ID: 1161043787

View in Genome Browser
Species Human (GRCh38)
Location 19:2123762-2123784
Sequence GGCCACACCTTTCCACAGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 295
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 263}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161043787_1161043793 -1 Left 1161043787 19:2123762-2123784 CCCGCCTGTGGAAAGGTGTGGCC 0: 1
1: 0
2: 1
3: 30
4: 263
Right 1161043793 19:2123784-2123806 CTCTGCAGTGTGGGACCCCATGG 0: 1
1: 0
2: 1
3: 35
4: 643
1161043787_1161043803 26 Left 1161043787 19:2123762-2123784 CCCGCCTGTGGAAAGGTGTGGCC 0: 1
1: 0
2: 1
3: 30
4: 263
Right 1161043803 19:2123811-2123833 CGCCCAGTGCGGGACGTACCTGG 0: 1
1: 0
2: 0
3: 1
4: 28
1161043787_1161043799 16 Left 1161043787 19:2123762-2123784 CCCGCCTGTGGAAAGGTGTGGCC 0: 1
1: 0
2: 1
3: 30
4: 263
Right 1161043799 19:2123801-2123823 CCATGGGCCCCGCCCAGTGCGGG 0: 1
1: 0
2: 1
3: 27
4: 317
1161043787_1161043794 0 Left 1161043787 19:2123762-2123784 CCCGCCTGTGGAAAGGTGTGGCC 0: 1
1: 0
2: 1
3: 30
4: 263
Right 1161043794 19:2123785-2123807 TCTGCAGTGTGGGACCCCATGGG 0: 1
1: 1
2: 1
3: 11
4: 106
1161043787_1161043791 -10 Left 1161043787 19:2123762-2123784 CCCGCCTGTGGAAAGGTGTGGCC 0: 1
1: 0
2: 1
3: 30
4: 263
Right 1161043791 19:2123775-2123797 AGGTGTGGCCTCTGCAGTGTGGG 0: 1
1: 0
2: 2
3: 26
4: 272
1161043787_1161043797 15 Left 1161043787 19:2123762-2123784 CCCGCCTGTGGAAAGGTGTGGCC 0: 1
1: 0
2: 1
3: 30
4: 263
Right 1161043797 19:2123800-2123822 CCCATGGGCCCCGCCCAGTGCGG 0: 1
1: 1
2: 0
3: 27
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161043787 Original CRISPR GGCCACACCTTTCCACAGGC GGG (reversed) Intronic
900179877 1:1306390-1306412 GCCCACACCTCCCCACAGCCCGG + Intronic
900354765 1:2255159-2255181 CTCCCCAACTTTCCACAGGCAGG + Intronic
900482480 1:2905787-2905809 GGCCACGGCTTTTCAGAGGCAGG - Intergenic
901132930 1:6973875-6973897 TGCCCCACCTTCCCACAGCCGGG + Intronic
902938303 1:19780663-19780685 AGCCACACCTGCCCACGGGCCGG - Exonic
903337456 1:22634685-22634707 GGCAGCTCCTTTCCACAGCCAGG + Intergenic
904443830 1:30551454-30551476 GGCCACTCCTCTCCATAGCCAGG - Intergenic
904551823 1:31325194-31325216 GGTAGCTCCTTTCCACAGGCAGG - Intronic
907020305 1:51060293-51060315 GGTAGCTCCTTTCCACAGGCAGG - Intergenic
907369583 1:53992264-53992286 GGCAGCTCCTTTCCACAGCCTGG + Intergenic
909197823 1:72649164-72649186 GGTAGCTCCTTTCCACAGGCAGG - Intergenic
910059865 1:83077558-83077580 GGCCAGACCTTAACACTGGCTGG - Intergenic
910101425 1:83582517-83582539 GGTAGCTCCTTTCCACAGGCAGG + Intergenic
910259912 1:85284580-85284602 GGCAGCTCCTCTCCACAGGCAGG - Intergenic
911025775 1:93434489-93434511 GGTAACTCCTCTCCACAGGCAGG + Intergenic
912094502 1:106121471-106121493 GGCATCTCCTTCCCACAGGCAGG - Intergenic
912544795 1:110442954-110442976 TTCCATATCTTTCCACAGGCTGG - Intergenic
914839595 1:151237156-151237178 GGCTACTCCTTTCCAGAAGCTGG - Intronic
915229042 1:154432311-154432333 TGACAGAGCTTTCCACAGGCTGG - Intronic
919077533 1:192831396-192831418 GACCACATCTTTTCACAGCCTGG - Intergenic
919249134 1:195030402-195030424 GGTAGCTCCTTTCCACAGGCAGG + Intergenic
919253947 1:195096988-195097010 GGCAGCTCCTTTCCACAGACAGG - Intergenic
919264041 1:195238054-195238076 GGTAACTCCTTTCCACAGGCAGG - Intergenic
920093267 1:203469457-203469479 GACCACACATGTCCACAGACTGG + Intergenic
920783305 1:209015489-209015511 GGCCCCACCTTTTGAAAGGCAGG + Intergenic
921625415 1:217373366-217373388 GGCAGCTCCTCTCCACAGGCAGG - Intergenic
921674652 1:217964811-217964833 GGTAACTCCTTTCCACAGGCAGG + Intergenic
921675258 1:217968950-217968972 GGTAACTCCTTTCCACAGGCAGG - Intergenic
921766894 1:218983126-218983148 GGTAGCTCCTTTCCACAGGCAGG + Intergenic
923998176 1:239520430-239520452 TGCCACACCGTTCAACAGCCAGG - Intronic
1062926747 10:1321853-1321875 GGACACACATGCCCACAGGCAGG - Intronic
1064115858 10:12576972-12576994 CTCCACCCCTTTCCCCAGGCTGG - Intronic
1068938480 10:62658227-62658249 GGTAACTCCTTTCCACAGACAGG - Intronic
1070647899 10:78214211-78214233 GGCCATCCCATTCCACAGGAGGG + Intergenic
1071651359 10:87395778-87395800 GGCCACCCCAGTTCACAGGCAGG - Intergenic
1071819322 10:89264343-89264365 GGTAGCTCCTTTCCACAGGCAGG + Intronic
1072781418 10:98254410-98254432 GGCCGCAGCTTGCCCCAGGCTGG + Intronic
1074301787 10:112240167-112240189 GGTAGCACATTTCCACAGGCAGG + Intergenic
1075024870 10:118977157-118977179 GGCCAGACTTTTCCATTGGCTGG - Intergenic
1076703992 10:132291287-132291309 GGCCACACAGGTCCACAGGAAGG + Intronic
1076781226 10:132725680-132725702 GTGCACAGCTGTCCACAGGCAGG - Intronic
1077390695 11:2299490-2299512 GGACACAGCTTTCCAGAGGAGGG + Exonic
1077533532 11:3108193-3108215 TGGCACACCTGTCCCCAGGCCGG - Intronic
1077835551 11:5923772-5923794 TGCATCCCCTTTCCACAGGCAGG - Intronic
1078364518 11:10695000-10695022 GTCCACACCTGTCCACATGGAGG + Intergenic
1078407835 11:11086834-11086856 GGCCAGTCCTTCCCACAGCCTGG + Intergenic
1078874343 11:15378531-15378553 GGTAGCTCCTTTCCACAGGCGGG - Intergenic
1081082224 11:38756467-38756489 GGTGGCTCCTTTCCACAGGCAGG + Intergenic
1083307431 11:61768670-61768692 GGCCACAGCCTTCCACTTGCTGG + Intronic
1083457688 11:62789969-62789991 GGTCACCCCTCTCCAGAGGCCGG - Exonic
1083545432 11:63545726-63545748 AGCTACACCTTTGCACAGGGAGG - Intronic
1083587489 11:63870840-63870862 GGCCACAGCTTTCCACTGCCTGG - Intronic
1083611513 11:64006683-64006705 GGCCACAACTTTGACCAGGCAGG - Intronic
1083640566 11:64143082-64143104 GGTCACACTGTTCCCCAGGCTGG - Intronic
1083776188 11:64895314-64895336 GGCCACACCCTCCCGCAGGTCGG + Exonic
1084426646 11:69087655-69087677 GGCCACGTCTTCCCACTGGCTGG - Intronic
1084657162 11:70526422-70526444 TGCTTCACCTTTCCACATGCAGG + Intronic
1084718965 11:70891973-70891995 GGCCACCCCTGTCCTCAGCCGGG - Intronic
1085364805 11:75929840-75929862 TTCCCCACCTTTCCACATGCTGG - Intronic
1085403965 11:76250744-76250766 GGTAGCTCCTTTCCACAGGCAGG - Intergenic
1085435056 11:76492979-76493001 GGTAGCTCCTTTCCACAGGCAGG - Intronic
1086334280 11:85783954-85783976 GGCCACAGATTTCCTCAGACTGG + Intronic
1087453384 11:98353128-98353150 GGTAGCTCCTTTCCACAGGCAGG + Intergenic
1087534358 11:99424941-99424963 GGTTGCTCCTTTCCACAGGCAGG + Intronic
1089307983 11:117538724-117538746 GGCCCCACCTTTGCAGAGGGTGG - Intronic
1089591940 11:119547219-119547241 GGCAGCTCCTTTCCACAGCCAGG - Intergenic
1089635319 11:119808071-119808093 TGCCACTCCCTGCCACAGGCTGG - Intergenic
1090041965 11:123299409-123299431 GGTAGCTCCTTTCCACAGGCAGG - Intergenic
1091715486 12:2773459-2773481 GGCCAGTACTTTCCACAGGAGGG + Intergenic
1092118497 12:6026466-6026488 GGACTCACCTTCCCAGAGGCAGG - Intronic
1093621708 12:21298337-21298359 GGCCACACATTACTAGAGGCAGG - Intronic
1095603210 12:44037744-44037766 GGTCACTCCTCTCCACAGGCAGG - Intronic
1095942240 12:47734953-47734975 GGCCACGCCTCCCCACAGACGGG - Intronic
1098671402 12:73235142-73235164 GGCAGCTCCTTTCTACAGGCAGG + Intergenic
1099033760 12:77560299-77560321 GGTAGCTCCTTTCCACAGGCAGG - Intergenic
1101489328 12:105197073-105197095 GGCCACTCCTCTCCCCAGGCAGG + Intronic
1102867115 12:116383168-116383190 GGCCACACCTTTGCACACCCAGG - Intergenic
1104966657 12:132511412-132511434 GGCAACACCTGACCACAGGTGGG - Intronic
1105787026 13:23759718-23759740 GCCCACCCCTTTCCACAGAATGG - Intronic
1105988646 13:25595404-25595426 GGCCACACCCATCCACAGAGAGG - Intronic
1106977471 13:35237378-35237400 GGACATACATTTCTACAGGCTGG - Intronic
1107841192 13:44459331-44459353 GGTAGCTCCTTTCCACAGGCAGG - Intronic
1109687811 13:65844004-65844026 GGTAGCTCCTTTCCACAGGCAGG - Intergenic
1111347328 13:86975118-86975140 GGTAGCTCCTTTCCACAGGCAGG - Intergenic
1112422777 13:99268139-99268161 GGCCACACCTAATCACAGGGAGG + Intronic
1113229338 13:108195231-108195253 GGTAGCTCCTTTCCACAGGCAGG - Intergenic
1113503102 13:110793693-110793715 GGTAGCTCCTTTCCACAGGCTGG - Intergenic
1114344553 14:21781341-21781363 GGTAGCTCCTTTCCACAGGCAGG - Intergenic
1116830862 14:49718308-49718330 GGTCTCACCTTTGCCCAGGCAGG + Intronic
1117258309 14:54002859-54002881 GGCCACATCATCACACAGGCAGG - Intergenic
1119029109 14:71177512-71177534 GGCCACAGCTCTCCACAGGAAGG - Intergenic
1119554587 14:75543225-75543247 GGCCACACCTTGCAGAAGGCAGG + Intronic
1119686214 14:76633764-76633786 GGCCTCACTTTTCCACAGTGTGG - Intergenic
1122353763 14:101111790-101111812 GCCCCCACCCTTCCTCAGGCAGG + Intergenic
1122606285 14:102948866-102948888 GGGCACACCTGTGCACAGCCAGG + Intronic
1123106060 14:105841599-105841621 GGCCACACCTGGCCAGAAGCTGG - Intergenic
1123724589 15:23089343-23089365 TGCCACACTTTTGCACAGGGAGG + Intergenic
1125862098 15:43008838-43008860 GGTATCTCCTTTCCACAGGCAGG - Intronic
1128074897 15:64819934-64819956 GGCCACAGCTTCCCACAAGGTGG - Exonic
1128345343 15:66849557-66849579 GGCCAGGCCTCTCCGCAGGCTGG + Intergenic
1130183229 15:81652119-81652141 GGCAGCTCCTTTCCACAGCCAGG - Intergenic
1130537429 15:84797427-84797449 GCCCATGCCTTCCCACAGGCTGG - Intronic
1131022665 15:89112478-89112500 GGCCCCACCTCACCACAGCCTGG + Intronic
1134674964 16:16083765-16083787 GTCCACAGCTTTCCAAAGGGGGG + Intronic
1135507188 16:23049093-23049115 GACCATACCTATCCACAGGAAGG + Intergenic
1136515852 16:30768027-30768049 AGCCAAACCTTTTCCCAGGCAGG - Intronic
1137588696 16:49680259-49680281 GGCCACTCCTTCCCATGGGCAGG - Intronic
1138277261 16:55744104-55744126 AGACACACCTTTGCACAGGAAGG + Intergenic
1138285788 16:55809325-55809347 TGACACACCTTTGCACAGGAAGG - Intronic
1140834530 16:78780972-78780994 GGCCACACCAGTCTGCAGGCTGG - Intronic
1141033416 16:80608747-80608769 AGCCCCACCTCTCCACAGGCCGG - Intronic
1142960486 17:3549396-3549418 GGCCACGACTTTCCACACTCTGG + Intronic
1144670232 17:17128724-17128746 GCCCTCACCTTCCCACAAGCTGG + Intronic
1149197113 17:54134239-54134261 GGCCTCACTCTTGCACAGGCTGG - Intergenic
1149238018 17:54616158-54616180 GGCAGCTCCTTTCCACAGCCAGG - Intergenic
1150232992 17:63568750-63568772 GACAACAGCTTTCCACTGGCCGG - Intronic
1150284367 17:63946895-63946917 GGCCAGACCTGGCCTCAGGCAGG + Intronic
1150951024 17:69802203-69802225 GGCAGCTCCTTTCCACAGCCAGG - Intergenic
1151744166 17:76002633-76002655 GGCCACAGGGTGCCACAGGCAGG + Intronic
1153698959 18:7673217-7673239 TGCCACACCTTGGCATAGGCAGG + Intronic
1154006452 18:10532756-10532778 GGCAACAGCTTCCCTCAGGCAGG - Exonic
1156713214 18:39974124-39974146 AGCAATACCTTTCCACACGCAGG + Intergenic
1159458583 18:68693983-68694005 GGTAGCTCCTTTCCACAGGCAGG - Intronic
1160354680 18:78216769-78216791 GGCCGCCCCCTTCCCCAGGCAGG - Intergenic
1161043787 19:2123762-2123784 GGCCACACCTTTCCACAGGCGGG - Intronic
1161454942 19:4365418-4365440 GGCCACACCTCAACACAGGCAGG - Intronic
1162554300 19:11377089-11377111 GGTCTCACTTTTGCACAGGCTGG - Intergenic
1163847753 19:19646907-19646929 GTCCACACCTGTCCACAGGTAGG - Intronic
1164669216 19:30063340-30063362 AGCCTCACCTGCCCACAGGCGGG + Intergenic
1164984467 19:32638338-32638360 GGCAGCTTCTTTCCACAGGCAGG - Intronic
1167136428 19:47618871-47618893 GGAGCCACCTTTCCAGAGGCTGG + Intronic
925284811 2:2709012-2709034 GGCCTCACCTTCCCAGAGACTGG - Intergenic
926109302 2:10171930-10171952 GTCCCCACCTGTCCAGAGGCTGG + Intronic
926554591 2:14342055-14342077 GGCAACTCCTTTCCACAGGCAGG - Intergenic
927015313 2:18953234-18953256 GCACACACATTTCCACATGCGGG - Intergenic
927126497 2:20016554-20016576 GGCCACACCTGGCCACAAGGGGG + Intergenic
928182668 2:29080576-29080598 GGCAGCTCCTTTCCACAGGCAGG + Intergenic
929847086 2:45541573-45541595 GGCAGCTCCTTTCCGCAGGCAGG + Intronic
930380521 2:50622120-50622142 GGCCAATCCTCTCCAAAGGCAGG + Intronic
932643726 2:73479791-73479813 GGCCACACCTTTTTCCAGGGTGG + Intronic
933454951 2:82508372-82508394 GGTAGCTCCTTTCCACAGGCAGG - Intergenic
934138225 2:89018493-89018515 GGCCACAGCTTTCCACCTGCAGG - Intergenic
934143335 2:89069573-89069595 GGCCACAGCTTTCCACCTGCAGG - Intergenic
934225906 2:90130982-90131004 GGCCACAGCTTTCCACCTGCAGG + Intergenic
934231022 2:90182133-90182155 GGCCACAGCTTTCCACCTGCAGG + Intergenic
934845252 2:97658162-97658184 GGCTACCCCTTCCCCCAGGCTGG + Intronic
936085296 2:109463444-109463466 AGTCACACTTCTCCACAGGCCGG - Intronic
937167850 2:119837361-119837383 GGTGGCTCCTTTCCACAGGCAGG - Intronic
937331334 2:121032176-121032198 TGCCACACCACTGCACAGGCAGG - Intergenic
940956921 2:159738547-159738569 GGTGGCTCCTTTCCACAGGCAGG + Intronic
943129378 2:183837937-183837959 GACAGCTCCTTTCCACAGGCAGG - Intergenic
943191654 2:184685590-184685612 GGTAGCTCCTTTCCACAGGCAGG + Intronic
943932209 2:193868461-193868483 GGTAACTCCTTTCCACAGTCAGG - Intergenic
943965588 2:194328061-194328083 GGTAACTCCTCTCCACAGGCAGG - Intergenic
946495631 2:220192727-220192749 GGTAGCTCCTTTCCACAGGCAGG - Intergenic
947154259 2:227145569-227145591 GGTCACACCATTCCAAAGGATGG + Intronic
947417365 2:229910741-229910763 GGCAACACTTTTCAAAAGGCAGG + Intronic
947449903 2:230198205-230198227 TTCCACACACTTCCACAGGCGGG + Intronic
948627657 2:239279049-239279071 GGCCACACCCTGCCCCAGGCGGG + Intronic
1169632317 20:7647407-7647429 GGTAGCTCCTTTCCACAGGCAGG + Intergenic
1169880539 20:10341902-10341924 GGCCGCTCCTTTCTGCAGGCAGG - Intergenic
1170314888 20:15031512-15031534 GGTAGCACCTTTCCTCAGGCAGG + Intronic
1170314901 20:15031582-15031604 GGTAGCTCCTTTCCACAGGCAGG + Intronic
1170917772 20:20644788-20644810 GCCCACACCTTTCCTCAACCTGG + Intronic
1172179099 20:32989817-32989839 AGCCACAGGCTTCCACAGGCAGG - Intronic
1172941762 20:38659147-38659169 GCCCACACCTGCCCACAGCCAGG - Intergenic
1173384778 20:42577311-42577333 GGCCACACCTCTGCACAAGGCGG + Intronic
1173878013 20:46388519-46388541 TGCCACACTTTTGCACAGGGAGG - Intronic
1174285224 20:49468099-49468121 GGCCACTTCTTTCTGCAGGCAGG + Intronic
1175138594 20:56843023-56843045 GGAAGCTCCTTTCCACAGGCAGG - Intergenic
1175260846 20:57673185-57673207 GGCCACACCTTTGCCCGGGCTGG + Intronic
1175934257 20:62507831-62507853 GGCCACACCGCATCACAGGCAGG - Intergenic
1175988952 20:62778064-62778086 GACCACACCTTCAGACAGGCTGG - Intergenic
1176367870 21:6044664-6044686 AGCCACACTTTACCACCGGCTGG + Intergenic
1177037355 21:16060566-16060588 GGTATCTCCTTTCCACAGGCAGG + Intergenic
1179755649 21:43493878-43493900 AGCCACACTTTACCACCGGCTGG - Intergenic
1180353984 22:11824210-11824232 GGCCACACCTTTCCGCGGCACGG + Intergenic
1180384261 22:12168115-12168137 GGCCACACCTTTCCGCGGCACGG - Intergenic
1181047161 22:20220592-20220614 GTCCACACCCTTCCGCAGTCGGG + Intergenic
1183714394 22:39525298-39525320 GGCCACAAGTTGCCACATGCAGG - Intergenic
1184507759 22:44914427-44914449 GGCCACACCTCTCCCCAGGGAGG + Intronic
949218501 3:1600834-1600856 GGCAGCTCCTTTCCACAGCCAGG + Intergenic
950479399 3:13235315-13235337 GGCCACACCCTTCCCCTGGCTGG + Intergenic
952152507 3:30607458-30607480 GGCCACGCTTTCCCTCAGGCCGG + Intronic
957307801 3:78480780-78480802 GGTAGCTCCTTTCCACAGGCAGG - Intergenic
957614082 3:82505949-82505971 CGCAGCTCCTTTCCACAGGCAGG - Intergenic
957775825 3:84756586-84756608 GGTAGCTCCTTTCCACAGGCAGG + Intergenic
958161191 3:89818482-89818504 GGTAGCTCCTTTCCACAGGCAGG + Intergenic
958433966 3:94075271-94075293 AGCCACACCATTTCACAGACAGG + Intronic
959420216 3:106119126-106119148 GGGCACACCTTTTTATAGGCAGG + Intergenic
961391290 3:126553664-126553686 AGCCACGCCTGTCCACAGCCCGG + Intronic
962258338 3:133887137-133887159 GGGCACCCCTTTCCACAGCCTGG - Intronic
962346136 3:134620187-134620209 GCCCACAGCTCTCCACAGGATGG - Intronic
962990591 3:140573875-140573897 GGCAACACCTCCCCAGAGGCAGG + Exonic
964075165 3:152684354-152684376 GGTAGCTCCTTTCCACAGGCAGG + Intergenic
964075178 3:152684423-152684445 GGTAGCTCCTTTCCACAGGCAGG + Intergenic
966259668 3:177960849-177960871 GGCCAGGCATTTCCACAGGGTGG - Intergenic
968491667 4:893514-893536 GGCCCCACGGTTCCCCAGGCGGG + Intronic
968538597 4:1150731-1150753 GGCAGCTCCTTTCCACAGCCAGG + Intergenic
968614858 4:1572823-1572845 GGCCACACCTTTTCACAGCTGGG - Intergenic
968712514 4:2129178-2129200 GGCCACACCTTTCTAGCAGCAGG - Exonic
968874356 4:3257508-3257530 GGCCTCTCCTTCACACAGGCAGG - Intronic
970445170 4:16117351-16117373 GGCCAGACGTTTTCACAGGTTGG - Intergenic
971784307 4:31081015-31081037 GGACTCACATTTCCACAGGTTGG - Intronic
971867415 4:32190288-32190310 GGTAGCTCCTTTCCACAGGCAGG - Intergenic
974420171 4:61662837-61662859 GGTAGCACCTCTCCACAGGCAGG - Intronic
974628927 4:64458052-64458074 GGTAGCTCCTTTCCACAGGCAGG - Intergenic
975023594 4:69521071-69521093 GGTAGCTCCTTTCCACAGGCTGG - Intronic
975498357 4:75058190-75058212 AGTAACTCCTTTCCACAGGCAGG - Intergenic
977410321 4:96653792-96653814 GGTAGCTCCTTTCCACAGGCAGG - Intergenic
978723559 4:111943982-111944004 GGACCCTCCTTTTCACAGGCGGG - Intergenic
979963854 4:127053683-127053705 ACCCACACCCCTCCACAGGCTGG + Intergenic
980671180 4:136008888-136008910 GGTAGCTCCTTTCCACAGGCAGG - Intergenic
983323823 4:166227807-166227829 GGTAGCTCCTTTCCACAGGCAGG - Intergenic
983852782 4:172603379-172603401 GGCCATACCGTCCCACAGGCAGG + Intronic
984375377 4:178922575-178922597 GGTAGCTCCTTTCCACAGGCAGG - Intergenic
984944702 4:184961873-184961895 GGCCACACCCATCCTCAGGGCGG - Intergenic
985916202 5:2920749-2920771 GGTAACTCCTCTCCACAGGCAGG - Intergenic
986021629 5:3809643-3809665 GGACACACCTACCCACAGGGTGG + Intergenic
987875450 5:23675116-23675138 GGTAGCTCCTTTCCACAGGCAGG - Intergenic
989730435 5:44641672-44641694 GGTAACTCCTTTCCACAGGCAGG + Intergenic
989732519 5:44664973-44664995 GGCAACTCCTCTCCACAGGCAGG - Intergenic
990641725 5:57792863-57792885 GGTCACACCGTTGCACAGCCTGG + Intergenic
992660929 5:78959914-78959936 GACCACAGCTGTTCACAGGCAGG - Intronic
992947124 5:81822003-81822025 GGCCACACTCTTCTACAGCCAGG + Intergenic
994451602 5:99950846-99950868 GGGAGCTCCTTTCCACAGGCAGG - Intergenic
995146055 5:108787745-108787767 GGCAGCTCCTTTCCACAGGCAGG - Intronic
995392961 5:111659874-111659896 GGACTCACAGTTCCACAGGCTGG + Intergenic
995501047 5:112807196-112807218 GGTCAACACTTTCCACAGGCTGG - Intronic
996934236 5:128929574-128929596 GGCCACTCCGTTTCACATGCTGG + Intronic
997042759 5:130277628-130277650 GGTAGCTCCTTTCCACAGGCAGG + Intergenic
998204926 5:140151432-140151454 GGCCACACCTCTCCACAATGCGG - Intergenic
999737942 5:154526672-154526694 GGCCACACCCTTCCACAACACGG - Intergenic
1001773876 5:174314496-174314518 GGCGACAACCTGCCACAGGCCGG - Intergenic
1003656364 6:8014047-8014069 AGCCATACATTTACACAGGCAGG + Exonic
1004868764 6:19881633-19881655 TACCACTCATTTCCACAGGCAGG - Intergenic
1007624138 6:43233379-43233401 GGCCACACCTCTGCTCTGGCTGG + Intergenic
1008381310 6:50842159-50842181 GGCCACAGCTTTTCACAGATGGG - Intronic
1009243339 6:61204810-61204832 GGCAGCTCCTCTCCACAGGCAGG + Intergenic
1009353363 6:62709177-62709199 TGCCTCCCATTTCCACAGGCAGG + Intergenic
1015663784 6:135604200-135604222 GGCAGCTCCTTTCCACAGCCAGG - Intergenic
1016076715 6:139804842-139804864 GGTTGCTCCTTTCCACAGGCAGG + Intergenic
1016457313 6:144244817-144244839 TGCCTCCCCTTTCCACAGGCAGG + Intergenic
1016814285 6:148289349-148289371 GCTCACGCCTTTCCACAGGAAGG - Intronic
1018774030 6:166998244-166998266 GGCCGCGCCTTTCCCGAGGCCGG - Intergenic
1019525986 7:1480780-1480802 GGCCCCACCCCTCCCCAGGCTGG + Intronic
1022421917 7:30231293-30231315 TGCCAGACCCTTCCACTGGCTGG + Intergenic
1023981686 7:45074139-45074161 GGCTTCACCTCTGCACAGGCTGG - Intronic
1024009694 7:45257182-45257204 GGCCACCACTTGCCCCAGGCAGG - Intergenic
1024857004 7:53794245-53794267 GGTAGCTCCTTTCCACAGGCAGG + Intergenic
1026391994 7:69911604-69911626 GGTAACTCCTTTCCACAGGCAGG + Intronic
1027734894 7:81920276-81920298 GGTAGCTCCTTTCCACAGGCAGG + Intergenic
1027924874 7:84447607-84447629 GGTAGCTCCTTTCCACAGGCAGG - Intronic
1028054501 7:86225762-86225784 GGTAGCTCCTTTCCACAGGCAGG + Intergenic
1028160987 7:87484177-87484199 TCCCTCCCCTTTCCACAGGCAGG - Intergenic
1028241822 7:88431113-88431135 GACCACACCATTGCACAGCCTGG - Intergenic
1030359486 7:108580026-108580048 GGTAGCTCCTTTCCACAGGCAGG - Intergenic
1030922710 7:115412067-115412089 AGTCACATCTTTCCACAGGAAGG - Intergenic
1030981068 7:116186035-116186057 GGTAGCTCCTTTCCACAGGCAGG + Intergenic
1032425359 7:131818420-131818442 GCCCTCTCCTTTCCAGAGGCAGG - Intergenic
1034481303 7:151321936-151321958 GGCAGCTCCTTTCCACAGCCAGG - Intergenic
1035602730 8:906301-906323 AGACACACGTTTCCACAGGGAGG - Intergenic
1035643300 8:1200003-1200025 CCCCACACTTTTCCACAGGATGG - Intergenic
1036935738 8:13000807-13000829 AACCACACCTTTCCCAAGGCAGG - Intronic
1037261637 8:17015715-17015737 TGCCTCACCTTTCCCAAGGCTGG - Intergenic
1038921641 8:32091538-32091560 AGCCACACATGCCCACAGGCTGG + Intronic
1039210109 8:35204304-35204326 GGTAGCTCCTTTCCACAGGCAGG + Intergenic
1039273657 8:35910964-35910986 GGACTCACAGTTCCACAGGCTGG + Intergenic
1042625142 8:70749012-70749034 GGTAGCTCCTTTCCACAGGCAGG - Intronic
1043180551 8:77082696-77082718 GGTAGCTCCTTTCCACAGGCAGG + Intergenic
1045873400 8:106950569-106950591 GGTAGCTCCTTTCCACAGGCAGG - Intergenic
1047361710 8:124175200-124175222 GGCCCCAGCTTGCAACAGGCAGG - Intergenic
1048614526 8:136059096-136059118 TGCCCCACCTTCCCTCAGGCTGG + Intergenic
1049140526 8:140950045-140950067 GGTAGCTCCTTTCCACAGGCAGG - Intronic
1049342909 8:142123313-142123335 GGCCTCACCTTCCCCCAAGCTGG - Intergenic
1052609818 9:30758436-30758458 AGACCCTCCTTTCCACAGGCAGG + Intergenic
1055744589 9:79428888-79428910 GGCTACTCCTCTCCTCAGGCTGG - Intergenic
1057668149 9:97062956-97062978 GTCCATACCTTTCCACAGGAAGG - Intergenic
1058280174 9:103103860-103103882 GGTAGCTCCTTTCCACAGGCAGG - Intergenic
1058545728 9:106059108-106059130 GGTAGCTCCTTTCCACAGGCAGG + Intergenic
1061767993 9:132894550-132894572 GACCACGCCCTGCCACAGGCTGG + Exonic
1061928636 9:133820729-133820751 GGCCACAGCTGTCCACTGGGAGG + Intronic
1062102290 9:134734528-134734550 AGACACCCCCTTCCACAGGCCGG - Intronic
1062119667 9:134827535-134827557 GGCCACCCATTTGCAGAGGCAGG - Intronic
1186223588 X:7374975-7374997 GGTAGCTCCTTTCCACAGGCAGG + Intergenic
1188647917 X:32592500-32592522 GGTAGCTCCTTTCCACAGGCAGG - Intronic
1188727725 X:33606756-33606778 GGTAGCTCCTTTCCACAGGCAGG + Intergenic
1190621159 X:52288177-52288199 GGCAGCTCCTTTCTACAGGCAGG - Intergenic
1190621198 X:52288391-52288413 GGCAGCTCCTTTCTACAGGCAGG - Intergenic
1195179019 X:102339062-102339084 GACAGCTCCTTTCCACAGGCAGG + Intergenic
1197028284 X:121782341-121782363 TGCCTCTCCTTTCCAAAGGCAGG + Intergenic
1200749126 Y:6928953-6928975 GGTAACTCCTTTCCACAGGCAGG + Intronic
1201583772 Y:15538074-15538096 GGCCCCTCCTTTCAACAGGGAGG + Intergenic
1202341550 Y:23874236-23874258 GGTAACTCCTCTCCACAGGCTGG - Intergenic
1202529216 Y:25795850-25795872 GGTAACTCCTCTCCACAGGCTGG + Intergenic