ID: 1161050841

View in Genome Browser
Species Human (GRCh38)
Location 19:2163565-2163587
Sequence CTGGACCGTGACTCTTATGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 48
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 43}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161050841 Original CRISPR CTGGACCGTGACTCTTATGG GGG Intronic
910997629 1:93125474-93125496 CTTGAGGGAGACTCTTATGGAGG + Intronic
911019619 1:93373879-93373901 CTGGACATTGGATCTTATGGTGG - Intergenic
917201951 1:172526385-172526407 CAGCCCCGTGACTCTTATGATGG + Intergenic
1067191040 10:44068672-44068694 CTTCACCATGACTGTTATGGTGG - Intergenic
1075291622 10:121236093-121236115 CTGGACCCTGACTCTGAGGAGGG - Intergenic
1081713934 11:45235280-45235302 CTGGAAAGAGACTCTAATGGGGG - Intergenic
1082569867 11:54725621-54725643 CAGGACAGTGACTGTTATGTAGG - Intergenic
1086988431 11:93275776-93275798 CTTGAATGTGCCTCTTATGGAGG - Intergenic
1091696872 12:2633538-2633560 CTGGACGATGATTCTGATGGTGG + Intronic
1093458720 12:19389085-19389107 CAGAACCGTGTCTTTTATGGAGG - Intergenic
1100888582 12:99099466-99099488 CTGGACCGTGCCTCCTATGCAGG - Intronic
1104410613 12:128554656-128554678 CTCGACTGTGCCTCTTTTGGAGG + Intronic
1105569257 13:21585026-21585048 CTATACAGTGACTCTTCTGGGGG - Intronic
1119407525 14:74407796-74407818 CTGGCCCGTCACTCTACTGGAGG - Intronic
1131833061 15:96366437-96366459 CTGGACCCTGACTTTTTTGGAGG - Intergenic
1133616400 16:7480793-7480815 CTGGGCCTTGGCACTTATGGAGG + Intronic
1143450980 17:7036549-7036571 CTGCACCGCGATTCCTATGGAGG - Exonic
1147896841 17:43756829-43756851 CTTGACCATGTCTCCTATGGTGG + Intronic
1147955629 17:44132607-44132629 CTGGACCTTGACTATCTTGGAGG - Intergenic
1152554774 17:81047330-81047352 TGGGACAGTGACTCTCATGGAGG + Intronic
1155526201 18:26718410-26718432 CTGGGCTGTGACTCTCAGGGTGG + Intergenic
1161050841 19:2163565-2163587 CTGGACCGTGACTCTTATGGGGG + Intronic
1163160995 19:15464117-15464139 CTGGTCCGTGACTCCTTGGGAGG + Exonic
1165480060 19:36057829-36057851 CTGGACTGTGAATCTGATGTGGG + Intronic
1165797646 19:38528149-38528171 CAGGACCCTGACTCTGTTGGTGG + Intronic
931039675 2:58283459-58283481 CTGAACCATGACTCTTGTGATGG - Intergenic
932340204 2:70958773-70958795 CAGGACCATGACTCTAATGGGGG - Intronic
937781677 2:125845806-125845828 CTGGTCCTGGACTTTTATGGTGG + Intergenic
1181725348 22:24806998-24807020 CTGACCCGTGACTCTCAGGGAGG - Intronic
1184072973 22:42157637-42157659 CTGTACTGTGACTGTTATGATGG + Intergenic
1184088916 22:42282419-42282441 CTGGACCTTGACTCCTCTGACGG - Intronic
950169459 3:10827933-10827955 CTGGATTCTGACTCTTATGGGGG + Intronic
963025816 3:140917751-140917773 CTGGACCGTGGCTTTTCTGAGGG - Intergenic
976129112 4:81865722-81865744 CTGGACTGTGACTCTTTAAGGGG + Intronic
985854659 5:2415725-2415747 ATGGACCGTGTCTCTAATGCTGG + Intergenic
999125814 5:149245022-149245044 CTGGACCCAGGCTCCTATGGGGG - Intronic
1001068695 5:168563934-168563956 CTGGTCCGTGATATTTATGGAGG - Exonic
1015846436 6:137525120-137525142 GTTGACGGTGACTCTTATGATGG - Intergenic
1025997325 7:66536259-66536281 CTGGACAGTGACGCCTTTGGTGG - Intergenic
1026990189 7:74580736-74580758 CTGGACAGTGACACCTTTGGTGG - Intronic
1034162643 7:149004451-149004473 CTGGGCAGTGACTCTTGTGATGG - Intronic
1044200817 8:89433443-89433465 CTTGACCTTGACTATCATGGTGG - Intergenic
1046313997 8:112476840-112476862 CTGGACTGTGACAGTTATAGAGG - Intronic
1047229457 8:122983968-122983990 CTGGTCCTTGGCTCATATGGTGG - Intergenic
1056544282 9:87601071-87601093 CTGGATCGGGACTCCTTTGGGGG - Intronic
1061412420 9:130428811-130428833 CTGGGCCTTGATTCATATGGGGG - Intronic
1203625136 Un_KI270750v1:10782-10804 TTGGAACGTGACTGATATGGTGG - Intergenic
1196903290 X:120408072-120408094 CTGGACTGAGATTTTTATGGTGG - Intergenic