ID: 1161038825

View in Genome Browser
Species Human (GRCh38)
Location 19:2099357-2099379
Sequence CCCCCACGTTGCCCTGGGGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 224}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161038825_1161038832 15 Left 1161038825 19:2099357-2099379 CCTGCCCCAGGGCAACGTGGGGG 0: 1
1: 0
2: 1
3: 21
4: 224
Right 1161038832 19:2099395-2099417 ACAGCCCCTGCCTGTCACTCTGG 0: 1
1: 0
2: 1
3: 34
4: 414
1161038825_1161038836 21 Left 1161038825 19:2099357-2099379 CCTGCCCCAGGGCAACGTGGGGG 0: 1
1: 0
2: 1
3: 21
4: 224
Right 1161038836 19:2099401-2099423 CCTGCCTGTCACTCTGGAGCTGG 0: 1
1: 0
2: 2
3: 36
4: 290
1161038825_1161038837 22 Left 1161038825 19:2099357-2099379 CCTGCCCCAGGGCAACGTGGGGG 0: 1
1: 0
2: 1
3: 21
4: 224
Right 1161038837 19:2099402-2099424 CTGCCTGTCACTCTGGAGCTGGG 0: 1
1: 1
2: 8
3: 33
4: 278
1161038825_1161038831 -8 Left 1161038825 19:2099357-2099379 CCTGCCCCAGGGCAACGTGGGGG 0: 1
1: 0
2: 1
3: 21
4: 224
Right 1161038831 19:2099372-2099394 CGTGGGGGCGGAGACTCAGCTGG 0: 1
1: 0
2: 0
3: 7
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161038825 Original CRISPR CCCCCACGTTGCCCTGGGGC AGG (reversed) Exonic
900389135 1:2426552-2426574 CTCCCACGCTGACCTAGGGCTGG + Intronic
900398561 1:2463388-2463410 TCCCCAGGTCGCCCTGGTGCTGG + Intronic
900407827 1:2500183-2500205 GCCCCACCCTGACCTGGGGCAGG - Intronic
900956254 1:5888002-5888024 CTCCCCCGTTTCCCTGGGCCAGG + Intronic
901577132 1:10210335-10210357 CCCCCTGGTGGCCCTCGGGCCGG - Intergenic
902235987 1:15057781-15057803 CCCTCCTGCTGCCCTGGGGCTGG - Intronic
902810090 1:18883186-18883208 CCGCCACGAAGCCCTGGGGAAGG + Exonic
903285348 1:22273490-22273512 CCCCCACCTAGCCCAGGGCCAGG + Intergenic
904562373 1:31407270-31407292 CCCTTATGCTGCCCTGGGGCTGG + Intergenic
905749488 1:40450081-40450103 CTCCCACGTAGCGCTGCGGCGGG - Intronic
905791564 1:40792316-40792338 TCCCCACTGTGCCCAGGGGCTGG - Intronic
907038534 1:51237057-51237079 CCCACACGGTGCCCGAGGGCAGG - Intronic
907474292 1:54695317-54695339 CCCACAGGTCCCCCTGGGGCTGG + Intronic
912952210 1:114127856-114127878 CCCCCATGCTCCCCTGGGCCTGG - Intronic
915073685 1:153292473-153292495 CACCCCCGCAGCCCTGGGGCAGG + Intergenic
915310467 1:155003716-155003738 CCCCCACTCTGGGCTGGGGCAGG - Intronic
915444640 1:155967706-155967728 ACCCCACCTTGCCATGGGGTAGG + Intronic
921308512 1:213820507-213820529 CCCACAGGCTGGCCTGGGGCTGG + Intergenic
922677216 1:227560533-227560555 CCCCCTTGTTGCCCACGGGCTGG + Intergenic
922717804 1:227886302-227886324 CTCCCCTGTGGCCCTGGGGCAGG + Intergenic
922881694 1:228985921-228985943 CTCCCACTTTGCCCTGTGGAGGG + Intergenic
1062928645 10:1337645-1337667 CCTCAACTTTACCCTGGGGCTGG + Intronic
1064311236 10:14213558-14213580 CCCTCAGGTTGCCCTGGGCTAGG + Intronic
1064839332 10:19573205-19573227 CAACCACCTTGACCTGGGGCAGG - Intronic
1066657330 10:37708430-37708452 CCCCCTGGTTGCTCTGGGGCAGG - Intergenic
1067039475 10:42941447-42941469 CCCCCACGTTCCCCTTGGCCCGG + Intergenic
1067041802 10:42958050-42958072 CCCCCTGGGTGCTCTGGGGCAGG - Intergenic
1074427130 10:113361349-113361371 CCCCTCCGTGGCCCAGGGGCAGG + Intergenic
1075728864 10:124624604-124624626 CTCCCAGGCTGGCCTGGGGCAGG + Intronic
1075770253 10:124928325-124928347 TCCTCACCTTCCCCTGGGGCTGG + Intergenic
1076704628 10:132294354-132294376 CCCCAAAGATGCCTTGGGGCGGG - Intronic
1076802575 10:132838025-132838047 CCCCCATGCTCCCCTGGGGAAGG + Intronic
1076818305 10:132925389-132925411 CCCTCACGCTGCCCCTGGGCTGG + Intronic
1077020639 11:415794-415816 TCCCCAGGTTGACCTGGGACTGG + Intronic
1077081424 11:726200-726222 CCCCCAGGTGGCCCTGGGCCCGG - Intronic
1077224283 11:1433332-1433354 CCCTCATGATGCCCTGGGGCAGG + Intronic
1077305754 11:1868051-1868073 GCCCCGAGTTGCCCAGGGGCAGG - Intronic
1079135028 11:17771574-17771596 CCCCCGCCTGGCCCTGGGACTGG + Intronic
1079249759 11:18778931-18778953 CCCTCATGCTGCCCTGGGCCTGG + Intronic
1081575971 11:44318799-44318821 CCCACAGCTTGCCCTGGGTCAGG + Intergenic
1083270169 11:61568126-61568148 CCCTCACTTTTTCCTGGGGCGGG - Intronic
1083307927 11:61770427-61770449 CCACTACGCTGCCATGGGGCAGG + Exonic
1083726351 11:64630555-64630577 CCCCCACGGTGCCCTGGTCCTGG + Exonic
1085053733 11:73392514-73392536 CCCCCAAGTGGAGCTGGGGCTGG - Intronic
1085395404 11:76204742-76204764 CCCCCACGCTGGCCTGTGGTGGG - Intronic
1091154437 11:133360727-133360749 TCCCCACGTGGCCGTGGGGAAGG - Intronic
1091454672 12:598266-598288 CCCCCTCGGTGCCCAGGGGGAGG - Intronic
1091681448 12:2530392-2530414 GCCCCATGTTGCCCTGGTACTGG + Intronic
1096069295 12:48766098-48766120 GGCCCACGGAGCCCTGGGGCAGG + Intergenic
1096259323 12:50081198-50081220 CCCCCACGTGGCCCCGTGCCGGG - Intronic
1096677241 12:53232329-53232351 CCTCCTCTGTGCCCTGGGGCTGG + Intronic
1097251210 12:57633051-57633073 CCCCGGCTTTGCCCCGGGGCTGG - Exonic
1097980071 12:65729267-65729289 TCCCCGCGCTGCCCTGGGGACGG + Intergenic
1102111767 12:110370706-110370728 CCCTCCTGCTGCCCTGGGGCAGG + Intergenic
1102462727 12:113109966-113109988 CCCCAAGGTGGCCCTGGAGCAGG - Intronic
1103696417 12:122819375-122819397 CTCCCACGTTGCCAGGGAGCAGG + Intronic
1105601324 13:21891275-21891297 TCCCCACCCTGCCCTGGGCCAGG - Intergenic
1105763186 13:23531818-23531840 TCCTCACGTGGCCCTGGAGCGGG + Intergenic
1107133535 13:36920398-36920420 CGCGCACGTGGCCGTGGGGCCGG - Intronic
1107890343 13:44908932-44908954 CACCCGCCTTGCCCTGGGGGAGG + Intergenic
1108269486 13:48745759-48745781 CCTTCTTGTTGCCCTGGGGCAGG - Intergenic
1113305354 13:109072415-109072437 CCCTCACCTTTCCCTGGGCCTGG + Intronic
1117742862 14:58835854-58835876 CCACCATGTAGCCCTGGAGCTGG + Intergenic
1118395233 14:65330530-65330552 ACCTCACTTTTCCCTGGGGCAGG + Intergenic
1121336947 14:93083389-93083411 TCCCCACCCTGCCCTGGGGAGGG - Intronic
1121876343 14:97456897-97456919 CCCCCAATCTGTCCTGGGGCTGG - Intergenic
1122288869 14:100668801-100668823 CCCCCAAGTTCCCCTGTGTCTGG + Intergenic
1122791302 14:104185253-104185275 GCCCCACGGTGCCTGGGGGCTGG + Intergenic
1122847319 14:104506939-104506961 CCCCCAGGTTGCCATGGGGCTGG + Intronic
1122857736 14:104567957-104567979 TCCCCAGGCTGCCCTGGGGCTGG - Intronic
1123930627 15:25170130-25170152 CTCCCACCATGCCCAGGGGCAGG + Intergenic
1124004608 15:25785849-25785871 CACCCACCTCGCCCAGGGGCAGG + Intronic
1124208327 15:27742149-27742171 CTCCCACCTTGCCCTGGACCTGG - Intergenic
1125589386 15:40844787-40844809 CCCCCACCGTGCGCCGGGGCTGG + Exonic
1126968619 15:54084100-54084122 GCTCCACGTTGCTCTGGGGTCGG + Intronic
1127256622 15:57298840-57298862 CCCCCGCGTTGGTGTGGGGCCGG + Intronic
1128498021 15:68209328-68209350 CCCCAGTGTTGCCCTGGGGCCGG - Intronic
1129299119 15:74615522-74615544 CCCCGACCTGGCCGTGGGGCTGG - Exonic
1129452153 15:75657231-75657253 CCCCCTCCTTCCCCTGGGCCTGG + Exonic
1129767196 15:78177791-78177813 CCCCCATGAAGCCCTGGTGCAGG + Intronic
1132673859 16:1113757-1113779 TCTCCACCTTGTCCTGGGGCTGG - Intergenic
1132682659 16:1149546-1149568 CCCCCACGCTGCCCAGGGGAAGG - Intergenic
1132688591 16:1172432-1172454 CCCTCACCCTGCCCTGGGCCTGG + Intronic
1132881222 16:2162534-2162556 CCGCCACTTTGGCCTGGGACTGG + Intronic
1132888097 16:2191217-2191239 CCCCCACCCTGTCCTGGGCCTGG - Intronic
1133025693 16:2988127-2988149 CCCCCACCTCCCCCTGTGGCAGG - Intergenic
1133113186 16:3561823-3561845 CCCCCACCCTGCCCGTGGGCGGG - Intronic
1133283474 16:4679973-4679995 CCCCCACGCGGCCCTGGAGTGGG - Intronic
1136188236 16:28600693-28600715 CCTGCGCGGTGCCCTGGGGCCGG + Intergenic
1136190708 16:28613687-28613709 CCTGCGCGGTGCCCTGGGGCCGG + Intronic
1136293699 16:29290308-29290330 CTCCCACGTATTCCTGGGGCCGG + Intergenic
1136562525 16:31048649-31048671 CCCCCACTTTTCCCTGGGAGTGG - Intergenic
1137365456 16:47855804-47855826 CCTCCAAGTGGGCCTGGGGCTGG - Intergenic
1137552958 16:49453090-49453112 CCCCCAAGTTCCCCTGAGGTGGG + Intergenic
1137613591 16:49834775-49834797 CCCCCAGCATCCCCTGGGGCGGG - Intronic
1139476737 16:67206606-67206628 TCCCCAGCTGGCCCTGGGGCTGG + Intergenic
1139806081 16:69566263-69566285 CCCTCCCGCTGCCCTCGGGCCGG + Exonic
1142099582 16:88264314-88264336 CTCCCACGTATTCCTGGGGCCGG + Intergenic
1142201256 16:88762135-88762157 CCCCCACTGTGCCCTGGGAAGGG + Intronic
1142307285 16:89292882-89292904 CCTCCATGCTGCCCGGGGGCCGG + Intronic
1143411754 17:6713461-6713483 CCTCCCCGCGGCCCTGGGGCGGG + Exonic
1143632718 17:8148060-8148082 CCCCCAGGAGGTCCTGGGGCAGG + Exonic
1144261313 17:13524453-13524475 TCACCACGTTGCCCAGGGGGAGG + Intronic
1144850643 17:18242311-18242333 GCCCCACGGTGCCCTGGGGGAGG + Intronic
1147726034 17:42566748-42566770 TCCCCACGTTACCCTGAGGGCGG - Intergenic
1148127272 17:45243270-45243292 CCCCCAGGTTGCCCTTCCGCAGG - Exonic
1148772288 17:50074384-50074406 CCCCAACTCTGGCCTGGGGCAGG + Intronic
1150652930 17:67021659-67021681 TGCCCACCTTGCCCTGGGCCTGG + Intronic
1152242568 17:79168013-79168035 CCCTCACCCAGCCCTGGGGCTGG - Intronic
1152389849 17:79997092-79997114 CCTCCACGCTGCCCTGGCACAGG - Intronic
1152821674 17:82440834-82440856 CCCCCAGGTCCCCTTGGGGCCGG + Intronic
1153855045 18:9137081-9137103 CCCCTACCTTGCTCTGGGGAGGG - Intronic
1155677022 18:28441432-28441454 CCCCTACCTTGCCCTAGAGCAGG + Intergenic
1156416378 18:36895867-36895889 CCCCCACGTTGTCCTGTGTGAGG + Intronic
1157222503 18:45837951-45837973 CACCCACGTAGCCCTTGGGGCGG - Intronic
1160245379 18:77154846-77154868 GCCCCTCGTGGCCCTGGGACAGG - Intergenic
1160766425 19:810650-810672 TCCCCAGGCTGCCCTGCGGCCGG + Intronic
1160792565 19:929413-929435 CCCCCACGCTGCAGTGCGGCCGG + Exonic
1160856203 19:1219052-1219074 CCCCCACCCTGCCCATGGGCGGG - Intronic
1160951099 19:1667771-1667793 ACCCCACGGCGCCCTGGGCCAGG - Intergenic
1160971013 19:1767767-1767789 CCAGGACGGTGCCCTGGGGCGGG + Intronic
1161038825 19:2099357-2099379 CCCCCACGTTGCCCTGGGGCAGG - Exonic
1161189406 19:2944791-2944813 GCCCCACCTCGCCCTGGGCCCGG + Intronic
1161249108 19:3270914-3270936 CCCCCACCTTGTTCTGGGGTTGG - Intronic
1162301976 19:9849455-9849477 CCACCACACTGCCCTGGGTCTGG - Exonic
1162523459 19:11194855-11194877 CCTCCACATAGCCCTGGGGCTGG + Intronic
1162996435 19:14338841-14338863 GCCCCACGTGCCCCTGGGGCTGG - Intergenic
1163536851 19:17881860-17881882 CCCCACCGTTGCCCTCAGGCTGG + Intronic
1163599579 19:18240775-18240797 ACCCCACTTTGCCCTGGCTCTGG - Intronic
1166944851 19:46390427-46390449 GTCCAACATTGCCCTGGGGCGGG - Exonic
1167295037 19:48644979-48645001 CTCCCACGGGGCTCTGGGGCAGG - Intronic
1167499123 19:49835750-49835772 CCCCTACGGTACCCTGAGGCTGG - Exonic
1168256264 19:55167036-55167058 AGCCCACGTTGTGCTGGGGCGGG - Intergenic
1168269074 19:55239961-55239983 CCCCCACCTAGCCCTCAGGCCGG + Intronic
926242886 2:11101629-11101651 CCACCAGGCTGCCCAGGGGCAGG + Intergenic
926321723 2:11753079-11753101 CCCCCTCCTTGCCCAGGGACAGG - Intronic
928238454 2:29565646-29565668 CCACCACGTTGCCCTGGGCAAGG + Intronic
929402910 2:41606293-41606315 CCCTCAGGTTCACCTGGGGCAGG + Intergenic
932479045 2:72027726-72027748 CCCCCACCTGCTCCTGGGGCAGG - Intergenic
934710276 2:96509743-96509765 CCCCCACGGGGCCTTGGGGGTGG + Intergenic
936072582 2:109381204-109381226 CACCCAGGTGGCCCTGGAGCAGG + Intronic
937877702 2:126837674-126837696 CCCCCACCCTGCCATGGGCCTGG - Intergenic
937954967 2:127416992-127417014 GGCCCACCTTGCCCAGGGGCAGG - Intergenic
938942271 2:136179609-136179631 TCCCCAGGTGGCCCTGGGTCTGG + Intergenic
939435187 2:142167065-142167087 CCCCCACATTGCCCTGCCCCTGG - Intergenic
940115204 2:150201068-150201090 TCACCATGTTGCCCGGGGGCTGG - Intergenic
940581376 2:155584619-155584641 CACCCTTGTTGCCCTTGGGCTGG + Intergenic
941874433 2:170418698-170418720 CCCCCAGGTGGCCCAGGGCCAGG - Intronic
941978575 2:171431737-171431759 CCCGCCCATGGCCCTGGGGCTGG - Intronic
945844133 2:214923232-214923254 CCCCCACTATTCCCAGGGGCTGG + Intergenic
946902486 2:224385481-224385503 CCCTGAGATTGCCCTGGGGCAGG - Intronic
948839545 2:240642303-240642325 CCCTCACCTGGCCCTGGGGAAGG + Intergenic
1170607780 20:17886709-17886731 CCACCACTGGGCCCTGGGGCTGG - Intergenic
1171349612 20:24492556-24492578 CCCCCACCTAGCCCTGAGGTGGG + Intronic
1172015285 20:31869647-31869669 CCCCCCAGCTGCCCTGGGGGTGG - Intronic
1174365600 20:50054426-50054448 CCCCCACCTTGTCCTGCTGCCGG - Intergenic
1175286394 20:57839706-57839728 CAACCACCTTGACCTGGGGCAGG - Intergenic
1175300987 20:57942506-57942528 ACCCCACGCTGTCCTGGGCCAGG - Intergenic
1175911574 20:62407599-62407621 CACCCACGCCGCCCTGGGTCCGG - Intergenic
1175957266 20:62617820-62617842 CCCCTAGGTGGCCTTGGGGCAGG - Intergenic
1179646535 21:42779443-42779465 CCCTCACGTTCCCCTGCAGCAGG - Intergenic
1179677459 21:42993385-42993407 CCTCCACGTTGCCCTGCTGCAGG + Intronic
1179758164 21:43508968-43508990 TCCCCACGTACCCCTGGGCCGGG - Intergenic
1179886234 21:44315358-44315380 CACCCAGGGTGCACTGGGGCAGG + Intronic
1180930346 22:19586321-19586343 CCTAGACATTGCCCTGGGGCCGG - Intergenic
1182159475 22:28107192-28107214 CCCCCAGGTTGCCATAGGCCCGG + Exonic
1182397273 22:30045668-30045690 TCCCCACCGAGCCCTGGGGCAGG + Intergenic
1183161260 22:36114857-36114879 CCCCCACCTGGCTCTGGGCCTGG + Intergenic
1183339685 22:37273317-37273339 CCCCAGCGCTGCCCTGGGGTGGG + Intergenic
1184302586 22:43570906-43570928 CCACCATGGAGCCCTGGGGCGGG + Intronic
1184498837 22:44859908-44859930 TCCCCTCCTTGCCCTGGGTCTGG + Intronic
1184508133 22:44916579-44916601 CCTCCCCGTTGCCCCGGGCCGGG - Exonic
1185070713 22:48654281-48654303 CCACCACCCTCCCCTGGGGCTGG + Intronic
1185270426 22:49927032-49927054 CCCCCACGCTGCCGTGGGTGTGG - Intronic
1185276752 22:49953235-49953257 CCCCCACGCTCACCTGGGACAGG + Intergenic
949808223 3:7978223-7978245 CCTAGACGCTGCCCTGGGGCTGG - Intergenic
950553163 3:13679757-13679779 CCCCCGAGTTGCCCTGAGGGAGG - Intergenic
950798579 3:15531299-15531321 CCCACACTGTGCCCTGGGGTGGG - Intergenic
950880341 3:16317900-16317922 CCCCCAGGTTGGCTTGGAGCTGG - Intronic
953341724 3:42140189-42140211 CCCCCACCTTCCCCTGGAGGTGG + Intronic
953947753 3:47163960-47163982 CCCCCGCGTCGCCCTGCTGCGGG - Exonic
953982615 3:47420229-47420251 CCACCACATTGCCCTGGGTCGGG - Intronic
954460815 3:50625905-50625927 CCCCCACCCTCCCCTGGGGTGGG - Intronic
954673489 3:52303189-52303211 CCTCTGCCTTGCCCTGGGGCTGG - Intergenic
954695527 3:52422901-52422923 CCCCCTCCTTGCTCTGAGGCCGG - Intronic
955916268 3:63911921-63911943 CTCCCGCGCTGCCCTGGGGCCGG + Intronic
961009479 3:123426200-123426222 CCCCCATGTTGCCATGCTGCAGG - Intronic
966852284 3:184171539-184171561 CCCCCAATTTACCCTGGGCCTGG + Exonic
968505277 4:968447-968469 CCCCCAGGGCTCCCTGGGGCCGG + Intronic
968611659 4:1559964-1559986 CGGCCACTCTGCCCTGGGGCTGG + Intergenic
968794025 4:2690050-2690072 CCCCCCCGGTGCACAGGGGCAGG + Intronic
970408196 4:15783486-15783508 CCCCCACCTTGTCTTGGGGCAGG - Intronic
971258931 4:25038767-25038789 CCCCCAACTTGTCCTTGGGCTGG - Intergenic
971322496 4:25616682-25616704 GCCCCAAGTTGGCCTGGGGGAGG + Intergenic
972503446 4:39698414-39698436 CCCCCACCTCTGCCTGGGGCGGG + Intronic
985728358 5:1527282-1527304 CCCCCACAGCTCCCTGGGGCTGG + Intergenic
992739790 5:79762228-79762250 CACCCAAGTTGGCCTGGGGCAGG + Intronic
1000351338 5:160355058-160355080 CCACCAAGCTGACCTGGGGCTGG + Intronic
1001381893 5:171310983-171311005 CCCGCACGACGCCCGGGGGCTGG - Intronic
1003033696 6:2624355-2624377 CCCCCACGCTGCCCTTGTTCTGG - Intronic
1003384023 6:5650819-5650841 GCCCCACGTTTCCCTGGAGAGGG + Intronic
1006301927 6:33198346-33198368 CCTCCAGGTGGCCCTGGGGCTGG - Exonic
1007450743 6:41939347-41939369 CCTCCACCTTGCTCTGTGGCGGG - Intronic
1007486669 6:42185239-42185261 TCCCCACATAGCCCTGAGGCTGG + Intronic
1007717792 6:43867373-43867395 ATCCCACCATGCCCTGGGGCAGG - Intergenic
1007765035 6:44155088-44155110 ACCCCTCTTTGCCCCGGGGCCGG - Exonic
1007821040 6:44561011-44561033 CACCCGCCTGGCCCTGGGGCTGG - Intergenic
1009459387 6:63894131-63894153 CCCCCACTTTTCCCTGGCACAGG + Intronic
1015384324 6:132604995-132605017 CTTCCACATTGCCCTGGGGCTGG - Intergenic
1017506575 6:155073980-155074002 CCAACAAGTTGCTCTGGGGCAGG - Intronic
1017787636 6:157769604-157769626 CTCCCACGCTGCCCTCGGGAGGG - Intronic
1018669474 6:166167326-166167348 CCCCCAGGCTGCCCAGGCGCTGG + Intronic
1019376745 7:696880-696902 CCCCCATGCAGCCCTGGGGAGGG - Intronic
1019540302 7:1548236-1548258 CCCCCACTGGGCCCTGGGCCAGG - Intronic
1019623493 7:2003732-2003754 CCCTCACACTGCCCTGGGGGAGG + Intronic
1024603924 7:51009911-51009933 ACCCCAGATTGCCCTGTGGCTGG - Intergenic
1026339232 7:69421150-69421172 CCCCCACTTTGGGCTGAGGCGGG - Intergenic
1027267723 7:76503482-76503504 CCTCCATCTTTCCCTGGGGCTGG - Exonic
1027319534 7:77003344-77003366 CCTCCATCTTTCCCTGGGGCTGG - Intergenic
1028995293 7:97093310-97093332 CCCCCACACTCCCCTGAGGCAGG - Intergenic
1029992429 7:104974472-104974494 CCCCCACTTTGGCCTTGGGAAGG + Intergenic
1030117111 7:106070386-106070408 CCACCGCGCTGCCCTGAGGCTGG + Intergenic
1033040584 7:137914074-137914096 CCACCAGCTTGCCCTGGGGTAGG + Intronic
1034163265 7:149007585-149007607 GCCCCAGGTTCCCCTTGGGCTGG + Intronic
1034469359 7:151247356-151247378 CCCCCAGGGGTCCCTGGGGCTGG + Intronic
1034552882 7:151832549-151832571 CTCCCCCCTTCCCCTGGGGCTGG + Intronic
1034962715 7:155372631-155372653 CCCCCACGCGGCCCTAAGGCGGG + Intergenic
1034986325 7:155517665-155517687 CCCCCACTTTGCCGTGTTGCAGG - Intronic
1035421850 7:158736141-158736163 CCAGCACGGTGGCCTGGGGCAGG - Intronic
1036471696 8:9058186-9058208 CCCTCACGTGGCCCTGGAGCTGG + Intronic
1036759015 8:11494208-11494230 GACCCACGTTGCCCAGGGCCAGG + Exonic
1037837238 8:22221445-22221467 CCCCCAGGGTGCCCAGGGACAGG + Exonic
1038740328 8:30211468-30211490 GCCCCAGGTTGCCATGAGGCTGG + Intergenic
1049239337 8:141528975-141528997 ACCCCACCTAGCCCTGGGGATGG + Intergenic
1049848733 8:144819477-144819499 CCCCAACAGTGGCCTGGGGCAGG - Intergenic
1053221816 9:36318843-36318865 CCCCCGCGATGCCATGAGGCAGG + Intergenic
1055394705 9:75861744-75861766 CCCTGAGGTAGCCCTGGGGCTGG + Intergenic
1056293353 9:85166636-85166658 ACCCCACGTTTCTCAGGGGCAGG + Intergenic
1056615408 9:88161083-88161105 CCCCCACGTTCCTATGGGGCTGG - Intergenic
1057269724 9:93644014-93644036 CCCCCACTCTGCCCTGCTGCAGG + Intronic
1057303935 9:93901821-93901843 CCCCCAGTGTGCCCTGGGGGTGG + Intergenic
1057921912 9:99104910-99104932 GCCCCACGCTCCCCGGGGGCTGG - Intronic
1059363644 9:113768149-113768171 ACCCCACGGTGTCCTAGGGCTGG - Intergenic
1188115587 X:26238773-26238795 CCTCCACATTGCCCTAGGGGAGG + Intergenic
1189763222 X:44343668-44343690 CCCCCACGTTGCCTGGAGACGGG + Exonic
1197750653 X:129961429-129961451 GCCCCAGCTTGCCCTAGGGCTGG - Intergenic
1199671489 X:150151737-150151759 GCCCCAGGTAGCCATGGGGCTGG - Intergenic