ID: 1161042543

View in Genome Browser
Species Human (GRCh38)
Location 19:2117668-2117690
Sequence CAGAGGCGGGGAGCCCGCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161042543_1161042555 10 Left 1161042543 19:2117668-2117690 CCCCCGCGGGCTCCCCGCCTCTG No data
Right 1161042555 19:2117701-2117723 AACTCAGACACAGCCAGGCTGGG No data
1161042543_1161042554 9 Left 1161042543 19:2117668-2117690 CCCCCGCGGGCTCCCCGCCTCTG No data
Right 1161042554 19:2117700-2117722 CAACTCAGACACAGCCAGGCTGG No data
1161042543_1161042552 5 Left 1161042543 19:2117668-2117690 CCCCCGCGGGCTCCCCGCCTCTG No data
Right 1161042552 19:2117696-2117718 GCTCCAACTCAGACACAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161042543 Original CRISPR CAGAGGCGGGGAGCCCGCGG GGG (reversed) Intronic