ID: 1161039165

View in Genome Browser
Species Human (GRCh38)
Location 19:2100823-2100845
Sequence GACCGAGGCCACCACGGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 90}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161039153_1161039165 8 Left 1161039153 19:2100792-2100814 CCCCTGCACGGCCTTGGGTGGAG 0: 1
1: 0
2: 2
3: 18
4: 310
Right 1161039165 19:2100823-2100845 GACCGAGGCCACCACGGGGTGGG 0: 1
1: 0
2: 0
3: 19
4: 90
1161039149_1161039165 14 Left 1161039149 19:2100786-2100808 CCTGCTCCCCTGCACGGCCTTGG 0: 1
1: 0
2: 14
3: 46
4: 355
Right 1161039165 19:2100823-2100845 GACCGAGGCCACCACGGGGTGGG 0: 1
1: 0
2: 0
3: 19
4: 90
1161039155_1161039165 6 Left 1161039155 19:2100794-2100816 CCTGCACGGCCTTGGGTGGAGAT 0: 1
1: 0
2: 0
3: 1
4: 93
Right 1161039165 19:2100823-2100845 GACCGAGGCCACCACGGGGTGGG 0: 1
1: 0
2: 0
3: 19
4: 90
1161039154_1161039165 7 Left 1161039154 19:2100793-2100815 CCCTGCACGGCCTTGGGTGGAGA 0: 1
1: 0
2: 1
3: 11
4: 132
Right 1161039165 19:2100823-2100845 GACCGAGGCCACCACGGGGTGGG 0: 1
1: 0
2: 0
3: 19
4: 90
1161039159_1161039165 -3 Left 1161039159 19:2100803-2100825 CCTTGGGTGGAGATGCTGGGGAC 0: 1
1: 0
2: 5
3: 25
4: 244
Right 1161039165 19:2100823-2100845 GACCGAGGCCACCACGGGGTGGG 0: 1
1: 0
2: 0
3: 19
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161039165 Original CRISPR GACCGAGGCCACCACGGGGT GGG Intergenic
904664334 1:32108366-32108388 GCCCGAGGCCACCATGTGGGGGG - Intronic
911950919 1:104172608-104172630 GCGGGAGCCCACCACGGGGTGGG - Intergenic
1068968160 10:62934295-62934317 GAGCGAGGCCATCAACGGGTGGG + Intergenic
1069581882 10:69572239-69572261 GGCCCAGGCCTCCACGGGGGCGG - Exonic
1074827490 10:117225002-117225024 CACCGAGGCCAGCACATGGTAGG + Intergenic
1075747295 10:124736676-124736698 GAGGGTGGCCTCCACGGGGTGGG + Intronic
1076554367 10:131311989-131312011 GCCAGAGGCCACCAGGGGGCCGG - Intergenic
1076774622 10:132687854-132687876 GGCAGAGGCCACCATGGCGTCGG + Intronic
1077217989 11:1403040-1403062 CCCCGGGGCCACCACGGGGTAGG + Intronic
1078141947 11:8699351-8699373 GAGCAAGGCCACCACCGCGTGGG + Exonic
1081589232 11:44409403-44409425 CACAGAGGCCACCAGGGAGTTGG + Intergenic
1083853833 11:65382401-65382423 TAGCGTGGCCACCAGGGGGTAGG + Intronic
1089563290 11:119356789-119356811 GAGCGGGGCCACCACGGGGAAGG + Exonic
1089621973 11:119727659-119727681 CACCAGGGCCACCCCGGGGTCGG + Intronic
1092756023 12:11764208-11764230 GACCGTGGCCAGCACGGAGTGGG + Intronic
1092791232 12:12072418-12072440 GACCCCGGCCACCTCGGGGAGGG + Intronic
1102079478 12:110086369-110086391 GACAGAGGACACCATGGGGTTGG + Intergenic
1108519088 13:51229358-51229380 GACTAAGGGCACCACCGGGTTGG - Intronic
1113801735 13:113090188-113090210 GACAGACGCCACCACGGTGAGGG - Intronic
1113960607 13:114123724-114123746 GAGGGAGGCACCCACGGGGTGGG + Intronic
1119745002 14:77037952-77037974 AACCGAGGCAACCACGGGGGAGG - Intergenic
1122379116 14:101288824-101288846 GGCCGAGTCCACCAGGGGGAGGG - Intergenic
1122424998 14:101600795-101600817 CACAGATGCCACCACGGGGGTGG - Intergenic
1122603011 14:102930513-102930535 GACCGGGGCCTCCTCGGGGCCGG + Intronic
1124278842 15:28346858-28346880 GAGCGAGATCACCACTGGGTAGG + Intergenic
1127759303 15:62122096-62122118 GGCTGAGACCACCATGGGGTGGG - Intergenic
1129739765 15:77984628-77984650 GACCCAGGACACCTGGGGGTGGG - Intronic
1130115504 15:81001721-81001743 GCTCGAGGCCACCTCGGGCTCGG - Exonic
1131098961 15:89673298-89673320 CACAGAGGCCACCAGGGGGTGGG + Exonic
1134037571 16:11042451-11042473 GACCGATGACACCACGGGCCAGG - Intronic
1134460697 16:14427053-14427075 GACGAAGGACATCACGGGGTAGG - Intergenic
1137787562 16:51151179-51151201 GAGCGAGGCCACTTCGGGGTCGG + Exonic
1138656410 16:58494162-58494184 GACCGCGGGCACCACGAGGGCGG - Intronic
1142187985 16:88703531-88703553 GAACGAGGCACCCACAGGGTGGG + Intronic
1143538916 17:7558175-7558197 GTCCGAGGCCACCAAGAGGAAGG - Intronic
1143659526 17:8315951-8315973 GACCGAGGCCACAGCAGGTTGGG + Intronic
1146616450 17:34360694-34360716 CACCCAAGCCACCACTGGGTGGG + Intronic
1146940966 17:36844287-36844309 GATGGAGGCCACCAGGAGGTGGG - Intergenic
1153522159 18:5963441-5963463 GGTGGAGGCCACCACGGGGCAGG - Intronic
1154191962 18:12237377-12237399 GCCCGCGGCCACCAGGGGGCAGG - Intergenic
1157446528 18:47750753-47750775 GACCGAGGACCCTACGGGCTGGG + Intergenic
1160241193 18:77124444-77124466 AAAGGAGGCCAGCACGGGGTGGG - Intronic
1161039165 19:2100823-2100845 GACCGAGGCCACCACGGGGTGGG + Intergenic
1161317317 19:3623659-3623681 GACAGAGGCCACCACCCGGCGGG + Intronic
1161700831 19:5794195-5794217 GCCCGAGGCCACAACAGGCTTGG + Intergenic
927488447 2:23504930-23504952 AACCGAAGCCTCCACGGGGCAGG + Intronic
929940373 2:46329249-46329271 GTGCGAGGCAACCACAGGGTAGG + Intronic
937204344 2:120225913-120225935 GACAGAGGCCATGTCGGGGTGGG - Intergenic
944413764 2:199464233-199464255 GAGGGAAGGCACCACGGGGTGGG - Intronic
948257800 2:236580647-236580669 CACCCAGACCACCACGGAGTTGG - Exonic
948688268 2:239685276-239685298 TACCGAGGACACCTGGGGGTGGG + Intergenic
1170412637 20:16107605-16107627 GAACGAGGCCAACAAGGGGCAGG + Intergenic
1176131531 20:63498681-63498703 GACAGAAGCCACCCTGGGGTGGG + Intronic
1178327893 21:31660053-31660075 GACCGAGGCCGCCGCGGGGCTGG + Intronic
1179209563 21:39313634-39313656 GACCGACGCCTCCGCGGGGGAGG + Exonic
1179496993 21:41778300-41778322 GACCGAGGGCTCCACGAGGAAGG - Intergenic
1179891812 21:44339081-44339103 GGCCGCGGCCGCCCCGGGGTGGG - Intronic
1180612259 22:17105701-17105723 AACCGAGGCCAGCCCGGGGTGGG + Intronic
1180784364 22:18538646-18538668 GGCAGTGGCCACCACGCGGTAGG + Intergenic
1181127938 22:20712699-20712721 GGCAGTGGCCACCACGCGGTAGG + Exonic
1181241267 22:21478003-21478025 GGCAGTGGCCACCACGCGGTAGG + Intergenic
1181583260 22:23839310-23839332 GACCCACGACACCACGGGGGCGG + Intergenic
1182459341 22:30472844-30472866 GGCCGAGGCTAGCCCGGGGTTGG - Intergenic
1184860702 22:47171779-47171801 CACTGAGGCCACAACGGGGAAGG - Intronic
1185301199 22:50081995-50082017 GACCCAGGACAGCACGGGGCGGG + Intronic
1185370129 22:50457056-50457078 GGCCGAGGCCGCCATGGGGTTGG + Exonic
954327473 3:49871283-49871305 GACCCACCCCACCACTGGGTAGG + Intergenic
954450479 3:50568959-50568981 GCCCGAGCCCACCAGGGGGTCGG - Intronic
961715393 3:128853988-128854010 GGCAGAGGCCACCACTGGGCAGG - Intergenic
968454247 4:689094-689116 GACGGAGGCCGAGACGGGGTTGG - Exonic
968488141 4:874570-874592 GCCCGAGGACAGGACGGGGTGGG - Intronic
969814373 4:9675782-9675804 GACCCAGTCCACCAGGGAGTGGG + Intergenic
977415617 4:96729441-96729463 GCCCGAGTCCTCCATGGGGTAGG - Intergenic
999271983 5:150302186-150302208 GACCAAGGCTACCACGACGTGGG - Exonic
999311636 5:150555333-150555355 GACCCAGGCCCCCACAGGCTGGG - Exonic
1000239218 5:159393957-159393979 GAAGGAGGACACCACGTGGTAGG + Intergenic
1002087100 5:176782787-176782809 TGCTGAGGCCACCACGGGGCAGG + Intergenic
1002826058 6:775489-775511 GATCCAGGCCACCTCGCGGTCGG + Intergenic
1007154132 6:39725481-39725503 GAAGGAGGCCACTACGGGGCGGG + Intergenic
1011129296 6:84037558-84037580 GCGGGAGCCCACCACGGGGTGGG + Intronic
1019355955 7:579106-579128 GTCCGGGGCCTCCATGGGGTGGG - Intronic
1019383389 7:740011-740033 GACTGATGGCACCACGGAGTCGG + Intronic
1025178237 7:56812550-56812572 GACCAAGGCCACCAGGAGCTGGG + Intergenic
1025178669 7:56814292-56814314 GACCAAGGCCACCAGGAGCTGGG + Intergenic
1025179107 7:56816082-56816104 GACCAAGGCCACCAGGAGCTGGG + Intergenic
1025179562 7:56817968-56817990 GACCAAGGCCACCAGGAGCTGGG + Intergenic
1025180012 7:56819806-56819828 GACCAAGGCCACCAGGAGCTGGG + Intergenic
1025180483 7:56821788-56821810 GACCAAGGCCACCAGGAGCTGGG + Intergenic
1025180930 7:56823637-56823659 GACCAAGGCCACCAGGAGCTGGG + Intronic
1025181357 7:56825377-56825399 GACCAAGGCCACCAGGAGCTGGG + Intronic
1025181804 7:56827215-56827237 GACCAAGGCCACCAGGAGCTGGG + Intergenic
1025690115 7:63749780-63749802 GACCAAGGCCACCACGAGCTGGG - Intergenic
1025690562 7:63751603-63751625 GACCAAGGCCACCACGAGCTGGG - Intergenic
1025691010 7:63753426-63753448 GACCAAGGCCACCAGGAGCTGGG - Intergenic
1025691446 7:63755202-63755224 GACCAAGGCCACCACGAGCTGGG - Intergenic
1025691886 7:63757025-63757047 GACCAAGGCCACCACGAGCTGGG - Intergenic
1025692334 7:63758848-63758870 GACCAAGGCCACCACGAGCTGGG - Intergenic
1025692778 7:63760671-63760693 GACCAAGGCCACCACGAGCTGGG - Intergenic
1025693195 7:63762350-63762372 GACCAAGGCCACCACGAGCTGGG - Intergenic
1025693639 7:63764173-63764195 GACCAAGGCCACCACGAGCTGGG - Intergenic
1026833485 7:73623776-73623798 GGCCGAGGCCTGCAGGGGGTCGG + Intronic
1034347771 7:150397696-150397718 GGCCGAGGCCATCCCGGGCTTGG + Exonic
1036910470 8:12754368-12754390 GACCGAGGCCGCCCCGGCGCGGG - Intronic
1038147615 8:24913376-24913398 GAACAAGGGGACCACGGGGTCGG + Exonic
1041256133 8:55980959-55980981 GACCGAGAACAGCACGGGGGTGG - Intronic
1049936540 9:505309-505331 GGCCGAAGCCACCTCGGAGTTGG - Intronic
1051835728 9:21335392-21335414 GTCCCAGGATACCACGGGGTGGG + Intergenic
1190288132 X:48974005-48974027 GGCAGAGGCCACCAGGGAGTGGG - Exonic
1192577603 X:72255476-72255498 GGCCGAGGGCACCACGCGGCAGG - Intronic
1200279362 X:154763256-154763278 GTCCCACGCCACCGCGGGGTGGG - Intronic