ID: 1161041116

View in Genome Browser
Species Human (GRCh38)
Location 19:2111228-2111250
Sequence CAGCCCACACTCTTTGGCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 149}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161041116_1161041130 25 Left 1161041116 19:2111228-2111250 CCCATGCCAAAGAGTGTGGGCTG 0: 1
1: 0
2: 1
3: 11
4: 149
Right 1161041130 19:2111276-2111298 GCCACTCACCATTTTAACATAGG 0: 1
1: 0
2: 0
3: 8
4: 107
1161041116_1161041120 -6 Left 1161041116 19:2111228-2111250 CCCATGCCAAAGAGTGTGGGCTG 0: 1
1: 0
2: 1
3: 11
4: 149
Right 1161041120 19:2111245-2111267 GGGCTGGCCCACCCTGCCCCTGG 0: 1
1: 2
2: 12
3: 70
4: 611
1161041116_1161041122 0 Left 1161041116 19:2111228-2111250 CCCATGCCAAAGAGTGTGGGCTG 0: 1
1: 0
2: 1
3: 11
4: 149
Right 1161041122 19:2111251-2111273 GCCCACCCTGCCCCTGGGAGCGG 0: 1
1: 0
2: 6
3: 53
4: 474
1161041116_1161041121 -5 Left 1161041116 19:2111228-2111250 CCCATGCCAAAGAGTGTGGGCTG 0: 1
1: 0
2: 1
3: 11
4: 149
Right 1161041121 19:2111246-2111268 GGCTGGCCCACCCTGCCCCTGGG 0: 1
1: 0
2: 4
3: 46
4: 376

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161041116 Original CRISPR CAGCCCACACTCTTTGGCAT GGG (reversed) Intronic
900831720 1:4970214-4970236 CACCCCACACGCTCTGTCATGGG - Intergenic
902886499 1:19408481-19408503 CAGCCCACAGTCTTTGTCCCTGG - Intronic
902932776 1:19743122-19743144 CAGCCCATATTCTTGGCCATAGG - Intronic
904036987 1:27564262-27564284 CAGCTCAGCCTCTTTGGCTTCGG + Intronic
905890926 1:41517918-41517940 CTGCCTACACACTCTGGCATGGG - Intronic
905920955 1:41718224-41718246 AAGCCCAGACTCCTTGGCAAAGG - Intronic
906881605 1:49597613-49597635 CAGCCCCCTCTCTCTGGAATTGG + Intronic
912638190 1:111318641-111318663 GATCCCAGACTCCTTGGCATAGG - Exonic
912750075 1:112280207-112280229 CTGCCCCAACTGTTTGGCATTGG + Intergenic
914801435 1:150965578-150965600 CAGCCCCCACTTTTTGGCAGAGG + Exonic
915059677 1:153170994-153171016 CATTCCACCCTCTTTGGCCTTGG + Intergenic
915179439 1:154045219-154045241 CAGCCCACCCTACTTGGAATTGG - Intronic
915476669 1:156156584-156156606 CAGCCCACACTCTTTATCCCTGG - Intronic
919796135 1:201322608-201322630 CAGACCACCCTCTTTGGCCCAGG + Intronic
919937423 1:202263915-202263937 AACCCCAAACTCTTTGGCTTGGG - Intronic
922619828 1:226982781-226982803 CTGCCCACTCTCTGTGGCCTCGG + Intronic
923460309 1:234204461-234204483 CAGCCCAGAGTCCTTGGCAGGGG - Intronic
1063274684 10:4552591-4552613 CCCCTCACACTCTCTGGCATTGG - Intergenic
1065732427 10:28721753-28721775 GAGCCCACCCTCTGTGGCACTGG + Intergenic
1071305619 10:84296531-84296553 CCACCCACATTCTTTGGCAAAGG - Intergenic
1072456982 10:95585156-95585178 CAGGCCACACGCATTGGCAGAGG - Intergenic
1074980058 10:118612258-118612280 AACCCCACACTGTATGGCATGGG - Intergenic
1075168622 10:120092280-120092302 CAGCATTCACTCTTTGGCAGTGG + Intergenic
1075246763 10:120829417-120829439 CAGTCCACACTCCTTGTCAGTGG - Intergenic
1075571003 10:123545562-123545584 TAGGCCTCACTCTTTGACATAGG + Intergenic
1076368222 10:129935805-129935827 CAGCCCACATTCTATGCCCTTGG - Intronic
1077705699 11:4482990-4483012 TGGCCCACAGTGTTTGGCATAGG - Intergenic
1077915502 11:6609055-6609077 CTGCCCACACTCTTAGGAAATGG + Exonic
1078164587 11:8871156-8871178 CAGCCCACCCTCTCTGTCTTGGG - Intronic
1080792897 11:35537266-35537288 CTGCTCACCCTTTTTGGCATCGG + Intergenic
1083058624 11:59847037-59847059 CAGCCCACACTCTAGGGAAGAGG - Intergenic
1085320948 11:75573609-75573631 CAGGTCACAATCTTTGGCAGAGG - Intergenic
1085749905 11:79152673-79152695 CAGCACAAACACTGTGGCATTGG - Intronic
1085803809 11:79616121-79616143 GAGCCCACACACTTTGCCACTGG + Intergenic
1087152688 11:94872779-94872801 CTTCCCACACCCTATGGCATGGG - Exonic
1091211435 11:133864508-133864530 CACCCTACACGCTTTGGGATAGG + Intergenic
1091238956 11:134039794-134039816 CAGCTCACACTCTCTGGCTACGG - Intergenic
1094632026 12:32185071-32185093 CAGCCTTCACTATTTGGCAGGGG + Intronic
1095189887 12:39245566-39245588 CAGCCAACACTCTGAGGCAGAGG - Intergenic
1099294328 12:80811104-80811126 CAGCCCACACTCTTCTCCTTAGG + Intronic
1102140694 12:110612739-110612761 CAGCCAACATTCTTGGGCTTGGG + Intergenic
1102252972 12:111399998-111400020 CAGCCCACACTCAAGGGCAGGGG + Intergenic
1107539151 13:41369759-41369781 CTGCCCACACTCCTTAGCTTGGG - Intronic
1107963741 13:45580835-45580857 CACCCCACCCTCTTTGGCTTTGG + Intronic
1113270984 13:108674158-108674180 CAGCCTACACTTTTGGGAATGGG - Intronic
1117815626 14:59594602-59594624 AAGCCCAAACTCCTTGGCACAGG + Intergenic
1118717730 14:68572290-68572312 CAGCCCTAACCCTGTGGCATGGG + Intronic
1120612148 14:86655226-86655248 CAGGCCACATTGTTTAGCATGGG + Intergenic
1121812910 14:96907339-96907361 CACGCTACACTCCTTGGCATGGG + Intronic
1126259495 15:46671741-46671763 CAGCCCACACTCCTAGGGACGGG + Intergenic
1128620924 15:69149269-69149291 CAAGCCAAACTCCTTGGCATGGG + Intergenic
1128888660 15:71311420-71311442 CATCCGACATTCTCTGGCATGGG + Intronic
1130993214 15:88889104-88889126 CAGCAGACACTCTATGGCAGAGG - Intronic
1135167928 16:20156956-20156978 TAGCCCACACTTCCTGGCATGGG + Intergenic
1135435790 16:22425791-22425813 CAGCCCTGACTCTTTAGGATCGG + Intronic
1138293109 16:55864825-55864847 CAGCCCAAACTCCTGGTCATAGG - Intronic
1140940138 16:79713698-79713720 CAGCCCACACTCATGGGGAGTGG - Intergenic
1142045001 16:87919624-87919646 CAGCCCGGACTCTTTAGGATCGG + Intronic
1142642964 17:1295345-1295367 CAGCCCACACTCTAGGGGAGAGG - Intronic
1143796567 17:9341951-9341973 CAGCCCACAGTCCTTGGCTCTGG - Intronic
1144379695 17:14682252-14682274 CAGCCCACACTCAAAGGCATGGG - Intergenic
1146186524 17:30727921-30727943 CTGCCCACACAACTTGGCATCGG + Intergenic
1151431886 17:74069362-74069384 CAGCCCACACTCTAGGGGAGGGG + Intergenic
1153682554 18:7514300-7514322 CAGCCCACACTCAATGGGAAGGG + Intergenic
1154065794 18:11105955-11105977 CAGCTTTCACTTTTTGGCATAGG + Intronic
1155097022 18:22566317-22566339 GAGCCCCCACTGCTTGGCATTGG - Intergenic
1155276049 18:24188377-24188399 CACACCACCCTCTTTGTCATTGG - Intronic
1161041116 19:2111228-2111250 CAGCCCACACTCTTTGGCATGGG - Intronic
1161217482 19:3101601-3101623 TATCCCACACTCTTTGGCGATGG + Intronic
1163331181 19:16639021-16639043 CAGTCCACACTCTTTTGCCTAGG + Intronic
927502209 2:23590459-23590481 CAACCCACATACTTTGGCAGGGG - Intronic
927619232 2:24634735-24634757 AAGACCACACTCTTTCGCCTAGG + Intronic
928687951 2:33768798-33768820 GAGTCCACACTGTTTGGCATAGG - Intergenic
928790225 2:34941156-34941178 CAGTCCTCACTCTTTGGCTATGG - Intergenic
929468407 2:42167825-42167847 CAGGCCACACTCTCTGCCTTAGG - Intergenic
930103063 2:47617926-47617948 CAGGCCACACTCTTTGGCCTTGG + Intergenic
931053204 2:58437620-58437642 GAGCCCACAATGTTTGCCATGGG + Intergenic
932767977 2:74483102-74483124 CGCCCCACAGTCTTTGGAATCGG - Exonic
938327745 2:130424035-130424057 CAGCCCACAGTGTTTGCTATAGG + Intergenic
938438611 2:131304142-131304164 CAGCCCACAGTATTTGCTATAGG - Intronic
941198111 2:162475388-162475410 CATGCCACGCTATTTGGCATAGG - Intronic
945344540 2:208697424-208697446 CAGCCCACACTCACTGGCAGAGG - Intronic
948067872 2:235095092-235095114 CTCCCCTCACTCTTTAGCATGGG + Intergenic
948930564 2:241129191-241129213 TTGCCCAGACTCTTTGGCAAGGG - Intronic
1175706243 20:61179309-61179331 CTGCCCACATTCTGTGGCTTTGG - Intergenic
1175750622 20:61494916-61494938 CAACCTGCACTCTTTGGCGTGGG + Intronic
1180256065 21:46628538-46628560 CAGCCCTCAGTCCTTGTCATGGG + Intergenic
1180621010 22:17161919-17161941 CAGCCCACACTCAATGGGAGGGG - Intronic
1181909160 22:26224454-26224476 AAGCCCAAACTCCTTGCCATGGG - Intronic
1182615519 22:31586376-31586398 TAGCCCACAGTGCTTGGCATGGG + Intronic
1184473635 22:44709434-44709456 GTGCCCACATTCTTTGGCTTGGG - Intronic
950839150 3:15950090-15950112 CAGTCCACAATCTTTGCCAATGG - Intergenic
951049707 3:18080413-18080435 CAGCCCTCCCTCTTGGGCATGGG - Intronic
952716885 3:36488903-36488925 ATGCCCAAACTCTTAGGCATGGG + Intronic
954379496 3:50212172-50212194 GAGACCACAGTCTGTGGCATGGG - Intronic
958462595 3:94418322-94418344 GAGCCCAGAATGTTTGGCATGGG + Intergenic
962735774 3:138323929-138323951 CAGCCCACACTCCAGGGCAGGGG - Intronic
965225861 3:165988789-165988811 AAGGCTACACTCTTTGGCCTAGG + Intergenic
967053574 3:185807635-185807657 CAGCCCATACTCTATGGGAAAGG - Intronic
967219662 3:187237801-187237823 CAGGCTACACTCCTTGGCCTGGG + Intronic
968999957 4:3972633-3972655 CAGCCCACCCTCTTGTGCTTTGG + Intergenic
969619159 4:8270255-8270277 CAGCGCGCACACGTTGGCATAGG - Exonic
969652842 4:8477991-8478013 GAGGCCACACACTCTGGCATGGG - Intronic
969999104 4:11345769-11345791 CAGCCAACATTCTGTGGAATTGG + Intergenic
970189130 4:13494076-13494098 CAGCCTACATTCTTTGGGTTGGG + Intergenic
973747413 4:53977490-53977512 CACCACATACTGTTTGGCATAGG + Intronic
976350576 4:84055805-84055827 CCACCCACACTCTATGGCAGAGG + Intergenic
980018012 4:127675922-127675944 CAGCCCACACTCATGGGGAGAGG + Intronic
983872601 4:172839151-172839173 CAACCCACACCCTTTGGGAGGGG + Intronic
984164509 4:176290789-176290811 CAGCCCGCACTCCATGGAATGGG - Intergenic
986674086 5:10168431-10168453 CAGCCCACAGCCTATGGCTTTGG + Intergenic
988863126 5:35305351-35305373 CAGCCATGACTCTTTGCCATAGG + Intergenic
990337764 5:54792009-54792031 CAGCCAGCTCTCTTTGGGATTGG - Intergenic
991011286 5:61885289-61885311 CAGCCCACATTCTGTGGGAGGGG - Intergenic
995221234 5:109650562-109650584 CAGCCCACACTCTGGGCAATTGG - Intergenic
997795012 5:136800333-136800355 CAGCCTACACCCCTGGGCATAGG + Intergenic
1001465709 5:171963850-171963872 CTGCTTACACTCTTTGTCATTGG - Intronic
1002089725 5:176797466-176797488 CAGCTCACACCCTGTGGCCTCGG + Intergenic
1002676157 5:180914926-180914948 CAGCCCACAATTTTTGCCATGGG + Intronic
1003397472 6:5765453-5765475 CAGCCCACGCTCCCTGCCATTGG - Intronic
1006070706 6:31496161-31496183 CAGCGCACATTCTTAGTCATTGG - Intronic
1007077806 6:39079003-39079025 CTGCCCATTCTCTTTGCCATTGG + Exonic
1007327302 6:41072527-41072549 GAGCCCACACTCTTTGGCGAAGG + Exonic
1009921925 6:70072787-70072809 CAGCCCACACTTGATGGCAAAGG + Intronic
1012853599 6:104475331-104475353 CAGCCCACACTCAATGGGAAGGG + Intergenic
1014841482 6:126225180-126225202 CAGCCCAGAGTGTTTGGCACAGG - Intergenic
1015021005 6:128474970-128474992 CAGGCCACATTCATTGGTATAGG + Intronic
1015392821 6:132702095-132702117 CAGGCCACAGTCCATGGCATAGG - Intronic
1017101027 6:150850067-150850089 AAGCCCCCACTCTTTGGAGTTGG + Intergenic
1019263971 7:101979-102001 CAGGCCCCACTCTGTGGCTTTGG - Intergenic
1022356353 7:29618564-29618586 CAGCCCACACTCAACGGCAAGGG - Intergenic
1029550887 7:101236553-101236575 CAGCGCTCAGTCTCTGGCATAGG + Intronic
1031596607 7:123656710-123656732 CACCCCACACTTCTTGGTATTGG - Intronic
1033518444 7:142134046-142134068 CAGCCCATACACATTGGCACTGG - Exonic
1037177255 8:15961974-15961996 GAGCCCACAGGCTTTGGCACGGG - Intergenic
1042122120 8:65499379-65499401 CAGCCCTCAGTCCTTGGCAGTGG - Intergenic
1042206140 8:66331815-66331837 CAGTCCAAATTCTTTGGCATGGG - Intergenic
1044328577 8:90889866-90889888 CAGCCCACACTCAGTGGGAGCGG + Intronic
1044553708 8:93539239-93539261 AAGCCCTCAGTCATTGGCATGGG - Intergenic
1044777068 8:95701116-95701138 AACCCCTCACTCTGTGGCATAGG + Intergenic
1045109610 8:98927804-98927826 CAGCTCCCACTCTGTGGCCTAGG - Intronic
1045643095 8:104273271-104273293 CAGCCCCCACTGGTTTGCATAGG + Intergenic
1051736421 9:20203784-20203806 CAACCCAAACTCTGTGGCAGCGG + Intergenic
1053451018 9:38194016-38194038 CCACCCACACTCCTTGGCTTGGG - Intergenic
1053459076 9:38254538-38254560 CAGCCCAGCATCTTTGGCTTCGG - Intergenic
1054777929 9:69139493-69139515 CAGGCCACTCTCTCTGGCTTGGG - Intronic
1059365113 9:113780847-113780869 CTGCCCACACTCTTTTTCTTTGG + Intergenic
1061499651 9:130994494-130994516 CAGCCCACACTCTGGGCCCTGGG - Intergenic
1062145146 9:134984922-134984944 CAGCCCACAGTCTCAGCCATCGG - Intergenic
1186689973 X:11964917-11964939 CAACCCACATTCCTTGGCTTGGG + Intergenic
1186727191 X:12369834-12369856 AAGTCCAAACTCTTTGGCATAGG - Intronic
1186815277 X:13231027-13231049 CAGCCCACACTCAATGGGAGAGG - Intergenic
1187762806 X:22606508-22606530 CAGCCTAAAATCTTTAGCATTGG - Intergenic
1188509745 X:30922761-30922783 CAGCCCCCATTCTCTGGAATGGG + Intronic
1188864213 X:35294480-35294502 CAGCCCACTCTCTTGGGGAGTGG + Intergenic
1189232124 X:39460706-39460728 CTGCCCACCCTCTGTGGCTTCGG + Intergenic
1192944341 X:75949503-75949525 CAGCCCACCCACTTTGCCAAGGG - Intergenic
1194356885 X:92896336-92896358 CAGCCCAGAGGGTTTGGCATGGG - Intergenic
1195077478 X:101340890-101340912 CAGCCCAGACTCCTTTCCATTGG - Intergenic
1196558908 X:117123003-117123025 CTGCCCACCCTCTTTAGCACTGG - Intergenic
1199971223 X:152863387-152863409 CAGCCCACCCTCAATGCCATGGG + Intronic
1200665218 Y:6013330-6013352 CAGCCCAGAGGGTTTGGCATGGG - Intergenic