ID: 1161044294

View in Genome Browser
Species Human (GRCh38)
Location 19:2126873-2126895
Sequence TACCCAAGGGGACTCCAGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 103}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161044294 Original CRISPR TACCCAAGGGGACTCCAGAG TGG Intronic
900777636 1:4596563-4596585 TGGCCGAGGGGGCTCCAGAGGGG - Intergenic
901050493 1:6423803-6423825 GCCCCCACGGGACTCCAGAGGGG + Intronic
901959112 1:12810469-12810491 GAGCCAGGGGGACTCCAGAAAGG - Intergenic
905170773 1:36108408-36108430 TTCCCAAGGGGTCACCAGAGAGG - Intronic
905225070 1:36473582-36473604 GACCCAAGGGGACTCCATCCTGG - Exonic
905396527 1:37669968-37669990 TGCCCAAGGAGACGGCAGAGAGG - Intergenic
907501300 1:54883516-54883538 TAGCCAAGGGCATTGCAGAGTGG - Intronic
913328607 1:117649344-117649366 TACCCAAGAAGCCTCCAGAGAGG - Intergenic
919853148 1:201687397-201687419 GAACCTAGGGGTCTCCAGAGGGG - Intronic
920503310 1:206499167-206499189 TACCCCAGAGGACCACAGAGAGG + Intergenic
922884516 1:229007643-229007665 TACCCAAGGTGACACCACCGGGG - Intergenic
923676286 1:236083318-236083340 TGGGCAAGGGGAGTCCAGAGAGG + Intergenic
924739717 1:246787978-246788000 GACCCAAGGTGGCTCCAGACTGG + Intergenic
1062782889 10:232562-232584 TACCCAAGGGAAGGCCACAGAGG - Intronic
1064593171 10:16915591-16915613 TCCCCAAGTGGCCTCCAGGGTGG + Intronic
1069895555 10:71678303-71678325 TACAGAAGGGGAACCCAGAGGGG + Intronic
1075062738 10:119268012-119268034 AACCCCAGTGGGCTCCAGAGAGG - Intronic
1075137450 10:119796830-119796852 TACACAGGTGGACTCCTGAGGGG - Exonic
1076599686 10:131649193-131649215 TAACCAAGGAGATTTCAGAGGGG - Intergenic
1078795001 11:14583625-14583647 CACCCAAGTGGACTCCAGGCTGG + Intronic
1083675233 11:64321483-64321505 GGCCCAAGAGAACTCCAGAGAGG - Intronic
1083685563 11:64373123-64373145 CACCCAATGAGCCTCCAGAGGGG - Intergenic
1084404540 11:68963624-68963646 AACCCAAGAGGTCTCCACAGAGG - Intergenic
1086318916 11:85624218-85624240 TATCCAAGGGCAGTCCAGAATGG + Intronic
1090465502 11:126929701-126929723 TACCCAAGAGGACTCCAGGCAGG - Intronic
1091178968 11:133586247-133586269 CACCCAAGGGTACTCCAGTGGGG + Intergenic
1094778257 12:33757902-33757924 AACACAAGGGGACTCCCCAGTGG - Intergenic
1095350285 12:41202196-41202218 TCCCCAAGAGGACTTCAAAGAGG - Intronic
1096084817 12:48858312-48858334 TCCCCAGGGCCACTCCAGAGGGG + Intronic
1096552923 12:52385345-52385367 CACCAAAGCGGACTCCACAGTGG + Exonic
1102962128 12:117099564-117099586 CACGAACGGGGACTCCAGAGCGG - Intergenic
1103020984 12:117534143-117534165 TAGGCATGGGGGCTCCAGAGGGG - Intronic
1106707738 13:32299861-32299883 TACCAAACTGGTCTCCAGAGGGG - Intergenic
1114730499 14:24987780-24987802 TACCCAAGGGAGATGCAGAGTGG + Intronic
1117021502 14:51575482-51575504 TACCTAGGGAGACTCCAGAAGGG - Intronic
1119473165 14:74911750-74911772 GATCCAAGGGGAATGCAGAGTGG + Intronic
1119777447 14:77257827-77257849 CACCCAAGCGGCCTCCAGTGTGG + Exonic
1129454805 15:75670897-75670919 TTCCCCAGGGGACTCCAGTGAGG - Intergenic
1129711482 15:77822489-77822511 GACACAAGGGGACCCCAGAGAGG - Intergenic
1141683613 16:85557624-85557646 TCCTCCTGGGGACTCCAGAGAGG - Intergenic
1143265146 17:5630999-5631021 TCCCCATGGGGCCTCCAGTGTGG + Intergenic
1149685261 17:58531402-58531424 TTCCCAAAGGGACCCCAGAGAGG - Intronic
1151277302 17:73045116-73045138 TACCCAAGGCTACCCCAGAGAGG - Intronic
1152278889 17:79373625-79373647 CACCCCAGGGGCCTCCAGTGTGG - Intronic
1156341817 18:36216148-36216170 TGCTCACGGGGACTCCTGAGAGG + Intronic
1156418415 18:36924039-36924061 TACCCTAGGGGACACCAGCTAGG + Intronic
1158832856 18:61299376-61299398 TACCCAGTGAGACTCCAGAAGGG - Intergenic
1159602065 18:70437594-70437616 TACCCAATTGTTCTCCAGAGTGG + Intergenic
1161044294 19:2126873-2126895 TACCCAAGGGGACTCCAGAGTGG + Intronic
1161112921 19:2479625-2479647 AACCCAAGGGGGCTCCAGGTGGG + Intergenic
1161412145 19:4122953-4122975 TGGGCAAGGGGGCTCCAGAGGGG - Intronic
1165426211 19:35746788-35746810 TCCCCAAGGGCACCCCAGCGGGG - Exonic
1166122064 19:40692046-40692068 CACCAAAGGGGACTCCTGGGTGG - Exonic
1168181654 19:54665985-54666007 CAGCCAAAGGGACTCCAGATAGG + Intronic
925828029 2:7869465-7869487 TCCCCCAGGGGAATCCACAGAGG - Intergenic
932075526 2:68659329-68659351 TAAGTAAGGGGTCTCCAGAGAGG - Intergenic
937469369 2:122162225-122162247 CACCTGAGGGGATTCCAGAGAGG + Intergenic
938728215 2:134125459-134125481 TACCCAGGGGCACTGCAGGGAGG + Intronic
941808889 2:169736097-169736119 CACCCAAGGTGACTGCACAGTGG - Exonic
946246399 2:218390299-218390321 TACCCAAGGGAAGTACAGAGTGG + Intronic
947822656 2:233082904-233082926 TTCCCCAGGGGACTCCAGACAGG - Intronic
1169011682 20:2256325-2256347 CACGCAAGGTGACTGCAGAGTGG + Intergenic
1173613052 20:44384984-44385006 CACCCAAAAGGACTCCTGAGTGG - Intronic
1174441034 20:50553915-50553937 TACCCAAGGGAAGTACAGAGAGG + Intronic
1174585789 20:51607157-51607179 TACCTCAGTGGCCTCCAGAGGGG - Intronic
1174607619 20:51772471-51772493 CACCCAAGGGATCACCAGAGCGG + Intergenic
1175408144 20:58748314-58748336 ATCCCTAGGGGCCTCCAGAGAGG - Intergenic
1175836654 20:62000350-62000372 AACCCAAGGGGAGCCCAGAAAGG + Intronic
1176100393 20:63361878-63361900 GACCCAAGAGGCGTCCAGAGGGG + Intronic
1176307324 21:5130578-5130600 TTCCCAAGGGCACTGCAGAGGGG + Intergenic
1179849735 21:44131452-44131474 TTCCCAAGGGCACTGCAGAGGGG - Intergenic
1184872751 22:47251432-47251454 GGCCCCAGGGGACTGCAGAGCGG - Intergenic
949165366 3:934246-934268 TACTCAAGGTGACTCTAAAGTGG - Intergenic
950274465 3:11646850-11646872 TACCCAAGTGTGATCCAGAGGGG + Intronic
950476231 3:13216537-13216559 AACCCAAAGGGATTGCAGAGGGG + Intergenic
954403825 3:50334083-50334105 TGCTTAAGGGGACTCCAGGGCGG - Intronic
960190064 3:114693160-114693182 TTCCAAAGGAGACTCCTGAGTGG - Intronic
966067462 3:175834369-175834391 TACCCAGGGGAATTCCAGTGGGG - Intergenic
966412611 3:179658659-179658681 TACCCAAGGAGTCCCCAGTGAGG - Intronic
967895246 3:194390111-194390133 TACTCAATGGAACCCCAGAGAGG + Intergenic
969365567 4:6692355-6692377 TCCCCAAGGGGTCACCAGTGGGG + Intergenic
971368078 4:25993566-25993588 AACCCAAGAGAACTGCAGAGAGG - Intergenic
972424031 4:38915945-38915967 TACCCTCTGGGCCTCCAGAGAGG + Intronic
979018312 4:115463314-115463336 TCCCAAAGGAGAGTCCAGAGAGG + Intergenic
981721933 4:147810694-147810716 TACCCTAAGGCACTACAGAGAGG - Intronic
981764771 4:148236079-148236101 TTCCCAAGGGGACGTCAGATGGG - Intronic
985589541 5:757430-757452 TGCCTGAGGGGGCTCCAGAGAGG - Intronic
985920769 5:2971009-2971031 TCCCCAAGGGCAGTCCACAGTGG - Intergenic
987311104 5:16681895-16681917 GTCCAAAGGGGACACCAGAGTGG - Exonic
988788306 5:34584363-34584385 AACCACAGGGGACTTCAGAGTGG - Intergenic
989673577 5:43947630-43947652 CAACCAAGGGTACTTCAGAGAGG + Intergenic
995574061 5:113511543-113511565 TTCCCAAGGGAAGGCCAGAGAGG - Intergenic
996004740 5:118406145-118406167 TACCCCATGGGGCTCCTGAGGGG + Intergenic
996625166 5:125562283-125562305 TTCCCAAGGGGAGTCCACACCGG + Intergenic
997505137 5:134411446-134411468 TTTCCAAGGGGCCTCCAGGGTGG + Intronic
999231929 5:150066753-150066775 TAGCCAAGGGGACACAAGATGGG + Intronic
1001787195 5:174424014-174424036 TACACACGGTGACTTCAGAGAGG + Intergenic
1002599774 5:180347491-180347513 AACTCAAGGGGATTCCAGAAGGG + Intronic
1012297966 6:97548052-97548074 AAACCAAGAGGATTCCAGAGAGG + Intergenic
1020639295 7:10735533-10735555 CAGCCAAGGGGACAGCAGAGTGG + Intergenic
1022041605 7:26587101-26587123 TTGCCAAGGGGACCCCAGTGGGG - Intergenic
1022560044 7:31338364-31338386 TGCCCAAGGGGACCCCTGGGTGG + Exonic
1025851384 7:65247498-65247520 TAGCCAAGGGCATCCCAGAGTGG - Intergenic
1030077847 7:105751798-105751820 TCCCCAGGGGGACACCTGAGGGG - Intronic
1034533079 7:151708776-151708798 TCACCAAGGGCACTCCAGAGAGG - Intronic
1037663127 8:20944029-20944051 CACCCAAGGGGATTCTAGGGAGG + Intergenic
1041005077 8:53489905-53489927 TTCCCTAGGGAACTCCAGAAAGG + Intergenic
1041075481 8:54165747-54165769 TGACCAATGTGACTCCAGAGAGG - Intergenic
1045837652 8:106541782-106541804 TTCCCAAGGGGAATCTAGGGAGG + Intronic
1056126715 9:83541743-83541765 TACCCAAGTAGACTTCAGAATGG + Intergenic
1058743571 9:107967987-107968009 TTCCCCATGGGACTCAAGAGGGG - Intergenic
1060271888 9:122149556-122149578 TTCCCAAGGTGAATCCATAGAGG - Intronic
1060553470 9:124496561-124496583 GACCCCAGGGGGCTCCAGAGGGG - Intronic
1060814181 9:126626175-126626197 GGCGCACGGGGACTCCAGAGCGG - Intronic
1061385768 9:130288532-130288554 TAGCCAAGGGGCCTCCAGCTGGG + Intronic
1061791521 9:133061637-133061659 TCCCCAAAGGGGCTTCAGAGGGG - Intergenic
1186621899 X:11250537-11250559 TTCCCAAGGGGCCTCCAGAAAGG - Intronic
1190425212 X:50329217-50329239 TGCCTAGTGGGACTCCAGAGTGG + Intronic
1195313821 X:103658630-103658652 TACCCAAGGGGACACCTCAGAGG + Intergenic
1197445720 X:126551421-126551443 TCCCGAAGAGGACTCCAGGGTGG + Exonic
1197771527 X:130092427-130092449 TACACAAGGGGACGCCCCAGTGG + Intronic