ID: 1161053121

View in Genome Browser
Species Human (GRCh38)
Location 19:2175907-2175929
Sequence TGTGCGGAAGAGCCCAGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 167}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161053121_1161053124 0 Left 1161053121 19:2175907-2175929 CCAGCACTGGGCTCTTCCGCACA 0: 1
1: 0
2: 1
3: 11
4: 167
Right 1161053124 19:2175930-2175952 GAGGCTCCCACCCATAGACCAGG 0: 1
1: 0
2: 0
3: 7
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161053121 Original CRISPR TGTGCGGAAGAGCCCAGTGC TGG (reversed) Intronic
900368706 1:2322062-2322084 TGTGGGGAAGGGGCCAGGGCGGG - Intronic
901072776 1:6530853-6530875 TGTGCGGCAGAGCACAGACCTGG + Intronic
901122875 1:6909503-6909525 TCTGCTGTAGAGCCCACTGCAGG - Intronic
901251447 1:7783521-7783543 TGTGGGGAGGAGCCCAGGGTGGG - Intergenic
902406683 1:16187908-16187930 AGGGCGGCAGAGCCCAGGGCTGG - Intergenic
902470925 1:16647268-16647290 GGTGCTGAAGATCCCAGCGCTGG - Intergenic
902487878 1:16760180-16760202 GGTGCTGAAGATCCCAGCGCTGG + Intronic
903013129 1:20344163-20344185 GGGGTGGAAGAGCCCAGGGCTGG - Intronic
903349474 1:22709667-22709689 TGAGTGGAGGAGCCCAGTGCAGG - Intergenic
903460699 1:23518753-23518775 TGTGCGCAGGAACCCAGGGCTGG + Intronic
905476106 1:38229306-38229328 TGTGAGTAAAAGCCCAGAGCAGG + Intergenic
915545900 1:156597629-156597651 TTTGCTGAAGAGCCCACAGCTGG - Intronic
916029748 1:160865346-160865368 TGTGTTGAAGAGCTCAGGGCTGG - Intergenic
916208963 1:162343066-162343088 TGTGAGGAAGAGCCACATGCAGG - Intronic
917231923 1:172846662-172846684 TGTGAGGAAAAGCTCAGTGAGGG + Intergenic
918122494 1:181551620-181551642 TGTGCGAAAAAGCTCTGTGCAGG + Intronic
918357976 1:183724079-183724101 TGAAGGGAAGAGCCCAGTCCTGG + Intronic
919465933 1:197921610-197921632 GAAGCGGAAGAGCCCAGCGCTGG + Exonic
922791526 1:228313827-228313849 TGCGCGGAAGATGACAGTGCCGG - Intronic
923523202 1:234752229-234752251 TCCAGGGAAGAGCCCAGTGCAGG + Intergenic
1063010681 10:2019484-2019506 TGTCTGGAAGAGCCCAGCTCTGG - Intergenic
1067038013 10:42933467-42933489 GGGGCGGAAGAGCCGAGGGCAGG + Intergenic
1067347179 10:45445111-45445133 TGGGCTGGAGAGGCCAGTGCTGG + Intronic
1067450172 10:46377172-46377194 TGGCAGGGAGAGCCCAGTGCTGG + Intronic
1067587070 10:47482591-47482613 TGGCAGGGAGAGCCCAGTGCTGG - Intronic
1067634130 10:47990358-47990380 TGGCAGGGAGAGCCCAGTGCTGG - Intergenic
1067686991 10:48471656-48471678 TGTGAGGAAGGGCGCAGTGGAGG - Intronic
1069555452 10:69394804-69394826 TCTGCGGCAGAGCACAGGGCTGG + Intronic
1069907548 10:71740659-71740681 TGGCCGGGAGAGCCCAGGGCTGG + Intronic
1069961347 10:72081073-72081095 TCTGAGGAAGACCCCAGGGCTGG + Intronic
1076162032 10:128251821-128251843 TGTGCAGATGAGCCCAGAGACGG - Intergenic
1076773045 10:132677503-132677525 TGTGACAGAGAGCCCAGTGCTGG + Intronic
1076831295 10:132995739-132995761 TGTCTGGAAGGTCCCAGTGCTGG - Intergenic
1076831305 10:132995786-132995808 TGTCTGGAAGGTCCCAGTGCTGG - Intergenic
1076875691 10:133214545-133214567 TGTGTGGCGGAGCCCAGTGCTGG - Intronic
1077225012 11:1435865-1435887 TGTCCAGAACAGCTCAGTGCTGG - Intronic
1077473804 11:2777068-2777090 GGTGCGGGAGAGTCCATTGCAGG - Intronic
1078541353 11:12215917-12215939 TGTGCAGAAAAGCCAAGTGCCGG - Intronic
1079071851 11:17353692-17353714 TGTGCGGCGGCGCCCAGTGACGG + Intronic
1079161532 11:17999472-17999494 GGTGAGGAAGAGCTCAATGCAGG - Intronic
1080662353 11:34307450-34307472 ACTGCTGAAGAGCTCAGTGCTGG - Intronic
1081710359 11:45212214-45212236 AGTGGGGAAGAGCCCAGGCCAGG - Intronic
1081737131 11:45411871-45411893 TGTGAGTCAGAGACCAGTGCTGG + Intergenic
1081845795 11:46239314-46239336 TGTGCGGCAGCGCCCTCTGCCGG - Intergenic
1085017247 11:73182891-73182913 TCTGCAGAAGAGCCCTCTGCTGG + Intergenic
1089662494 11:119994496-119994518 TGTGCCCAAGAGCCCACGGCTGG + Intergenic
1089845581 11:121455491-121455513 TCTGAGAAAGAGCCCTGTGCTGG + Intronic
1090270999 11:125386184-125386206 TGTGCTGAGGAGACCAGTGGAGG + Intronic
1090403860 11:126465830-126465852 TCTGCTGAAGAGCCCAAGGCAGG - Intronic
1091002745 11:131924114-131924136 TGTGTGGAAATGCACAGTGCAGG + Intronic
1093015569 12:14151214-14151236 TGTGCGCCAGTGCCCAGTGTCGG - Intergenic
1098503907 12:71226935-71226957 TGAAGGGAAGAGCCCAGTCCTGG + Intronic
1102490055 12:113285246-113285268 TGTGCAAAAGTGACCAGTGCAGG - Intronic
1103033100 12:117633863-117633885 TGTCTGGAGGAGCACAGTGCAGG - Intronic
1104678602 12:130732703-130732725 GGTGGGGAAGAGCACAGTGGTGG - Intergenic
1104707401 12:130957792-130957814 TGTGTGGAAAAGCACAGTGAAGG + Intronic
1104909795 12:132235247-132235269 TGTGGGGCAGAGGACAGTGCTGG + Intronic
1104969312 12:132524031-132524053 TGTGCAGCAGAGCCCGGGGCCGG - Intronic
1106610800 13:31278673-31278695 TGAGGGGCAGAGCCCAGTGGTGG - Intronic
1107952097 13:45472623-45472645 TGTACTGATGAGCCCATTGCAGG + Intronic
1109685814 13:65818698-65818720 TGAGCGGAAGGACCCAGTCCTGG + Intergenic
1115382490 14:32756433-32756455 TGTGGGTATCAGCCCAGTGCTGG + Intronic
1116971850 14:51074696-51074718 TGGGCGGAACAGCCCACTGGTGG - Intronic
1118276900 14:64393595-64393617 AGTGCAGCAGAGCCCAGAGCTGG + Intronic
1118763403 14:68894368-68894390 TGTCTGGAAGAGGCCTGTGCTGG - Intronic
1121544422 14:94753003-94753025 TGTGAGGAAGAGGCCACGGCAGG + Intergenic
1122940489 14:104978870-104978892 CGTGCGGGAGCGCCCAGCGCTGG + Intergenic
1127339037 15:58021804-58021826 TGAGCTGAAGCACCCAGTGCTGG + Intronic
1129200438 15:73995218-73995240 TGGGCGGAAGGGCCCAGGCCCGG - Intronic
1129708000 15:77805613-77805635 TGTGTGGAAGTGCCCATGGCAGG + Intronic
1130956586 15:88631107-88631129 TTTGCTTAAGAGCCCAGTACTGG - Exonic
1131832427 15:96362143-96362165 TGTGCTAAATTGCCCAGTGCTGG + Intergenic
1132399532 15:101496887-101496909 TGTGAGGCAGAGCCCGGCGCAGG - Intronic
1132570164 16:641024-641046 TGTGCTGAGGGGCCCTGTGCTGG - Intronic
1135425906 16:22335766-22335788 TGTGAGGGCCAGCCCAGTGCTGG - Intergenic
1137768608 16:50996739-50996761 TGTGGGGAAGATCCCAGGGGTGG - Intergenic
1139634146 16:68247789-68247811 TGTCCAGGAGAGCCAAGTGCTGG + Intronic
1139891053 16:70253511-70253533 TGTGGGGAGGACCCCAGCGCCGG + Intronic
1140722980 16:77788078-77788100 TGCCCTGAAGAGTCCAGTGCAGG - Intergenic
1143387734 17:6542026-6542048 TCTGCGGAAGAGATCAGGGCGGG + Intronic
1144081739 17:11769438-11769460 TGGGAGGAAGTGCGCAGTGCTGG - Intronic
1145977277 17:28991603-28991625 AGTGAGGAAGAGCCCAGGGTGGG + Intronic
1146661957 17:34670784-34670806 TGTGAGGAAGAGACCCCTGCAGG - Intergenic
1150246477 17:63679382-63679404 GGTGCTCAAGAGCCCAGTCCAGG - Intronic
1151634625 17:75337266-75337288 TGTGTGCAAGCTCCCAGTGCAGG - Intronic
1151836297 17:76585127-76585149 TGTCTGGATAAGCCCAGTGCGGG - Intronic
1152352478 17:79791393-79791415 GGTGCGGGAGAGCAGAGTGCGGG - Intergenic
1152635616 17:81429456-81429478 TGAGCGGCAGAGGCCAGGGCCGG + Intronic
1158054822 18:53266051-53266073 AGTGAGGAAGACCCCAGAGCAGG - Intronic
1160397103 18:78580546-78580568 TCTGGGGAAGAGCCAAGTGCTGG + Intergenic
1161053121 19:2175907-2175929 TGTGCGGAAGAGCCCAGTGCTGG - Intronic
1165839408 19:38778923-38778945 TGCGCGTAAGTGCCCAGTGAGGG + Intergenic
1166312896 19:41973025-41973047 TGTGGAGAAGAGCACAATGCAGG - Intronic
1202703321 1_KI270713v1_random:4060-4082 GGTGCTGAAGATCCCAGCGCTGG - Intergenic
929474213 2:42229396-42229418 GGTGCTTAAGAGCACAGTGCTGG - Intronic
935099731 2:99982042-99982064 GCTGAGGAAGAGCCCTGTGCAGG - Intronic
936522598 2:113220501-113220523 TCTGCGGAAGCTCCCAGAGCTGG + Intronic
938216965 2:129526292-129526314 TGAAGGGAAGAGCCCAGTTCTGG + Intergenic
939930795 2:148230774-148230796 TGAACGGAAGAACCCAGTCCTGG - Intronic
941007010 2:160258379-160258401 TGTGCGGAAGAAGCCAGAGTGGG + Intronic
941755798 2:169184438-169184460 TGTGGGGAAGAGCCCTCTGGAGG + Intronic
942514112 2:176733752-176733774 TATGTGGATGAGCACAGTGCTGG + Intergenic
944515703 2:200509951-200509973 GGTGCGGAAGAGCCGGGCGCGGG - Exonic
946057647 2:216915971-216915993 TGTGCGGGAGGGACCCGTGCTGG + Intergenic
946394322 2:219435515-219435537 TGAGACGAAGAGCCAAGTGCAGG + Intronic
948509584 2:238454747-238454769 GCTGCTGAAGAGGCCAGTGCTGG - Intergenic
1169780132 20:9300976-9300998 TGTGGGGAAGAACCCATTCCTGG + Intronic
1171339778 20:24418828-24418850 TGTGAGTAACAGCCCAGTGGAGG - Intergenic
1172098619 20:32472888-32472910 GGTCCCCAAGAGCCCAGTGCGGG - Intronic
1172300289 20:33845111-33845133 TGTGAGGAAGAGCATAGAGCTGG + Intronic
1172533613 20:35653236-35653258 GGTGCGGGAATGCCCAGTGCAGG - Exonic
1173641022 20:44601971-44601993 TGTGGGGAAATGCCCAGAGCAGG + Intronic
1174891716 20:54402411-54402433 TGTGAGGGAGTGCCCAGTGGTGG + Intergenic
1177770691 21:25512444-25512466 TGTGCAGAAGTCCCCTGTGCAGG + Intergenic
1178085259 21:29105710-29105732 TGTGTGGAAGGGGCCAGTGGGGG + Intronic
1178419680 21:32433609-32433631 TATGAGGAAGAGACCAGTGAGGG - Intronic
1179225036 21:39445648-39445670 GGTCCGGAAGGGCCCAGAGCTGG + Exonic
1179975296 21:44862087-44862109 TGTGTGTAAGAGCCCAGAGCTGG + Intronic
1184823827 22:46933559-46933581 TGTGTGGAAGAGGCCAGAGAGGG - Intronic
1184861360 22:47174812-47174834 AGTGCGGAAGGGCCCAGAGCTGG + Exonic
950502320 3:13372351-13372373 TGTGCTGAAGTGCACTGTGCAGG + Intronic
951259940 3:20495640-20495662 TGAAGGGAAGAGCCCAGTCCTGG - Intergenic
954298510 3:49686975-49686997 GGTGCTGAAGATCCCAGCGCTGG + Exonic
958760143 3:98296809-98296831 TGAAGGGAAGAGCCCAGTCCTGG + Intergenic
961178418 3:124855703-124855725 CGTGGTGGAGAGCCCAGTGCTGG - Intronic
964475270 3:157092267-157092289 TGAGAGGAAGAGCCCAGTGTTGG + Intergenic
966594117 3:181711376-181711398 AGAGCGGAAGAGCGCAGTACGGG + Intergenic
967840974 3:194004161-194004183 TGTGTGGAACAGCCCAAAGCAGG + Intergenic
968085574 3:195872519-195872541 TGTGAGGAGGGTCCCAGTGCCGG - Intronic
968463109 4:735751-735773 TGGGCAGAAGAGCACAGCGCAGG - Intronic
968555872 4:1246213-1246235 TGTGGGTAAGAGCTCTGTGCCGG - Intronic
969580503 4:8061949-8061971 TGGGAGGAAGAGCCCAGAGCAGG + Intronic
969653110 4:8479143-8479165 TGTGCAGAAGAGCCTTGTGTAGG + Intronic
970169408 4:13274851-13274873 TGTGAGGAAGAGGCAAGGGCTGG - Intergenic
970872634 4:20833976-20833998 AGTGGGGAAGAGCCCAGCCCAGG + Intronic
971567851 4:28168253-28168275 TGAAGGGAAGAGCCCAGTACTGG - Intergenic
972316845 4:37934671-37934693 TGTGAGGGAGAGACCAGTGTAGG + Intronic
972358662 4:38305875-38305897 TGTGCAGAAGAGGCCAGGGGTGG - Intergenic
975234433 4:71975369-71975391 TGTGGGGGAGAGCCTAGTGGTGG - Intergenic
977066535 4:92323519-92323541 TGAGGGGAAGAGACCAATGCAGG - Intronic
981088003 4:140703443-140703465 TGTTCGGAAGAGCTCAGTTCTGG + Intronic
984205497 4:176783017-176783039 TGTGCTGAAGACTACAGTGCTGG - Intronic
988236935 5:28557549-28557571 TATAGGGAAGAGCCCAGTCCTGG - Intergenic
996369348 5:122736690-122736712 GGTGCTGAAGAGGCCAGGGCAGG + Intergenic
998486978 5:142511544-142511566 GGTGGGGAAGGGCCCAGTGGAGG + Intergenic
1004026885 6:11827563-11827585 TTTGTGGAGGAGGCCAGTGCTGG + Intergenic
1004666509 6:17752859-17752881 TGTGCTGGACAGCCCAGAGCTGG + Intergenic
1006235039 6:32622626-32622648 AGTGTGGAAGAGCCCCCTGCTGG - Intergenic
1007195298 6:40055420-40055442 TTTGCCGAGGAGCCCAGAGCTGG - Intergenic
1019520498 7:1458722-1458744 TGTGGGGGAGCGGCCAGTGCAGG - Intronic
1020355533 7:7271408-7271430 GGTGCGGAGCAGCCCAGTGGGGG + Intergenic
1023808281 7:43890657-43890679 TGTGGGGAAGTGCCCAGAGGAGG - Intronic
1025025774 7:55515095-55515117 TGTGCGGAAGAGCAGAGAGAGGG - Intronic
1026067678 7:67089422-67089444 GGTGCGGAAGACTCCACTGCAGG + Intronic
1026878209 7:73891834-73891856 TCTGAGGAGGAGCCCAGTGAAGG - Intergenic
1029129537 7:98319372-98319394 TGTGCGGGAGAGCACCGTCCGGG - Intronic
1030090354 7:105852594-105852616 TGTGCGGAAGGGCCCTGTGCAGG - Intronic
1031597139 7:123661208-123661230 TCTGTGGTAGAGCCCTGTGCCGG + Intronic
1033610678 7:142961106-142961128 TGTGGGGAAAAGCTCAGAGCTGG + Intronic
1035369674 7:158372032-158372054 TGTGCGGAAGACCCCCTCGCAGG + Intronic
1037727265 8:21493165-21493187 CGTGTGGAAGAGCTCAGTGCTGG - Intergenic
1039424918 8:37477726-37477748 GGTGCAGGAGAGGCCAGTGCTGG - Intergenic
1047342363 8:123994421-123994443 TGTACGGAAGAGTCCAGAGAAGG + Intronic
1047408897 8:124608212-124608234 TGTGGGGAAGAAAACAGTGCAGG - Intronic
1049209669 8:141379853-141379875 TGTGCGCAAGAGCCAAAGGCCGG - Intergenic
1049613976 8:143568353-143568375 GGGGCAGAAGAGCCCAGGGCAGG + Intronic
1049642720 8:143722632-143722654 TGGAGGGAAAAGCCCAGTGCTGG - Intergenic
1050148903 9:2599522-2599544 TGTGAGGAAGAATCAAGTGCAGG - Intergenic
1053355110 9:37438812-37438834 TGTGGGAAAGAGCCCATTGGAGG - Exonic
1059389334 9:113988941-113988963 TCTGCTGGAGATCCCAGTGCCGG + Intronic
1060270718 9:122139106-122139128 TGTGTGGAAGAGCCTAATGCAGG - Intergenic
1060977119 9:127771302-127771324 TGAGCTGCAGAGCTCAGTGCCGG + Intronic
1061892830 9:133631783-133631805 TGTGAGCATGAGCCCAGAGCTGG + Intergenic
1189290376 X:39880942-39880964 TTTGCTGAACATCCCAGTGCTGG + Intergenic
1195102997 X:101574145-101574167 TGTGGGGGCCAGCCCAGTGCTGG + Intergenic
1195318965 X:103705818-103705840 GGTGTGGAAGAGCCCACTTCAGG - Intergenic
1196864670 X:120059871-120059893 TGTGCGTACCAGGCCAGTGCTGG - Intergenic
1196878431 X:120176460-120176482 TGTGCGTACCAGGCCAGTGCTGG + Intergenic
1200114777 X:153765232-153765254 TGTCCAGAACAGCCCAGTGGGGG + Intronic
1200857815 Y:7958516-7958538 TCTGCGGAGGGGCACAGTGCAGG + Intergenic