ID: 1161042304

View in Genome Browser
Species Human (GRCh38)
Location 19:2116649-2116671
Sequence GACGCCGCTGCTCCTCCTCG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 141}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161042294_1161042304 16 Left 1161042294 19:2116610-2116632 CCAGCTCTTCCTCGTCCGCCTCC 0: 1
1: 0
2: 19
3: 645
4: 5513
Right 1161042304 19:2116649-2116671 GACGCCGCTGCTCCTCCTCGTGG 0: 1
1: 0
2: 0
3: 15
4: 141
1161042292_1161042304 22 Left 1161042292 19:2116604-2116626 CCCGAGCCAGCTCTTCCTCGTCC 0: 1
1: 0
2: 5
3: 40
4: 352
Right 1161042304 19:2116649-2116671 GACGCCGCTGCTCCTCCTCGTGG 0: 1
1: 0
2: 0
3: 15
4: 141
1161042302_1161042304 -5 Left 1161042302 19:2116631-2116653 CCGACGGCCGGTGCTTGGGACGC 0: 1
1: 0
2: 0
3: 3
4: 44
Right 1161042304 19:2116649-2116671 GACGCCGCTGCTCCTCCTCGTGG 0: 1
1: 0
2: 0
3: 15
4: 141
1161042293_1161042304 21 Left 1161042293 19:2116605-2116627 CCGAGCCAGCTCTTCCTCGTCCG 0: 1
1: 0
2: 1
3: 17
4: 162
Right 1161042304 19:2116649-2116671 GACGCCGCTGCTCCTCCTCGTGG 0: 1
1: 0
2: 0
3: 15
4: 141
1161042296_1161042304 7 Left 1161042296 19:2116619-2116641 CCTCGTCCGCCTCCGACGGCCGG 0: 1
1: 0
2: 0
3: 6
4: 103
Right 1161042304 19:2116649-2116671 GACGCCGCTGCTCCTCCTCGTGG 0: 1
1: 0
2: 0
3: 15
4: 141
1161042298_1161042304 1 Left 1161042298 19:2116625-2116647 CCGCCTCCGACGGCCGGTGCTTG 0: 1
1: 0
2: 0
3: 0
4: 63
Right 1161042304 19:2116649-2116671 GACGCCGCTGCTCCTCCTCGTGG 0: 1
1: 0
2: 0
3: 15
4: 141
1161042301_1161042304 -2 Left 1161042301 19:2116628-2116650 CCTCCGACGGCCGGTGCTTGGGA 0: 1
1: 0
2: 0
3: 4
4: 40
Right 1161042304 19:2116649-2116671 GACGCCGCTGCTCCTCCTCGTGG 0: 1
1: 0
2: 0
3: 15
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161042304 Original CRISPR GACGCCGCTGCTCCTCCTCG TGG Exonic
900361010 1:2289119-2289141 GACCCAGCTGCCCCTCCCCGAGG + Intronic
900369920 1:2327701-2327723 GCCGCGCCTGCCCCTCCTCGTGG - Intronic
901799754 1:11701197-11701219 CACGCAGCCGCTCATCCTCGCGG - Intronic
902196368 1:14801524-14801546 GAGGCCTCTGCTCCTTCCCGGGG - Intronic
902509926 1:16960985-16961007 CGCGCCGCTGCACCTCCACGCGG - Exonic
904642110 1:31938529-31938551 TCCCCCGCTCCTCCTCCTCGTGG + Intronic
905340827 1:37276142-37276164 GACGCTGCTGCTGCTCCACCAGG + Intergenic
905526724 1:38645520-38645542 GACCCCGGTGCTCCTCGACGTGG + Intergenic
907851361 1:58258179-58258201 GACACAGCTGCTCCTTCGCGGGG - Intronic
908473850 1:64470279-64470301 GCCGCCGCTCCTCTTCCCCGGGG + Intergenic
914574421 1:148952087-148952109 GATGTCGAGGCTCCTCCTCGCGG - Intronic
914950254 1:152107804-152107826 GGCGTAGCTGTTCCTCCTCGCGG + Exonic
914950264 1:152107876-152107898 GGCGGAGCTGTTCCTCCTCGCGG + Exonic
914950275 1:152107948-152107970 GACGGAGCTGCTCTTCCTCTAGG + Exonic
914950281 1:152108020-152108042 GGCGCAGCTGTTCCTCCTCACGG + Exonic
914950344 1:152108524-152108546 GGCGCAGCTGTTCCTCCTCGCGG + Exonic
914950362 1:152108644-152108666 GCAGCTGCTGTTCCTCCTCGAGG + Exonic
914950412 1:152109067-152109089 GCAGCCGCTGTTCCTCCTCGAGG + Exonic
914950430 1:152109181-152109203 GGAGCAGCTGTTCCTCCTCGCGG + Exonic
914950595 1:152110405-152110427 GCTGCAGCTGCTCTTCCTCGCGG + Exonic
914950909 1:152112691-152112713 GCCGCCACAGCTCCTCGTCGCGG + Exonic
920600772 1:207321792-207321814 CGCGGCGCTGCCCCTCCTCGGGG + Exonic
922287652 1:224183648-224183670 GACGCGCCTGCGCCTCTTCGCGG - Intronic
924527276 1:244863738-244863760 GGGGCCGCTGCTCTTCCCCGCGG + Exonic
1070032706 10:72692500-72692522 GTCGCCCCTCCTCCTCCTCTCGG - Intronic
1071579410 10:86756329-86756351 GTCGGGGCTGCTCCTCCGCGCGG - Intergenic
1071601892 10:86962495-86962517 GGGGCCTCTGCTCCTCCTTGAGG + Intronic
1072757189 10:98029477-98029499 GCCGCCGCTGCTGCTGCTGGTGG - Intronic
1073443960 10:103569999-103570021 GAAGCTGCTCCTCCTCCTCTAGG + Intronic
1073544894 10:104339352-104339374 AACGCTGCTGCTGCTCCTCCAGG - Intergenic
1075871246 10:125773882-125773904 GACGCCGCTGGACTTCCGCGAGG - Exonic
1076900589 10:133335717-133335739 GCCGCCTCTGCTTCTCCTCCCGG + Intronic
1077063342 11:627101-627123 GCTGCTGCTGCTGCTCCTCGGGG - Exonic
1081641237 11:44755798-44755820 GAGGACGCTGCTCCTTCTTGGGG + Intronic
1082171829 11:49014089-49014111 GATGGCGTTGCTCCTCCTCCAGG + Intergenic
1083681255 11:64352846-64352868 GCCTCCGCAGCTCCTCCTCCAGG - Exonic
1085312948 11:75526598-75526620 GACCACGACGCTCCTCCTCGGGG - Intergenic
1086322420 11:85664660-85664682 GCCGCCGCGGCTCCCCCTCCCGG + Exonic
1086693939 11:89821864-89821886 GATGGCGTTGCTCCTCCTCCAGG - Intergenic
1086712208 11:90022705-90022727 GATGGCGTTGCTCCTCCTCCAGG + Intergenic
1089460103 11:118647959-118647981 GCCTCCGCCGCTCCTCCTCCAGG - Exonic
1091558607 12:1594227-1594249 GCCGCCGCCGCTCCTCCTCCTGG + Intronic
1094636396 12:32230688-32230710 GACGCCGCTTTTGCTCCACGTGG - Intronic
1096622617 12:52874088-52874110 GACGTCTCAGCTCCTCTTCGAGG - Intergenic
1103749865 12:123151148-123151170 GCCGCCGCCGCTCCCCCGCGCGG - Intergenic
1113861506 13:113490492-113490514 GACGCCACCGCTCCGGCTCGCGG + Intronic
1114656164 14:24316772-24316794 CACGCCCCTGCTCCTCCTCCAGG - Exonic
1115028551 14:28768100-28768122 GGCGCCGCTCCACCACCTCGCGG + Exonic
1122602937 14:102930295-102930317 GCCGCCGCTGCTGCGCCGCGCGG + Exonic
1124652341 15:31483320-31483342 GCCGCCGCCGCAGCTCCTCGCGG + Exonic
1127103153 15:55587945-55587967 GCGGCGGCTCCTCCTCCTCGCGG + Intronic
1127723037 15:61721465-61721487 GACGCAGCTGCTCCTCCAACAGG + Intergenic
1128813414 15:70587890-70587912 GATGCCCCTGCCCCTCCTCCTGG + Intergenic
1130115765 15:81002796-81002818 GACGCCGCAGCTGCTGCTGGAGG + Exonic
1132715826 16:1289404-1289426 GTCGCTGCTGCTTCTCTTCGTGG - Intergenic
1132796643 16:1727711-1727733 GACGCCTATGCTGCTCCTCGGGG + Intronic
1133332971 16:4987801-4987823 CACGCCCCTGCTCCACCTCCTGG - Intronic
1134614756 16:15642782-15642804 GGCGCCGCTGTTCCCCTTCGAGG - Intronic
1141419751 16:83905878-83905900 GGCGACGCTGCTCCTGCTCAGGG + Intronic
1142002203 16:87670386-87670408 GACGCCCCTGCTGCTCCCTGTGG + Intronic
1142210752 16:88807328-88807350 GCAGCCGCTGCTCCTGCTCCGGG - Exonic
1143296340 17:5874656-5874678 GACGCAGCTGCTGCTCCTGCTGG - Intronic
1143623842 17:8096741-8096763 GGCGGCGATGCTCCGCCTCGGGG + Exonic
1143636144 17:8164584-8164606 GACGCGGCTGCTCCTCTGAGGGG - Intergenic
1143679635 17:8466946-8466968 GACCCCGCTCCTCCTCCTCCTGG + Exonic
1145248467 17:21284800-21284822 GCCGCCGCTGCTCCTCCGCCTGG + Exonic
1145305105 17:21669775-21669797 GGCCTCGCTGCTCCTCCTCTGGG + Intergenic
1147752455 17:42744749-42744771 GCCCCCGCCGCTCCTCCTCCCGG + Intronic
1148346980 17:46909914-46909936 GACTGGGCTGCTCCTCCTCCTGG + Intergenic
1149994599 17:61400044-61400066 GGCGCAGCAGCTGCTCCTCGGGG - Exonic
1150561972 17:66302500-66302522 GCCCCCGCCGCTCGTCCTCGCGG + Intergenic
1151732224 17:75918220-75918242 GCCGCTGCAGCTGCTCCTCGTGG + Exonic
1156008448 18:32470494-32470516 GCCGCCGCTGCTCGCGCTCGCGG + Intergenic
1157805768 18:50656427-50656449 GAAGCTGCTGCTCCTTCTTGAGG - Intronic
1160563192 18:79771683-79771705 GGTGCCCCTGCTGCTCCTCGGGG - Intergenic
1160597600 18:79988124-79988146 GGAGCCGCGGCCCCTCCTCGGGG + Intronic
1160683277 19:422316-422338 GACGCAGCTGTTCCTCCGTGGGG + Exonic
1160810001 19:1009176-1009198 GCTGCTGCTGCTCCACCTCGGGG - Exonic
1160847363 19:1172512-1172534 GTCCCCGCTGCTCCTCTTCCAGG + Intronic
1161042304 19:2116649-2116671 GACGCCGCTGCTCCTCCTCGTGG + Exonic
1161736137 19:5993119-5993141 GCCACCTCTGTTCCTCCTCGTGG + Intergenic
1162349040 19:10137796-10137818 GACAGAGCGGCTCCTCCTCGAGG - Intronic
1162517219 19:11155692-11155714 GTCGCTGCTGCGCCTCCGCGCGG + Exonic
1164650533 19:29887892-29887914 GACACCTCTCATCCTCCTCGGGG - Intergenic
1166041580 19:40205964-40205986 GCCGCCGCAGCTGCTCCTCCTGG - Exonic
1166043808 19:40217997-40218019 GGCGCCGCTGCTCCTCGCTGAGG + Exonic
1166524337 19:43501790-43501812 CCCGCAGCTGCTCCTCCTCCCGG + Exonic
1166817243 19:45553705-45553727 CACGCTGCTCCTCCTCCTTGTGG + Intronic
1166862688 19:45819082-45819104 GAAGCCCCTGCTCCTCGTCAGGG + Intronic
1168316365 19:55486461-55486483 GCCGGCCCTGCTCCTCCTGGCGG + Exonic
927708612 2:25311962-25311984 CACGCCGCTGCTGCTGCTCTGGG - Intronic
930411219 2:51028246-51028268 GACGGCGCTGCTCCAGCGCGGGG - Exonic
932777805 2:74538985-74539007 GCTGCTGCTGCTCCTCCTCTTGG + Intronic
933945311 2:87281150-87281172 GACCCCGCTGCTCCTGCTGCTGG - Intergenic
936334896 2:111580441-111580463 GACCCCGCTGCTCCTGCTGCTGG + Intergenic
937906573 2:127055542-127055564 GACGCCGGTGCACAGCCTCGAGG + Intronic
939612937 2:144332305-144332327 GCCGCCGCTGCTGCCCCTCTGGG + Intronic
948893240 2:240916982-240917004 GAAGTCCCTGCTCCTCCTCCTGG - Intergenic
949019968 2:241735325-241735347 GAGGCTGCTGCTCCGCCCCGGGG + Exonic
1171522617 20:25787246-25787268 GGCCTCGCTGCTCCTCCTCTGGG + Intronic
1171554210 20:26068637-26068659 GGCCTCGCTGCTCCTCCTCTGGG - Intergenic
1174518125 20:51108973-51108995 CCCACAGCTGCTCCTCCTCGGGG + Intergenic
1174657264 20:52181952-52181974 GACTCAGCTGCTCCTCCTGATGG - Intronic
1174898585 20:54475641-54475663 GCCGCCGCCGCTCCTCCTCCTGG + Exonic
1176010127 20:62888983-62889005 GACGCCTCTGCTCTTTATCGTGG + Intronic
1176719191 21:10379495-10379517 GACTAGGCTGTTCCTCCTCGGGG - Intergenic
1179567852 21:42260338-42260360 GACGCTGCTGCTCCTGCCAGGGG + Intronic
1180300418 22:11032424-11032446 GACTAGGCTGTTCCTCCTCGGGG - Intergenic
1180782846 22:18530288-18530310 GACGCTGCCGCTCCTCTTCCTGG + Exonic
1181126409 22:20704319-20704341 GACGCTGCCGCTCCTCTTCCTGG + Intergenic
1181239744 22:21469650-21469672 GACGCTGCCGCTCCTCTTCCTGG + Intergenic
1181478312 22:23181664-23181686 GACGCCGCAGCTGCTCTCCGAGG - Exonic
1182122513 22:27797112-27797134 GGCGCCGCTGCTGCTCGTCGGGG + Exonic
1182552434 22:31107460-31107482 GGCGCTGCTGCTGCTTCTCGCGG - Exonic
950262193 3:11551194-11551216 GACGCACCCTCTCCTCCTCGGGG + Intronic
950508026 3:13407752-13407774 GGCACCGCTGGTCCTCCTTGAGG + Intronic
954693822 3:52410041-52410063 GACGGCCCTGCTCCGCCTCTGGG + Exonic
954694052 3:52410804-52410826 GCCTCCGCCGCTCCTCCTCGCGG - Exonic
961574498 3:127823326-127823348 GGCGCCCCCGCTCCTCCCCGCGG - Intergenic
967890595 3:194361666-194361688 GCCGCCGCTGCTGCACCTCCCGG - Intronic
968575837 4:1365767-1365789 GACGCACCTGCTCCACCTGGTGG + Intronic
968575852 4:1365824-1365846 GACGCACCTGCTCCACCTGGTGG + Intronic
968575877 4:1365938-1365960 GACGCACCTGCTCCACCTGGTGG + Intronic
968582973 4:1403482-1403504 GGCGCCGCTGCACCTCCCGGTGG + Exonic
968756300 4:2418034-2418056 GACCCTCCTGCTCCTCCTCTCGG - Intronic
968795296 4:2699733-2699755 GCCGCCTCTGCTCCTCCTGGAGG - Exonic
975401495 4:73944258-73944280 GGCGCTGCTGCTCCTGCTCCTGG - Intergenic
975409994 4:74038536-74038558 GGCGCTGCTGCTCCTGCTCCTGG - Exonic
975415382 4:74099045-74099067 GGCGCTGCTGCTCCTGCTCCTGG - Exonic
975778911 4:77819482-77819504 GCCGCCGCGGCTTCCCCTCGGGG - Intronic
977906525 4:102483442-102483464 GGGGGCGGTGCTCCTCCTCGGGG - Intergenic
978754237 4:112285739-112285761 CCGGCCGCTGCTCCTCCGCGCGG + Exonic
987132349 5:14871583-14871605 GCGGCGGCGGCTCCTCCTCGCGG + Exonic
997964326 5:138345552-138345574 GACGCCGGGGGTCTTCCTCGTGG - Exonic
999134075 5:149306208-149306230 GACACCCCTGCTCCACCTCAGGG - Intronic
999745485 5:154588641-154588663 GACTCTGCTTCTCTTCCTCGGGG + Intergenic
1002033388 5:176447436-176447458 GCCGCCGCCCCTTCTCCTCGAGG - Intergenic
1002534659 5:179869657-179869679 GACGCTGCTGTGCCCCCTCGAGG + Intronic
1005956205 6:30665211-30665233 AGCGCCGCTGCTCCTCCCCAGGG + Exonic
1009464449 6:63952781-63952803 GACACCTCTACTCCTCCTTGGGG + Intronic
1020383030 7:7566899-7566921 GGCGCCGCTGCGCGTCCTCCAGG + Exonic
1023610460 7:41966127-41966149 CCCGTCGCTGCACCTCCTCGGGG + Exonic
1026913635 7:74107003-74107025 GATGCTGCAGCTCCTCCTGGGGG - Exonic
1034351120 7:150415332-150415354 GACGCTGCTCCTGCTCCTCTAGG + Intergenic
1035570036 8:666773-666795 GGAGCCCCTCCTCCTCCTCGCGG + Intronic
1042784985 8:72537025-72537047 GACGCCGGGGCTCTGCCTCGCGG - Intergenic
1045547281 8:103140558-103140580 GGGGCCGCTGCTCCTGCTCCCGG + Intronic
1054731343 9:68705302-68705324 GGCGCCGCTGCTGCTCCTCTCGG + Intergenic
1057245653 9:93452038-93452060 GACCCCGCTGCGCCTGCTGGTGG + Exonic
1060480259 9:124013234-124013256 GGCGCCGCTGCTCCTGCTCCCGG - Intronic
1062518985 9:136949881-136949903 GGCGCGGCTGCTCCTCCCCGTGG + Intronic
1185541441 X:905891-905913 GACTACGCCGTTCCTCCTCGGGG + Intergenic
1186508058 X:10109964-10109986 CACGCCGCAGCTCCTCCTCTAGG - Exonic
1189041522 X:37545330-37545352 GTCTCCGCTGCCCCTCTTCGAGG - Intronic
1189305588 X:39984545-39984567 GACATCTCTGCTCCTCCTGGTGG - Intergenic
1197754459 X:129984185-129984207 GCCGCCGCTGCTGCTCCTGCTGG + Intronic
1200231989 X:154448686-154448708 GAAGCCGATTCTCCTCCTCCTGG - Exonic