG + Intronic
948905184 2:240976501-240976523 CCCTGCTCAGTCTCTGGGGTAGG + Intronic
948905206 2:240976591-240976613 CCCTGCTCAGTCTCTGGGGTAGG + Intronic
948905228 2:240976681-240976703 CCCTGCTCAGTCTCTGGGGTAGG + Intronic
948905263 2:240976816-240976838 CCCTGCTCAGTCTCTGGGGTAGG + Intronic
948905274 2:240976861-240976883 CCCTGCTCAGTCTCTGGGGTAGG + Intronic
948905284 2:240976906-240976928 CCCTGCTCAGTCTCTGGGGTAGG + Intronic
948905295 2:240976951-240976973 CCCTGCTCAGTCTCTGGGGTAGG + Intronic
948905306 2:240976996-240977018 CCCTGCTCAGTCTCTGGGGTAGG + Intronic
948905352 2:240977176-240977198 CCCTGCTCAGTCTCTGGGGTAGG + Intronic
948905363 2:240977221-240977243 CCCTGCTCAGTCTCTGGGGTAGG + Intronic
948905374 2:240977266-240977288 CCCTGCTCAGTCTCTGGGGTAGG + Intronic
948905385 2:240977311-240977333 CCCTGCTCAGTCTCTGGGGTAGG + Intronic
948905395 2:240977356-240977378 CCCTGCTCAGTCTCTGGGGTAGG + Intronic
948905406 2:240977401-240977423 CCCTGCTCAGTCTCTGGGGTAGG + Intronic
948905439 2:240977536-240977558 CCCTGCTCAGTCTCTGGGGTAGG + Intronic
948905506 2:240977806-240977828 CCCTGCTCAGTCTCTGGGGTAGG + Intronic
948905517 2:240977851-240977873 CCCTGCTCAGTCTCTGGGGTAGG + Intronic
948905539 2:240977941-240977963 CCCTGCTCAGTCTCTGGGGTAGG + Intronic
948905561 2:240978031-240978053 CCCTGCTCAGTCTCTGGGGTAGG + Intronic
948905596 2:240978166-240978188 CCCTGCTCAGTCTCTGGGGTAGG + Intronic
948905607 2:240978211-240978233 CCCTGCTCAGTCTCTGGGGTAGG + Intronic
948905618 2:240978256-240978278 CCCTGCTCAGTCTCTGGGGTAGG + Intronic
948905642 2:240978346-240978368 CCCTGCTCAGTCTCTGGGGTAGG + Intronic
948905652 2:240978391-240978413 CCCTGCTCAGTCTCTGGGGTAGG + Intronic
948905673 2:240978481-240978503 CCCTGCTCAGTCTCTGGGGTAGG + Intronic
948905684 2:240978526-240978548 CCCTGCTCAGTCTCTGGGGTAGG + Intronic
948905718 2:240978661-240978683 CCCTGCTCAGTCTCTGGGGTAGG + Intronic
948905761 2:240978841-240978863 CCCTGCTCAGTCTCTGGGGTAGG + Intronic
948905783 2:240978931-240978953 CCCTGCTCAGTCTCTGGGGTAGG + Intronic
948905806 2:240979021-240979043 CCCTGCTCAGTCTCTGGGGTAGG + Intronic
948905817 2:240979066-240979088 CCCTGCTCAGTCTCTGGGGTAGG + Intronic
948905828 2:240979111-240979133 CCCTGCTCAGTCTCTGGGGTAGG + Intronic
948905839 2:240979156-240979178 CCCTGCTCAGTCTCTGGGGTAGG + Intronic
948905849 2:240979201-240979223 CCCTGCTCAGTCTCTGGGGTAGG + Intronic
948905860 2:240979246-240979268 CCCTGCTCAGTCTCTGGGGTAGG + Intronic
948905893 2:240979381-240979403 CCCTGCTCAGTCTCTGGGGTAGG + Intronic
948905915 2:240979471-240979493 CCCTGCTCAGTCTCTGGGGTAGG + Intronic
948905961 2:240979651-240979673 CCCTGCTCAGTCTCTGGGGTAGG + Intronic
948905972 2:240979696-240979718 CCCTGCTCAGTCTCTGGGGTAGG + Intronic
948905983 2:240979741-240979763 CCCTGCTCAGTCTCTGGGGTAGG + Intronic
948905994 2:240979786-240979808 CCCTGCTCAGTCTCTGGGGTAGG + Intronic
948906004 2:240979831-240979853 CCCTGCTCAGTCTCTGGGGTAGG + Intronic
948906015 2:240979876-240979898 CCCTGCTCAGTCTCTGGGGTAGG + Intronic
948906061 2:240980056-240980078 CCCTGCTCAGTCTCTGGGGTAGG + Intronic
948906072 2:240980101-240980123 CCCTGCTCAGTCTCTGGGGTAGG + Intronic
948906083 2:240980146-240980168 CCCTGCTCAGTCTCTGGGGTAGG + Intronic
948906104 2:240980236-240980258 CCCTGCTCAGTCTCTGGGGTAGG + Intronic
948906115 2:240980281-240980303 CCCTGCTCAGTCTCTGGGGTAGG + Intronic
948906138 2:240980371-240980393 CCCTGCTCAGTCTCTGGGGTAGG + Intronic
948906149 2:240980416-240980438 CCCTGCTCAGTCTCTGGGGTAGG + Intronic
948906160 2:240980461-240980483 CCCTGCTCAGTCTCTGGGGTAGG + Intronic
948906194 2:240980596-240980618 CCCTGCTCAGTCTCTGGGGTAGG + Intronic
948906237 2:240980776-240980798 CCCTGCTCAGTCTCTGGGGTAGG + Intronic
948906259 2:240980866-240980888 CCCTGCTCAGTCTCTGGGGTAGG + Intronic
948906292 2:240981001-240981023 CCCTGCTCAGTCTCTGGGGTAGG + Intronic
948906313 2:240981091-240981113 CCCTGCTCAGTCTCTGGGGTAGG + Intronic
948906324 2:240981136-240981158 CCCTGCTCAGTCTCTGGGGTAGG + Intronic
948906335 2:240981181-240981203 CCCTGCTCAGTCTCTGGGGTAGG + Intronic
948906346 2:240981226-240981248 CCCTGCTCAGTCTCTGGGGTAGG + Intronic
1169289432 20:4336010-4336032 GGCTGAATTGTCTCTAGTGTAGG - Intergenic
1173123707 20:40317443-40317465 GGCTGATTATTCCCTGTGATGGG - Intergenic
1173473837 20:43344607-43344629 GGTGGATCTGTCTCTGGGGTTGG - Intergenic
1177587089 21:23111072-23111094 GGCTGATGATTCCCTGAGGTAGG - Intergenic
1180074343 21:45455186-45455208 GGCTGCTGAGTCTCTGGATTGGG - Intronic
1181287612 22:21765622-21765644 GGCTGATTAAACTATGGGATAGG - Intronic
1181436656 22:22914977-22914999 GGCTGATGGGTCTCTGTGGGAGG + Intergenic
1182023096 22:27097645-27097667 GGCTGATCAATATCTGGGGAGGG + Intergenic
1183721296 22:39563013-39563035 GGCAGATGAGGCTCAGGGGTGGG + Intergenic
1184641256 22:45871639-45871661 GGCATATTTGTGTCTGGGGTTGG + Intergenic
953453805 3:43025748-43025770 GGCTGATTAGTCACTGCATTCGG + Intronic
954593030 3:51800518-51800540 GGCTGAGTAGTCTGTGCTGTGGG + Intergenic
955357299 3:58241691-58241713 GCCTGAGTAGTCTCTGGGCAGGG - Intronic
955735123 3:62030830-62030852 GGCTGATTTGCCTCTGGAATGGG + Intronic
956778737 3:72587850-72587872 GGTTGATCAGTCGCTGGGGGTGG + Intergenic
958772391 3:98441074-98441096 GTCTGATTTGTCTCTGTGCTTGG + Intergenic
963310679 3:143706977-143706999 GGCTGGTTAGTGAATGGGGTGGG + Intronic
964337012 3:155665647-155665669 GGCTGATCAGACTCTAGGGGTGG - Intronic
965581374 3:170271728-170271750 GTTTGATTAGATTCTGGGGTTGG + Intronic
967982802 3:195075880-195075902 GGCTGAGTGGGCACTGGGGTTGG + Intronic
968494840 4:909937-909959 GGCCGAGAAGTCTCGGGGGTTGG - Intronic
968891487 4:3371726-3371748 GGCTGGAAAGCCTCTGGGGTCGG + Intronic
969877741 4:10148454-10148476 GGATGATTCTTCACTGGGGTTGG + Intergenic
970342781 4:15124230-15124252 GGCTGATTAGAATGTGGGCTAGG - Intergenic
970363702 4:15336858-15336880 GGTTGCTTACTCTCAGGGGTTGG - Intergenic
970424089 4:15930488-15930510 GGCTGATAATTCCCTGGAGTAGG - Intergenic
972045889 4:34664239-34664261 GGCTGGTCAGACCCTGGGGTGGG + Intergenic
976669120 4:87632442-87632464 GGCTAAGTTGTCTCTGGGGGAGG - Intergenic
984821796 4:183888865-183888887 GGCTGATTTGGCTCTGTGCTGGG + Intronic
984926027 4:184807791-184807813 GGCTTATAAGTCTCTGGCCTTGG - Intronic
985649715 5:1101787-1101809 GGCTGCTTAGTGTCGGGGGGTGG - Intronic
986444314 5:7807979-7808001 GCCTGCTGTGTCTCTGGGGTGGG + Intronic
992530743 5:77649454-77649476 GGCTATTTAGTCTTTGGGCTGGG - Intergenic
1000792419 5:165624199-165624221 AGATGATTTGTGTCTGGGGTGGG + Intergenic
1001080383 5:168663199-168663221 GGCTGAGTAGGCTCTGGGCTGGG + Intronic
1005399175 6:25414047-25414069 GGCATATTAGGTTCTGGGGTAGG + Intronic
1007412805 6:41674714-41674736 GGCTGGGGTGTCTCTGGGGTTGG - Intergenic
1016742958 6:147547643-147547665 GGGAGATTATTCTCTCGGGTTGG - Intronic
1017485728 6:154900542-154900564 GCCTGTTTAGTTTCTGGGGCTGG + Intronic
1018995937 6:168710407-168710429 GGCTGAATGGTCTGTGGGCTGGG + Intergenic
1022324863 7:29322067-29322089 GGTTGATAATTCTCTGGGATGGG - Intronic
1023615563 7:42016121-42016143 GGCAGATCATTCTCTGGCGTTGG - Intronic
1024785471 7:52902437-52902459 GGCTGGTTTCTCTCTGGGGTCGG + Intergenic
1032406467 7:131659492-131659514 GTTGAATTAGTCTCTGGGGTGGG + Intergenic
1037372954 8:18199693-18199715 GGCTGATAAGTCACTGGTGACGG + Intronic
1039797040 8:40924538-40924560 GGCTGGTGGGTCTCTGGGGCAGG + Intergenic
1043053731 8:75411297-75411319 GGCTGAATATTCCCTGGGGAAGG + Intronic
1048052787 8:130835159-130835181 GGCTGATTGGTCTCAGGTATTGG - Intronic
1050181005 9:2922896-2922918 GGCTGAGTTGTGTATGGGGTGGG + Intergenic
1053428782 9:38028163-38028185 GCCTGCTTAGTCTCTGGGACAGG - Intronic
1054849861 9:69836462-69836484 GTCTGCATTGTCTCTGGGGTGGG + Intronic
1057296914 9:93851714-93851736 GGCTGCCTCCTCTCTGGGGTAGG + Intergenic
1060878941 9:127104279-127104301 CCCTGATCAGTCTCTGGGATGGG + Intronic
1061422703 9:130480745-130480767 GGCTGTCTTGTGTCTGGGGTGGG + Intronic
1186379289 X:9040185-9040207 GGCTGATTAGTGTCTGAGTGTGG - Intronic
1186594357 X:10964903-10964925 GGCTGATTGGTGTCTGGTGAAGG + Intergenic
1187756169 X:22529286-22529308 TCCTGATTTGTCTCTCGGGTTGG - Intergenic