ID: 1161053121

View in Genome Browser
Species Human (GRCh38)
Location 19:2175907-2175929
Sequence TGTGCGGAAGAGCCCAGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161053121_1161053124 0 Left 1161053121 19:2175907-2175929 CCAGCACTGGGCTCTTCCGCACA No data
Right 1161053124 19:2175930-2175952 GAGGCTCCCACCCATAGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161053121 Original CRISPR TGTGCGGAAGAGCCCAGTGC TGG (reversed) Intronic