ID: 1161050938

View in Genome Browser
Species Human (GRCh38)
Location 19:2163900-2163922
Sequence GCGGGGCGAGTGGTTCCGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161050925_1161050938 29 Left 1161050925 19:2163848-2163870 CCGCTGGGCGGCGGGCACGCGCC No data
Right 1161050938 19:2163900-2163922 GCGGGGCGAGTGGTTCCGCCCGG No data
1161050929_1161050938 8 Left 1161050929 19:2163869-2163891 CCGGCGTCTTCGCTCCGGGCTCC No data
Right 1161050938 19:2163900-2163922 GCGGGGCGAGTGGTTCCGCCCGG No data
1161050924_1161050938 30 Left 1161050924 19:2163847-2163869 CCCGCTGGGCGGCGGGCACGCGC No data
Right 1161050938 19:2163900-2163922 GCGGGGCGAGTGGTTCCGCCCGG No data
1161050932_1161050938 -6 Left 1161050932 19:2163883-2163905 CCGGGCTCCCCTAGCGCGCGGGG No data
Right 1161050938 19:2163900-2163922 GCGGGGCGAGTGGTTCCGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161050938 Original CRISPR GCGGGGCGAGTGGTTCCGCC CGG Intronic