ID: 1161042543 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 19:2117668-2117690 |
| Sequence | CAGAGGCGGGGAGCCCGCGG GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1161042543_1161042555 | 10 | Left | 1161042543 | 19:2117668-2117690 | CCCCCGCGGGCTCCCCGCCTCTG | No data | ||
| Right | 1161042555 | 19:2117701-2117723 | AACTCAGACACAGCCAGGCTGGG | No data | ||||
| 1161042543_1161042554 | 9 | Left | 1161042543 | 19:2117668-2117690 | CCCCCGCGGGCTCCCCGCCTCTG | No data | ||
| Right | 1161042554 | 19:2117700-2117722 | CAACTCAGACACAGCCAGGCTGG | No data | ||||
| 1161042543_1161042552 | 5 | Left | 1161042543 | 19:2117668-2117690 | CCCCCGCGGGCTCCCCGCCTCTG | No data | ||
| Right | 1161042552 | 19:2117696-2117718 | GCTCCAACTCAGACACAGCCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1161042543 | Original CRISPR | CAGAGGCGGGGAGCCCGCGG GGG (reversed) | Intronic | ||