ID: 1161054032

View in Genome Browser
Species Human (GRCh38)
Location 19:2181002-2181024
Sequence ACTGACAAGGAGACAGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 660
Summary {0: 1, 1: 0, 2: 4, 3: 55, 4: 600}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161054032_1161054037 -3 Left 1161054032 19:2181002-2181024 CCTTCCTCTGTCTCCTTGTCAGT 0: 1
1: 0
2: 4
3: 55
4: 600
Right 1161054037 19:2181022-2181044 AGTCTCCCTGCTGTGGGTTTTGG 0: 1
1: 0
2: 3
3: 18
4: 194
1161054032_1161054043 28 Left 1161054032 19:2181002-2181024 CCTTCCTCTGTCTCCTTGTCAGT 0: 1
1: 0
2: 4
3: 55
4: 600
Right 1161054043 19:2181053-2181075 TCACCCTCACGCGCCCTCGACGG 0: 1
1: 0
2: 0
3: 2
4: 42
1161054032_1161054038 -2 Left 1161054032 19:2181002-2181024 CCTTCCTCTGTCTCCTTGTCAGT 0: 1
1: 0
2: 4
3: 55
4: 600
Right 1161054038 19:2181023-2181045 GTCTCCCTGCTGTGGGTTTTGGG 0: 1
1: 0
2: 1
3: 25
4: 242
1161054032_1161054036 -9 Left 1161054032 19:2181002-2181024 CCTTCCTCTGTCTCCTTGTCAGT 0: 1
1: 0
2: 4
3: 55
4: 600
Right 1161054036 19:2181016-2181038 CTTGTCAGTCTCCCTGCTGTGGG 0: 1
1: 0
2: 1
3: 27
4: 181
1161054032_1161054035 -10 Left 1161054032 19:2181002-2181024 CCTTCCTCTGTCTCCTTGTCAGT 0: 1
1: 0
2: 4
3: 55
4: 600
Right 1161054035 19:2181015-2181037 CCTTGTCAGTCTCCCTGCTGTGG 0: 1
1: 0
2: 2
3: 22
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161054032 Original CRISPR ACTGACAAGGAGACAGAGGA AGG (reversed) Intronic
900818119 1:4866078-4866100 ACTGACAAGTTGAGAGAAGAAGG - Intergenic
900883451 1:5398965-5398987 GCTAACAAGAGGACAGAGGATGG - Intergenic
901075651 1:6553380-6553402 ACAGACGAGGAGACTGAGGTTGG - Intronic
902791099 1:18768651-18768673 ACTGACAAGGCGGGAGAGGGAGG + Intergenic
903295821 1:22342574-22342596 AGAGATAAGGAGACAGAGAAAGG + Intergenic
903500317 1:23796881-23796903 AATGACTATGACACAGAGGATGG - Exonic
904096038 1:27978154-27978176 AGTGACAGGGAGGAAGAGGAAGG + Intronic
904276534 1:29388384-29388406 ACTGAGGAGCAGACAGAGAAGGG + Intergenic
904932386 1:34099622-34099644 ACAGAAAAGGTGACAGAGCAGGG + Intronic
905017348 1:34786741-34786763 AGTGACTGGGTGACAGAGGAGGG - Intronic
905096355 1:35474610-35474632 CCTGACAGGAAGTCAGAGGAGGG + Intronic
905206334 1:36344687-36344709 AGTCACAAGTAGACAAAGGAGGG - Intronic
905840309 1:41170985-41171007 AGTAACAAGATGACAGAGGATGG - Intronic
905922429 1:41728454-41728476 TCTGCCAAGGCGACAGAGCAGGG + Intronic
906847125 1:49205243-49205265 TCTTTCAAGGACACAGAGGAGGG + Intronic
907855611 1:58300722-58300744 ACTGGCAAGGAGAGAAAGCAAGG + Intronic
909292798 1:73905259-73905281 ACTGAAGAGGAGAAAGAGGAAGG + Intergenic
910625384 1:89301813-89301835 ACTGGCAAGGATGCAGAGAATGG - Intergenic
910822637 1:91367759-91367781 ACTGACGAGTTGAGAGAGGAAGG + Intronic
911862497 1:102970713-102970735 ACTGACAAGAAGGCAAAAGAAGG + Intronic
912248860 1:107990400-107990422 AATGAAAAGGAGACAGATGGAGG - Intergenic
913053463 1:115136834-115136856 ACTCAAAGTGAGACAGAGGATGG + Intergenic
913940199 1:125096235-125096257 ACCTGCAAGGAGAAAGAGGACGG + Intergenic
915109614 1:153554676-153554698 ACAGACAAGGAAACAGAGGCTGG - Intergenic
915214310 1:154329704-154329726 ACTGAGATAGAGATAGAGGAGGG - Intronic
915644154 1:157255082-157255104 TTTGACAAGTTGACAGAGGAAGG + Intergenic
917014043 1:170509296-170509318 ACTGGTAAGGATACAGAGAAAGG + Intergenic
917231117 1:172839135-172839157 ACAGGCAAAGAGACACAGGAAGG + Intergenic
917580401 1:176371563-176371585 GCTGACAAAGATACAGAGAAAGG - Intergenic
918078780 1:181190206-181190228 ACTTACAGAGAGACAGAGGTGGG + Intergenic
918209090 1:182335021-182335043 AGAGAGAAAGAGACAGAGGAAGG + Intergenic
918606707 1:186436492-186436514 ATTGTCCAGGAGACAGATGATGG + Intergenic
918703575 1:187635477-187635499 AGTGACAGGGAGAAAGAGGATGG - Intergenic
919446023 1:197706781-197706803 GCTGGCAAGGAGGCAGAGAAAGG + Intronic
919801892 1:201359276-201359298 AGTGACATGGAGACACAGGCAGG + Intronic
919979062 1:202631069-202631091 ACTGACAGCCAGAGAGAGGAAGG + Intronic
920177302 1:204110157-204110179 TCTGTCAAGGTGACAGAGCAAGG - Intronic
920341640 1:205278843-205278865 AGTGAGAAGGAGAATGAGGATGG + Intergenic
920841809 1:209561700-209561722 AGGAACAATGAGACAGAGGATGG - Intergenic
921709474 1:218359072-218359094 AACGAGAGGGAGACAGAGGAAGG + Intronic
921834101 1:219760195-219760217 GGTGACAAGTAGACAGAGGGAGG + Intronic
922076721 1:222252684-222252706 ACTGAAAATGAGATAGAGAATGG + Intergenic
923152354 1:231244811-231244833 AATGAAAAGAAGACTGAGGATGG + Intronic
923581682 1:235222554-235222576 AATGAAAAAGAGACACAGGAAGG + Intronic
923796064 1:237156891-237156913 GCTGGCAAGGAGGCAGAGAAAGG + Intronic
924198687 1:241638287-241638309 AGTGACCAGGAGACACAGGAGGG + Intronic
924668206 1:246095250-246095272 ACTGTCCAGGAGAAAGGGGAAGG + Intronic
924855322 1:247869716-247869738 ACTATCAAGGAGACAGTGTAGGG + Intronic
1062836893 10:641511-641533 ACTGACCAGGTGGGAGAGGAGGG - Intronic
1062983327 10:1744075-1744097 CCTGAACAGGAGGCAGAGGAAGG + Intergenic
1063790985 10:9447534-9447556 AAAGACAGGGAGAGAGAGGAAGG - Intergenic
1063818016 10:9799262-9799284 GCTGAGAAGGAGGAAGAGGAGGG + Intergenic
1063865982 10:10366161-10366183 ACTGAGAAAGAGAGAGAGGGAGG + Intergenic
1064444122 10:15378703-15378725 TCTGCGAAGGGGACAGAGGAGGG + Intergenic
1064464945 10:15569548-15569570 AGTAAGAAGCAGACAGAGGATGG - Intronic
1065004393 10:21366155-21366177 ACTATCTAGGAGACAGAGGTGGG + Intergenic
1066176205 10:32909538-32909560 AATGATAAGGAGACACAGGCTGG + Intronic
1066192588 10:33069520-33069542 AGAGAGAAGGAGAGAGAGGAAGG - Intergenic
1066545343 10:36493985-36494007 GCTGGCAATTAGACAGAGGAAGG - Intergenic
1067205421 10:44208219-44208241 ACTGAGAAAGAGATAGGGGAAGG - Intergenic
1067242874 10:44510893-44510915 ATGGCAAAGGAGACAGAGGAAGG + Intergenic
1067288511 10:44924590-44924612 ACAGAGCAGGGGACAGAGGAGGG + Intronic
1067522568 10:47019373-47019395 ACTGGCCAGGAGATAGAGGAAGG + Intergenic
1067783449 10:49225947-49225969 ACTGAAAAGGAGAAAAAGGGAGG - Intergenic
1068148724 10:53104779-53104801 AGAGAGAAAGAGACAGAGGAGGG + Intergenic
1068665634 10:59672546-59672568 CCTTGCAAGGAGACAGAGTATGG + Intronic
1069551441 10:69367159-69367181 ACAGAGAAGGAGCCAGAGGTGGG + Intronic
1070589264 10:77789947-77789969 GCTGTCAAGGAGACAGAGGCAGG + Intergenic
1071463796 10:85921794-85921816 AAAGCCAAGGACACAGAGGAAGG - Intronic
1072095203 10:92171548-92171570 ACTCAAAAGGAAACAAAGGAAGG + Intronic
1073190814 10:101649641-101649663 CCTGACAAGGAGAAAGAAGCTGG - Intronic
1073437037 10:103524073-103524095 GCTGGCAAGGAGGCAGAGAAAGG - Intronic
1074683833 10:115939354-115939376 ATTGAACAGGAAACAGAGGATGG + Intronic
1074757089 10:116632131-116632153 GCTGAGAAGAAGACAAAGGAGGG + Intronic
1075103059 10:119519420-119519442 ACAGACAGGGAGACAGAAGCTGG - Intronic
1075103139 10:119519764-119519786 ACAGACAGGGAGACAGAAGCTGG - Intronic
1075556547 10:123436421-123436443 AAAGACAAGTAGAAAGAGGAGGG - Intergenic
1076268545 10:129130355-129130377 ACTGACTCAGAGACACAGGATGG - Intergenic
1076582104 10:131518635-131518657 ACGGACAAGGAAACAGAGACTGG - Intergenic
1076830486 10:132992022-132992044 GTTGACAAAGAGACAGAGGTAGG + Intergenic
1076858930 10:133130610-133130632 ACAGACAAGGAGGAAGAGGGAGG - Exonic
1077902595 11:6501595-6501617 GCAGAGAAGGAGACAGAGAATGG + Intronic
1077968057 11:7157147-7157169 AGTGAAAAGGAGACAGAAAAAGG - Intergenic
1078184838 11:9042784-9042806 ACTGAGAAGGGGAAAGAGGTGGG - Intronic
1078525161 11:12095104-12095126 ACAGATAAGGAGACAGAGCTGGG + Intronic
1078678257 11:13448047-13448069 ACTGAGAATGGCACAGAGGATGG - Intronic
1078983957 11:16571540-16571562 ACTGCTAAGGAGACTGAGGTGGG - Intronic
1079012469 11:16840618-16840640 ACTGAAAAGTAGACAGAAGGGGG + Intronic
1079360321 11:19765464-19765486 AAGGAGAAGGAGACAGAGGGAGG - Intronic
1079532517 11:21472274-21472296 ACTGAGCTGGAGGCAGAGGAGGG - Intronic
1079853004 11:25561605-25561627 ACTGCCATGGAGTCAGAGGCAGG + Intergenic
1079902145 11:26199855-26199877 ATTGAGAAAGAGACAAAGGAAGG - Intergenic
1079943142 11:26707218-26707240 CCTGAAAAAGAGCCAGAGGAAGG - Intronic
1080002243 11:27363091-27363113 ACTGAGCAGGAGTCCGAGGAGGG + Exonic
1080523328 11:33087838-33087860 ACTGAAAAGAAGACTGTGGATGG - Intronic
1081152772 11:39652372-39652394 ACTGACGAGAAGAGTGAGGAAGG + Intergenic
1082178502 11:49089299-49089321 AGTGCCAAGGAGGCAGTGGAGGG + Intergenic
1082873301 11:57963381-57963403 ATTCACAGGGAGAGAGAGGAAGG - Intergenic
1082876993 11:57999146-57999168 ACTGACAAGCTGAGAGAAGAAGG - Intergenic
1084182073 11:67451828-67451850 ACTGGCCATGAGGCAGAGGAAGG + Exonic
1085157589 11:74310970-74310992 ACTGACACAGACACAGTGGACGG - Intronic
1085218183 11:74850344-74850366 ACAGACAAGGAGGAAGATGATGG + Intronic
1086179087 11:83928515-83928537 ACTGACACAGAGCCAGAAGAAGG + Intronic
1086253634 11:84848037-84848059 AGTGAAAATGAGTCAGAGGATGG + Intronic
1087132597 11:94681282-94681304 ACTGACAAGTAGAGAGCTGATGG - Intergenic
1087706395 11:101497527-101497549 GCTGACACTGAGAAAGAGGAAGG - Intronic
1088712003 11:112516676-112516698 ACTAACAAGGAGAGAGTTGAAGG - Intergenic
1088940589 11:114451354-114451376 ACTGAGAAGGAGAAAGGGGAGGG - Intergenic
1089502169 11:118939126-118939148 TCTGACCAGGAGGCAGAGAATGG - Intronic
1089515187 11:119027692-119027714 GATGAGCAGGAGACAGAGGAAGG + Exonic
1089554961 11:119311181-119311203 ATTGACTAGGAGGCAGAGGGAGG + Exonic
1090069815 11:123534321-123534343 GCTGAGAAGGAGAAAGAGGAGGG + Intronic
1090180113 11:124689968-124689990 ACTGGCAAGGATTCAGAGAAAGG + Intronic
1090339086 11:125999658-125999680 AATGAGAAGGAGAAAGATGATGG - Intronic
1090422694 11:126586479-126586501 AATGACAAGCAGAAAGAGGGCGG - Intronic
1090645819 11:128765727-128765749 ACTGACAAGGATGCAGGGAAAGG + Intronic
1090711218 11:129387456-129387478 ACTGAAAGAGAGAGAGAGGAAGG + Intronic
1091011248 11:132002747-132002769 ATTGATAAAGAGACAGAGTAAGG - Intronic
1091950021 12:4584998-4585020 ACTCACAAGACGGCAGAGGAGGG + Intronic
1092252178 12:6905697-6905719 GACGAGAAGGAGACAGAGGAGGG + Exonic
1092333902 12:7611262-7611284 ACTGAGTAGGAGACTGAGGCAGG + Intergenic
1092756134 12:11765215-11765237 ATTTACCAGGAGACAGAGCAAGG - Intronic
1094205350 12:27833878-27833900 ACGGAGAGGGAGAGAGAGGAAGG - Intergenic
1094422772 12:30289274-30289296 TCTGAAAAGAATACAGAGGAAGG - Intergenic
1095828094 12:46551451-46551473 AATGACATGGAGATAGAGCAGGG + Intergenic
1096183956 12:49566315-49566337 AGTGTCAAGGAGGCAGGGGAGGG - Intronic
1096256272 12:50064009-50064031 ACTGCCATGCAGACAGGGGAAGG + Intronic
1097338939 12:58415857-58415879 ATTGTCAGGGAGACAAAGGAGGG + Intergenic
1097736389 12:63186263-63186285 ACTGGAAAGGAGATGGAGGATGG + Intergenic
1097745671 12:63300144-63300166 AGTAGCAAGGAGACAGAAGAGGG + Intergenic
1098024902 12:66191085-66191107 ACTCAAAAGCAGACAGAGGATGG + Intronic
1098038661 12:66333001-66333023 AATGAGAAGGAGACAGAAAAAGG - Intronic
1098224791 12:68310321-68310343 ACTCACAGTGAGACAGAGAATGG + Intronic
1098540874 12:71655804-71655826 ACTGTCAAGGAAAAAGAGGGGGG + Intronic
1098790398 12:74815605-74815627 ACTAATAGGGAGACAGAGGCAGG + Intergenic
1098883200 12:75937416-75937438 GATAGCAAGGAGACAGAGGAAGG + Intergenic
1099619725 12:84986924-84986946 ACTGGAAAGGAAAGAGAGGAAGG + Intergenic
1100102593 12:91126966-91126988 ATTGACAAGAAGGCAGAGAAAGG - Intergenic
1100666198 12:96756090-96756112 TCTGTGAAGGAGACAGGGGAAGG + Intronic
1100766744 12:97874600-97874622 GCTGAGGAGGAGAAAGAGGAAGG - Intergenic
1100809360 12:98323472-98323494 ACTACTAGGGAGACAGAGGAAGG - Intergenic
1100948535 12:99817650-99817672 ACTGGCAAGGATGCAGAGGAAGG - Intronic
1101077077 12:101141590-101141612 TCTGAGAAGTAGACAGAGGATGG + Intergenic
1101418725 12:104531504-104531526 AGTGACATGGATACAAAGGATGG + Intronic
1101740450 12:107495806-107495828 ACAGACAAGAAAACAGAGGCAGG - Intronic
1102933448 12:116879254-116879276 AATGAGAAGGAAAGAGAGGAAGG - Intronic
1103147171 12:118604888-118604910 ACAGACAAGGAGACTGAGGCTGG - Intergenic
1103680663 12:122690966-122690988 AATAACAAGCAGAAAGAGGAAGG - Intergenic
1104550045 12:129748347-129748369 ACGGAGAATGAGACTGAGGAGGG + Intronic
1104799287 12:131542629-131542651 GCTGACAGGGAGACAGATGGAGG + Intergenic
1105712496 13:23026146-23026168 ACTGACAAGGAGGCAGAAGTGGG + Intergenic
1105790845 13:23797302-23797324 ACAGCCCAGGAGACAGAGCAAGG - Intronic
1106199709 13:27526156-27526178 CCTGTCAAGGAGTCAGATGATGG - Intergenic
1106435327 13:29718430-29718452 AGTGACAAGAATAGAGAGGAAGG - Intergenic
1106621867 13:31377992-31378014 ACTGCCAAGGAAATATAGGAAGG + Intergenic
1106656617 13:31753381-31753403 ATTGACCAGAAGACAGAAGAAGG + Intronic
1107148555 13:37086200-37086222 GGTGAGAAGGAGAAAGAGGAGGG + Intergenic
1107510552 13:41079579-41079601 ACTGGCAAGGATGCAGAGAAAGG + Intronic
1109428124 13:62194503-62194525 AGTGAGAAGGACATAGAGGATGG - Intergenic
1110062069 13:71054861-71054883 ACTGACCAGGAGAGAATGGATGG - Intergenic
1110122945 13:71905809-71905831 ACTGACAGGGAAACTGAGGGTGG - Intergenic
1110470474 13:75854419-75854441 GATGACAGGAAGACAGAGGAGGG + Intronic
1112220475 13:97484672-97484694 ACTAACAAGGATACACAAGATGG - Intergenic
1112547171 13:100382232-100382254 GCTGAAAAGGGGACAGAGGAGGG + Intronic
1113282344 13:108802711-108802733 GCTGGCAAGGACACAGAGAAAGG - Intronic
1113454722 13:110440115-110440137 AGTGACAAGGACATGGAGGAGGG - Intronic
1113631654 13:111892210-111892232 GCTCACAGGGTGACAGAGGAAGG - Intergenic
1113975684 13:114225681-114225703 ACGGACAAGGAGAAAGAAGGAGG + Intergenic
1114149585 14:20022358-20022380 ACTGACAAGGTTACAAGGGAAGG + Intergenic
1114479806 14:23025670-23025692 ACGGAGAAGGAGAGAGAGGCAGG - Intronic
1115635494 14:35286872-35286894 ACAGACAAGGGGGCAGAGGAGGG + Intronic
1117109063 14:52429802-52429824 CCTGAAAAGGATACAGAGGATGG + Intergenic
1117242885 14:53853093-53853115 AAGGAGAAGGAGAAAGAGGAGGG - Intergenic
1117367685 14:55046880-55046902 CCTTACAAAGACACAGAGGAAGG - Exonic
1117811601 14:59552623-59552645 ACTGACAAGTTGAGAGAAGAAGG + Intronic
1117855420 14:60026251-60026273 GCTGACAAGGATATAGAGAAAGG - Intronic
1118810502 14:69270020-69270042 CCAGACAAGGAGACAAAGGCGGG - Intronic
1119019310 14:71093758-71093780 GCTGAGAAGGAGGAAGAGGAGGG - Intronic
1119258445 14:73220583-73220605 ACTGCCAAGGGGAAAGAGAAGGG + Exonic
1119375853 14:74192225-74192247 ACTGACAAGAAGGCCAAGGAAGG + Intronic
1119881128 14:78100838-78100860 ACTGGAAAGGAGAGAGAGGCTGG - Intergenic
1120054714 14:79909964-79909986 AAGGAAAAGGAGACAGAGAAGGG - Intergenic
1120204271 14:81571022-81571044 ACTGATAAGTAGAGAGAGGGAGG - Intergenic
1120386887 14:83857738-83857760 CATTACAAAGAGACAGAGGAAGG - Intergenic
1120395790 14:83965475-83965497 AATGACAGGGAGACAGAAAAGGG - Intergenic
1120538587 14:85727542-85727564 ACTTACAAAGACACAGAGAAGGG + Intergenic
1121420639 14:93810985-93811007 TCAGAGAAGGAGGCAGAGGATGG + Intergenic
1121468010 14:94128359-94128381 ACTCAGAAGGAGCCAGAAGAGGG + Intronic
1121736529 14:96221789-96221811 ACTGGAGAGGAGAGAGAGGAAGG + Intronic
1122005776 14:98702466-98702488 AGAGACAAGGACACAGAGAAAGG - Intergenic
1122489936 14:102107824-102107846 TCTGACAAGGATCCATAGGAGGG + Intronic
1122582703 14:102781222-102781244 ACTGGCAAGGAGTGACAGGATGG - Intronic
1122795800 14:104205602-104205624 ACTGACAAAGAGAAAGACGGAGG - Intergenic
1124494658 15:30178948-30178970 ACTGACAGCCAGAGAGAGGAAGG + Intergenic
1124511577 15:30331800-30331822 ACTCATAAGGAGAAAGAGAAAGG + Intergenic
1124731337 15:32198957-32198979 ACTCATAAGGAGAAAGAGAAAGG - Intergenic
1124748912 15:32359697-32359719 ACTGACAGCCAGAGAGAGGAAGG - Intergenic
1125416113 15:39454663-39454685 AGTGACAAGGAGACACAGATTGG + Intergenic
1125569635 15:40706394-40706416 AATGATAAAGAGATAGAGGAAGG + Intronic
1125715667 15:41818639-41818661 ACTGAAATGGAGAGAGGGGAGGG - Intronic
1125736414 15:41929408-41929430 ACAGACATGGGAACAGAGGAAGG + Intronic
1125892488 15:43276770-43276792 ACTGCACAGGAGACTGAGGAGGG + Intronic
1126256914 15:46638512-46638534 TTTGACAGGAAGACAGAGGAGGG + Intergenic
1126351987 15:47753409-47753431 GCTGACAAGGACACAGAGGATGG + Intronic
1127006341 15:54574569-54574591 TCAGAGAAGGAAACAGAGGATGG - Intronic
1127141789 15:55985399-55985421 ACTGGCAAGGGTACTGAGGAGGG + Intronic
1127699761 15:61486941-61486963 GCTGGCAAGGATACAGAGAAAGG - Intergenic
1127965403 15:63919124-63919146 GCTGGCCAGGACACAGAGGAAGG + Intronic
1128237906 15:66080044-66080066 AAAGAGAAGGAGACAGAGGCTGG + Intronic
1130046201 15:80446848-80446870 AATGAGACAGAGACAGAGGAAGG - Intronic
1130159445 15:81384123-81384145 CCTCACAAGCAGAGAGAGGAAGG - Intergenic
1131077849 15:89507287-89507309 ACGGAGAAGGAGGAAGAGGAGGG - Intergenic
1131579928 15:93633165-93633187 ACTAACAAGTGTACAGAGGAGGG - Intergenic
1131611314 15:93967399-93967421 ACACACAAAGAGACAGAGAAAGG + Intergenic
1131646316 15:94348964-94348986 ACAGACAAGCAGATAGAGGTAGG - Intronic
1131727168 15:95239359-95239381 AGAGAAAAGGAGAAAGAGGAAGG + Intergenic
1131928975 15:97418295-97418317 ACTGACAAGTTGAGAGAAGAAGG - Intergenic
1133469258 16:6058341-6058363 TCTGAGAAGGAGAGGGAGGAAGG - Intronic
1133707561 16:8369611-8369633 TCTGCAGAGGAGACAGAGGAAGG - Intergenic
1133926935 16:10200862-10200884 ACTGAGGAGCAGCCAGAGGAGGG + Intergenic
1134350187 16:13430326-13430348 AGTTACATGGAGACACAGGATGG - Intergenic
1135147753 16:19977813-19977835 ACTGAGGAGGAGGAAGAGGAGGG - Intergenic
1135604843 16:23814568-23814590 AGGGACAAGGAGATAGAGGAAGG - Intergenic
1135948456 16:26887847-26887869 TCAGACAAGGAGGCACAGGAGGG + Intergenic
1136104307 16:28018595-28018617 CCTGACAAGGAGACTGAAAAGGG - Intronic
1136400762 16:30016852-30016874 ACTGACGTGGGGACAGGGGATGG + Intronic
1136594681 16:31239847-31239869 CCAGACAGGGAGAGAGAGGAGGG - Intergenic
1136686510 16:31997898-31997920 AATGCCAAGGAGGCAGAGAAGGG - Intergenic
1136690296 16:32023946-32023968 ACTGAAAAGGAAAGAGAGCAGGG + Intergenic
1136698368 16:32107364-32107386 ACCTGCAAGGAGAAAGAGGACGG - Intergenic
1136787125 16:32941433-32941455 AATGCCAAGGAGGCAGAGAAGGG - Intergenic
1136790885 16:32967510-32967532 ACTGAAAAGGAAAGAGAGCAGGG + Intergenic
1136798872 16:33050661-33050683 ACCTGCAAGGAGAAAGAGGACGG - Intergenic
1136878930 16:33886422-33886444 ACTGAAAAGGAAAGAGAGCAGGG - Intergenic
1136882651 16:33912351-33912373 AATGCCAAGGAGGCAGAGAAGGG + Intergenic
1137708644 16:50551502-50551524 ACTCCCAAGGAGACAGAGGCCGG - Intronic
1138874879 16:60937079-60937101 ACTGACAAGTTGAGAGAAGAAGG + Intergenic
1139361351 16:66402123-66402145 ACAGACAAGGAAACTGAGGCTGG + Intronic
1139469815 16:67172101-67172123 CCAGAGAAGGAGGCAGAGGAGGG + Intronic
1139660671 16:68418774-68418796 ATTTACAAGGAGACAGAGCCAGG - Intronic
1139965416 16:70742463-70742485 ACTGACTTGGGGACACAGGACGG + Intronic
1140112543 16:72016305-72016327 ACTGGCAAAGAGGAAGAGGAAGG + Intronic
1140375380 16:74441344-74441366 ACTGTCAAGAAGAAGGAGGAAGG - Intergenic
1140984277 16:80142707-80142729 ACTGGCAGGAAGACAGGGGAGGG + Intergenic
1141113718 16:81290952-81290974 AAAGAGAAAGAGACAGAGGAAGG - Exonic
1141393325 16:83682657-83682679 ACAGGCAAAGAGACAGAGGAAGG - Intronic
1141775829 16:86121976-86121998 AGGGACAAGGAGAAGGAGGAGGG - Intergenic
1203089360 16_KI270728v1_random:1203110-1203132 AATGCCAAGGAGGCAGAGAAGGG - Intergenic
1203093090 16_KI270728v1_random:1228967-1228989 ACTGAAAAGGAAAGAGAGCAGGG + Intergenic
1142873432 17:2836180-2836202 ACCGGCAAGGAAACACAGGAGGG - Intronic
1143590177 17:7880991-7881013 ACTGACAGACTGACAGAGGAAGG + Intronic
1144116652 17:12100026-12100048 ACTTGCAAGGAGAAAGAAGAGGG - Intronic
1144947528 17:18977579-18977601 ACAGACAAGGAGGCACAGGTGGG - Exonic
1144968804 17:19094222-19094244 ACTGTCAACAAGACAGATGAAGG + Exonic
1144979112 17:19157844-19157866 ACTGTCAACAAGACAGATGAAGG - Exonic
1144989110 17:19220388-19220410 ACTGTCAACAAGACAGATGAAGG + Exonic
1145279652 17:21458086-21458108 ACTGAGGAGAAGACAGAGCAGGG + Intergenic
1146543940 17:33721900-33721922 AGTGACAAGGCGAGAGATGAAGG + Intronic
1147153153 17:38530081-38530103 ACTGAAAAGGAAAGAGAGCAGGG + Exonic
1147355380 17:39891854-39891876 ACTGGAAAGGAGAGAGAAGAAGG + Intergenic
1147943550 17:44066857-44066879 AATGAAAAGGGGAAAGAGGAGGG + Intronic
1147982439 17:44282779-44282801 AGAAACAAGGAGCCAGAGGAGGG - Intergenic
1148201432 17:45752528-45752550 ACTGAAAAGGAGAGAATGGAAGG - Intergenic
1148657264 17:49296095-49296117 AATGCCAAGGAGACTGTGGAGGG + Exonic
1149604727 17:57916595-57916617 CCTGACAGGAAGACAGCGGAAGG + Intronic
1150647620 17:66989353-66989375 ACGGAGAAGGACACAGAAGATGG + Intronic
1151411047 17:73929937-73929959 ACAGACAAGGAGACAGGAGGGGG + Intergenic
1151603039 17:75118344-75118366 GCTGACATGGAGAGAGAGCAGGG - Intronic
1152297532 17:79476839-79476861 ACAGAGAAGGAGGAAGAGGAGGG + Intronic
1152343905 17:79740084-79740106 ACTGGCAGGGAGACTGAGGTGGG + Intronic
1152481868 17:80559589-80559611 TCTGAGCAGGAGAGAGAGGATGG + Intronic
1152730889 17:81969366-81969388 CCTGACAGGGTGACAGGGGAAGG + Intergenic
1152838046 17:82547757-82547779 ACTGCCAAGGGGCAAGAGGAAGG - Intronic
1153729668 18:7997882-7997904 ACTGGCAAGGATGCAGAGAAAGG + Intronic
1153912644 18:9717774-9717796 GCTGGCAAGGAGAAAGAGCAAGG + Intronic
1153948184 18:10035159-10035181 AATGCCACGGAGACAGAGAAAGG - Intergenic
1154095740 18:11413582-11413604 ACTCACAGGGAGACAGGGGTGGG - Intergenic
1154384853 18:13884025-13884047 ACTAACAGGGAGAAAGAGGAGGG + Exonic
1155112906 18:22734358-22734380 ACTGACACTGAGGGAGAGGAGGG - Intergenic
1155280080 18:24230235-24230257 ACAAACAAGGAGAGGGAGGAGGG + Intronic
1155467659 18:26156155-26156177 GCTGGCAAGGATACAGAGAAAGG + Intronic
1155567120 18:27147529-27147551 AGTGGGAAGGAGATAGAGGATGG - Intronic
1156072562 18:33230446-33230468 GCAGCCAAGGAGATAGAGGAGGG - Intronic
1156117421 18:33802776-33802798 TCTCAAAAGAAGACAGAGGAGGG + Intergenic
1156271417 18:35536568-35536590 AATGTGAAGGAGACAGAGGAGGG - Intergenic
1156409238 18:36811892-36811914 TCTGCCAAGGAGAAAAAGGAAGG - Intronic
1156596871 18:38557597-38557619 ATTGACAAGGAGTCAGTGCAGGG + Intergenic
1157126938 18:44965046-44965068 ACTGAGAAGGAGACAAATTAGGG + Intronic
1157185646 18:45538174-45538196 GCTGACATGGAGATAGAGGCAGG - Intronic
1157301482 18:46482913-46482935 GCTGAGAAGGAGCCAGGGGAGGG - Intronic
1157551283 18:48583270-48583292 AAGGACAAGGAGGCAGAGCAGGG + Intronic
1157991034 18:52496649-52496671 TCTGTTAAGGAGACAGTGGAGGG + Intronic
1158421624 18:57299841-57299863 ATGGACAAGGAGACTGAGGTAGG + Intergenic
1159834625 18:73324116-73324138 ACTGAGAAGGAGGAAGAGGAAGG - Intergenic
1159954187 18:74507800-74507822 CCTGACAAGGAGAGGGAGGCCGG - Intronic
1160081168 18:75728585-75728607 TCTGACAAGGACTTAGAGGAAGG - Intergenic
1160700139 19:502136-502158 ACAGACAAGGAAACTGAGGCTGG - Intronic
1161054032 19:2181002-2181024 ACTGACAAGGAGACAGAGGAAGG - Intronic
1161289039 19:3483095-3483117 GCTGAGGAGGGGACAGAGGAGGG - Intergenic
1161784075 19:6312205-6312227 ACTGCCCAGGAGCCACAGGATGG + Exonic
1161895754 19:7078756-7078778 ACTGGAGAGGAGACAGAGAAAGG - Intronic
1162526666 19:11210331-11210353 ACAGATAAGGAGACAGGTGAAGG - Intronic
1162526677 19:11210407-11210429 ACAGGCAAGGAGACAGGTGAAGG - Intronic
1162526683 19:11210435-11210457 ACAGGCAAGGAGACAGGTGAAGG - Intronic
1162526771 19:11210774-11210796 ACAGATAAGGAGACAGCTGAAGG - Intronic
1162550943 19:11357792-11357814 ACAGATAAGGAGACTGAGGTTGG - Intronic
1163492038 19:17622850-17622872 CCAGACAAGGAAACAGAGGCTGG + Intronic
1163821634 19:19499537-19499559 ACTGCCCAGGATACAGAGGGAGG + Intronic
1164522186 19:28988186-28988208 AAAGAAAAGGAGAGAGAGGAGGG + Intergenic
1164573571 19:29391907-29391929 GCAGACAAGGAGAGAGTGGAGGG - Intergenic
1164861661 19:31566537-31566559 CCTGACAGGGGGAAAGAGGAGGG + Intergenic
1165307968 19:35013722-35013744 ACTGATAGGAAGAGAGAGGAGGG + Intronic
1165814494 19:38633261-38633283 ACTGAGAAGGAGCCACCGGAGGG + Intronic
1166303176 19:41923556-41923578 AGGGACAAGGAGACAGGGGCAGG + Intronic
1166304171 19:41928252-41928274 ACAGCCAAGGAGACAGAGACGGG + Intronic
1166670634 19:44707728-44707750 GCTGGGAAGGAGACTGAGGAAGG - Intronic
1166819319 19:45567506-45567528 TCAGATAAGGAGACAGAGCAGGG + Intronic
1167084597 19:47300660-47300682 ACAGAGAAAGAGAGAGAGGAGGG - Intronic
1167579350 19:50332715-50332737 ACTGAAAACGAGACAGACGTTGG - Intronic
1167711589 19:51115046-51115068 AGTGACAGGGACTCAGAGGAGGG - Intergenic
1168191690 19:54742924-54742946 ACAGAGAATGAGCCAGAGGAAGG + Intronic
1168193964 19:54759556-54759578 ACAGAGAATGAGCCAGAGGAAGG + Intronic
1168196009 19:54774281-54774303 ACAGAGAATGAGCCAGAGGAAGG + Intronic
1168197906 19:54789144-54789166 ACAGAGAATGAGCCAGAGGAAGG + Intronic
1168204374 19:54838527-54838549 ACAGAGAAAGAGCCAGAGGAAGG + Intronic
1168206600 19:54854700-54854722 ACAGAGAATGAGCCAGAGGAAGG + Intronic
1168236668 19:55068026-55068048 AGAGAGAAGGAGACACAGGAGGG - Intronic
1202672185 1_KI270709v1_random:65709-65731 ACCTGCAAGGAGAAAGAGGACGG - Intergenic
925028985 2:634843-634865 ACTGAGAAAGAGACAGGAGAAGG + Intergenic
925317142 2:2935275-2935297 GCTGAGGAGGAGGCAGAGGAGGG + Intergenic
925665110 2:6245109-6245131 ATGGCCCAGGAGACAGAGGAGGG - Intergenic
925789810 2:7472537-7472559 ACTGAGCAGGAGATGGAGGAGGG - Intergenic
926220869 2:10934733-10934755 AATGACAGGGAGGCAGAGGGAGG - Intergenic
927377784 2:22438255-22438277 TCTCACAAGGAGATAGAAGAGGG - Intergenic
927464381 2:23325977-23325999 AGACACAAGGGGACAGAGGAAGG + Intergenic
927607757 2:24503364-24503386 ACTGTTAAGAAGACAGAGGAAGG - Intronic
927803572 2:26123961-26123983 GCTGAGGAGGAGAAAGAGGAGGG - Intronic
929945251 2:46366471-46366493 AGCCACAAGGAGGCAGAGGAAGG - Intronic
930113885 2:47702212-47702234 AATGACTTGGAGGCAGAGGACGG - Intronic
930208238 2:48609536-48609558 AATGAGTAGGAGACAGAGGAAGG - Intronic
930293273 2:49522402-49522424 ACTGACAATGAGATACTGGAGGG + Intergenic
930862512 2:56089638-56089660 TCTGAAAATAAGACAGAGGAAGG - Intergenic
931529399 2:63197148-63197170 GCTGAGAAGGAGGAAGAGGAGGG - Intronic
931618507 2:64186487-64186509 TCAGATAAGGAGAAAGAGGAAGG + Intergenic
932595078 2:73088509-73088531 GCTTGCAAGGAGCCAGAGGATGG + Exonic
932887799 2:75562616-75562638 ACAGATAAGGAAACAGAGGTCGG - Intronic
933322501 2:80794804-80794826 ACTGACATGGAGGCAGTGAAAGG + Intergenic
933792639 2:85895373-85895395 ACTAACAAGGAGCCAAAGGCAGG + Intergenic
934056212 2:88253395-88253417 ACTGGAAGGGAGAGAGAGGAAGG - Intergenic
934062360 2:88306899-88306921 GGTGAAAAGGAGATAGAGGATGG - Intergenic
934581430 2:95444048-95444070 AGTGCCAAGGAGGCAGTGGAGGG - Intergenic
934598020 2:95632666-95632688 AGTGCCAAGGAGGCAGTGGAGGG + Intergenic
934652389 2:96099942-96099964 GGTGAGAAGGAGAAAGAGGAAGG + Intergenic
934723603 2:96600590-96600612 AAGGACAGGGAGACACAGGAAGG + Intronic
934765038 2:96875927-96875949 AGTGACAGGGAGACAGAGGAAGG + Exonic
935375130 2:102388017-102388039 ACAGACAGAGAGACAGAGTAAGG + Intronic
935836627 2:107062225-107062247 AGAGGCAAGGAGACAGAGAAAGG + Intergenic
936412480 2:112272999-112273021 CGTGTCAAGGGGACAGAGGAAGG + Intergenic
936496544 2:113027207-113027229 ACTGAGGAGAAGAAAGAGGAGGG + Intronic
936561199 2:113541473-113541495 ACTCCCAGGGAGACAGGGGACGG + Intergenic
936838613 2:116740864-116740886 ACTGTCAAGGAGACAGGGGTAGG + Intergenic
937198285 2:120179869-120179891 ACTGACAGGAAGATGGAGGATGG + Intergenic
937281765 2:120722238-120722260 ACTTACATGAAGACAGAGCAAGG - Intergenic
937821223 2:126313288-126313310 ACTTCCAAGGAGAAAGATGACGG - Intergenic
937832576 2:126439592-126439614 ACTGACAGAGAGACAGAGTGAGG + Intergenic
938646271 2:133333561-133333583 GCTGACAAGGTGACAGAGTGTGG - Intronic
939274304 2:139980390-139980412 ACTGAGGAGGAGAGAGATGAGGG + Intergenic
939339193 2:140871396-140871418 ACTGTTAAGGAAACAGAGAAAGG + Intronic
939752085 2:146060622-146060644 ACTGACAAGGATGTGGAGGAAGG + Intergenic
939857018 2:147370695-147370717 ACTGGCAAGGATGCAGAGAAAGG + Intergenic
939996860 2:148927889-148927911 AGGGACAGGGAGAGAGAGGAGGG - Intronic
940988488 2:160074017-160074039 ACTAGGAAGGAGACAGTGGAAGG + Intergenic
941590392 2:167413179-167413201 GCTGACAAGGAGAGAGATGGGGG + Intergenic
942482194 2:176401439-176401461 ATTGAAAAGGACTCAGAGGAGGG - Intergenic
942764592 2:179439708-179439730 ACTCACAAATAGGCAGAGGAAGG - Intergenic
944253332 2:197599499-197599521 TGTGAGAAGGAGAAAGAGGAAGG + Intronic
945103429 2:206285283-206285305 ACTGGCAAGGATGCAGAGAAGGG - Intronic
946305340 2:218853859-218853881 GCTGCAAAGGAGATAGAGGAGGG - Intergenic
947269507 2:228318368-228318390 ACTGACAAGGAGAGGGAGTTGGG - Intergenic
947385098 2:229583121-229583143 ACTGACATTGAGATTGAGGATGG - Intronic
947703470 2:232255302-232255324 ACTTAGAAGGAGTCAGAGCAGGG + Intronic
948200718 2:236128102-236128124 ACTGGCAAGCTGAGAGAGGAGGG - Exonic
948310945 2:236986334-236986356 AATGATATGGAGACAGATGAAGG + Intergenic
1168980199 20:1997386-1997408 ACAGAGAAGGAAACAGAGGCTGG + Intergenic
1169410793 20:5368142-5368164 ACTGAGAAGGAGTCAGTAGATGG + Intergenic
1169472718 20:5901935-5901957 GATGACAAGGAGACAGAGCATGG + Intergenic
1169742491 20:8910074-8910096 AATGGCAAGGAGAAAGAGAAAGG - Intronic
1170036414 20:11994594-11994616 CCTGACAAAGAGAGAGAGAAAGG - Intergenic
1170534551 20:17327013-17327035 ACAGATGAGGAGACAGAAGAAGG - Intronic
1171149715 20:22816598-22816620 ACTGGCTAAAAGACAGAGGAAGG + Intergenic
1171316315 20:24198858-24198880 ACTGACAGGCAGGCAGATGATGG - Intergenic
1172057035 20:32161254-32161276 CCTGAGGAGGAAACAGAGGAAGG - Exonic
1172308441 20:33898599-33898621 ACAGACAAGGAAACTGAGAAAGG - Intergenic
1172797299 20:37549631-37549653 GCTGGCAAGGAGGCAGAGGAAGG - Intergenic
1173301798 20:41810094-41810116 ACTGAAAAGTAGAAAGAAGAAGG + Intergenic
1173310987 20:41895628-41895650 ACTGAGAGGGAGAAAGGGGAGGG + Intergenic
1173317803 20:41960829-41960851 ACTGATGAGGAAACTGAGGAAGG + Intergenic
1173452838 20:43180388-43180410 TATGACAGGGAGAGAGAGGAAGG - Intronic
1174560570 20:51428075-51428097 AGGGTCAAGGACACAGAGGAAGG + Intronic
1174994875 20:55555166-55555188 ACAGGCAAGAAGACAGAGAAAGG + Intergenic
1175088380 20:56480753-56480775 ACTGAGAAGGAGAGAGATGGGGG + Intronic
1175363963 20:58438136-58438158 ACTGCCACAGTGACAGAGGAGGG + Intronic
1175849766 20:62083552-62083574 AGAGAGAAGGAGAAAGAGGAGGG - Intergenic
1177072970 21:16534153-16534175 AAGGAAAAGGAGACAGATGAAGG + Intergenic
1178706458 21:34877572-34877594 ACTGCCAAGGAGAAAAAGGAGGG + Intronic
1179999651 21:44989550-44989572 AGTGACAAGGAGACAGGAGCAGG - Intergenic
1181030013 22:20145163-20145185 ACGAACACGGGGACAGAGGACGG - Intronic
1181298864 22:21864793-21864815 ACTGATAAGGAAACAGAAGGGGG + Intronic
1181497415 22:23295343-23295365 ACAGACACGCAGACAGAGGGTGG - Intronic
1181513250 22:23398150-23398172 ACGAACACGGGGACAGAGGACGG + Intergenic
1182066524 22:27435248-27435270 ACAGACAGGGAGACTGAGGCCGG + Intergenic
1182722431 22:32414320-32414342 CCTGATAAGCAGACAGTGGAGGG - Exonic
1182899970 22:33889754-33889776 AGTGACCAGAAGATAGAGGAGGG + Intronic
1183079974 22:35450070-35450092 GCTGAGAAGGAGACAGGGAAGGG + Intergenic
1183280005 22:36926994-36927016 GCTGAAACGGAGACAGAGGGAGG + Intronic
1183739242 22:39661078-39661100 AGTGAGATGGAGACAGAGGGAGG - Intronic
1183836426 22:40457641-40457663 TCTGTCAAGAAGACAGAGCAAGG + Intronic
1185156040 22:49194100-49194122 CCTGAGAAGGAGGCATAGGAAGG + Intergenic
949644230 3:6074928-6074950 AATGACAAGAAGACAGGGGTTGG + Intergenic
949804108 3:7935332-7935354 ACTGACAAGTTGACAGAAGTAGG + Intergenic
950184275 3:10935408-10935430 ACAGACAGGAAGACAGAGGCTGG - Intronic
950392227 3:12705653-12705675 CCTGCAAAGGAGACAGAGAAGGG + Intergenic
951493759 3:23302040-23302062 ACTGACAAGGAGAAATAAAAGGG - Intronic
952331342 3:32367045-32367067 AGTAACTTGGAGACAGAGGAAGG - Intronic
952932016 3:38367825-38367847 AATGCCAAGGAGATAGAGGAAGG + Intronic
953395902 3:42569551-42569573 ACTTGCAAGGAGATAGAAGAAGG + Intronic
954783862 3:53079240-53079262 AATGAGAAGGAGGAAGAGGAAGG + Intronic
956543242 3:70367860-70367882 ACTGGCAAGGATACGGAGAAAGG - Intergenic
956783803 3:72625500-72625522 AGTGACAAGGAGGAAAAGGAGGG + Intergenic
957892595 3:86379243-86379265 ACTGAGAAGGAGACAAAGAAGGG + Intergenic
959565264 3:107826665-107826687 TCGGCCAAGGAGACAGGGGAAGG - Intergenic
959565270 3:107826689-107826711 ACAGTGAAGGTGACAGAGGATGG - Intergenic
959627641 3:108471038-108471060 AAAGAAAAGGAGAAAGAGGAAGG + Intronic
960770451 3:121187920-121187942 ACCAACAAAGAGACAGAGAAGGG + Intronic
960799450 3:121523125-121523147 ACTAACCAGGAGACTGAGGTAGG - Intronic
960930957 3:122849461-122849483 GCTGACAAGGATACAGAGAAGGG - Intronic
961009826 3:123428263-123428285 ACAGACAAGGAAACTGAGGCAGG + Intronic
962269182 3:133965720-133965742 CCTGAGAAGAAGACAGAGGGAGG - Intronic
962336631 3:134537671-134537693 ATGGAAAAGGAGACAGAGGGAGG - Intronic
962681115 3:137801426-137801448 TCTGCCAAGGAGACAGAGGAGGG + Intergenic
963062825 3:141238914-141238936 GCTGAGAAGGAGGAAGAGGAGGG + Intronic
964311355 3:155396623-155396645 ACTGAGAAGGAGGAAGAGGAGGG + Intronic
964450393 3:156807059-156807081 ACTGATAAGGAAATGGAGGAAGG - Intergenic
964517673 3:157530542-157530564 ACTCACAAGGAGAGAGAAGGGGG + Intronic
965078247 3:164004422-164004444 ACTGGCCGGGAGCCAGAGGAAGG - Intergenic
965884029 3:173422602-173422624 GCTGGCAAGGAGAAAGAGGAAGG - Intronic
966276994 3:178185306-178185328 ACTGAAAATGATACAGAGAAAGG - Intergenic
966836461 3:184053112-184053134 ACTGACAGTGAGGCAGAGGAGGG - Exonic
967000567 3:185330276-185330298 TCTGAGATGAAGACAGAGGAAGG - Intronic
967192074 3:186993051-186993073 TATGGCCAGGAGACAGAGGAGGG - Intronic
967194697 3:187016299-187016321 GCTAAAAAGGAGACAGAGAAGGG + Intronic
968956935 4:3724238-3724260 ACTGCCAAGGAGACAGAGTGAGG + Intergenic
969247421 4:5944730-5944752 AGGGACAAGGAAACAGAAGAGGG + Intronic
969587640 4:8103736-8103758 CCTGCCCAGGTGACAGAGGAGGG + Intronic
969686823 4:8680198-8680220 AGAGACAAAGAGAAAGAGGAAGG + Intergenic
969689871 4:8698530-8698552 AAAGACCAGGAGGCAGAGGAGGG + Intergenic
969963345 4:10969541-10969563 AAAGAGAAGGAGAGAGAGGAAGG - Intergenic
970236531 4:13964368-13964390 GCTGAAAAGGAGGAAGAGGAGGG - Intergenic
970432653 4:16002918-16002940 ATTGAAAAGGAGGAAGAGGAGGG + Intronic
970791892 4:19867805-19867827 ACTGACAAGTCGACAGAAGTAGG - Intergenic
970898772 4:21134212-21134234 ACTAAGAAGGAGGAAGAGGAGGG - Intronic
970991751 4:22220917-22220939 ACTGACAGAGAATCAGAGGAAGG + Intergenic
972230910 4:37071931-37071953 GATGACAAGGGGGCAGAGGAAGG - Intergenic
972362687 4:38342998-38343020 GCTGAGGAGGAGAAAGAGGAGGG - Intergenic
972690347 4:41391134-41391156 ACTGCCAAGGATATAGAGTAGGG + Intronic
974068691 4:57104371-57104393 ACTGTCAGAGAGCCAGAGGAGGG - Intronic
975940777 4:79643025-79643047 ACTCAGAAGAGGACAGAGGATGG - Intergenic
975949127 4:79746876-79746898 ACAGGCAAGGAGAGAGAAGAAGG + Intergenic
976220992 4:82756779-82756801 ACAGACAAGGAGACCAAGGAGGG - Intronic
976487649 4:85627059-85627081 ACTGACAAGTTGAGAGAAGAAGG - Intronic
976668484 4:87626040-87626062 ACTGAGAAGCAGTGAGAGGATGG - Intergenic
977025400 4:91812611-91812633 AATTAGAAGGATACAGAGGAAGG - Intergenic
979151901 4:117328316-117328338 TCTGTCCAGGAGAGAGAGGAAGG - Intergenic
979211117 4:118104310-118104332 ACAGAGAAGGAGACAGAGAGAGG + Intronic
979399443 4:120230580-120230602 ACTAAGAAGGAAACAGATGAAGG + Intergenic
979557124 4:122061856-122061878 GCTGAGAAGGAGAAAGAAGAGGG - Intergenic
980983702 4:139675289-139675311 TCTGGCATGGAGACAGAGCAAGG - Intronic
981890851 4:149734775-149734797 GATAACAAAGAGACAGAGGAGGG - Intergenic
983502745 4:168518260-168518282 AATAACAAAGAGACAGATGATGG - Intronic
984894845 4:184529133-184529155 ACCGACAAGGGGACAGGGAATGG + Intergenic
985028590 4:185764984-185765006 ACTCACAACCAGACAAAGGAAGG - Intronic
985237498 4:187892012-187892034 ATGGATAAGTAGACAGAGGAAGG + Intergenic
986046914 5:4047299-4047321 ACTAAAAAGAAGACAAAGGAAGG + Intergenic
986066391 5:4238414-4238436 ATTGGCAAGGATACAGAGAAAGG - Intergenic
986110006 5:4705803-4705825 ACTGATAAGGAAAAAGAGAAGGG - Intergenic
986661360 5:10062956-10062978 ACTCAGAGGCAGACAGAGGAGGG - Intergenic
987023472 5:13899229-13899251 AGTGTCAAGGAGACCAAGGATGG - Intronic
987939237 5:24511346-24511368 ACTGAGAAGGACACACAGGAAGG - Exonic
988116768 5:26903656-26903678 ACTGACAAGGATACACAGGAAGG - Exonic
989363107 5:40625613-40625635 ACCTACAAGGACACAGAAGAAGG - Intergenic
990392023 5:55332946-55332968 TCTGAAAATGAGACAGATGACGG - Intronic
990633403 5:57695764-57695786 AATGGCAAGAAGTCAGAGGAAGG + Intergenic
990695204 5:58408748-58408770 AATGAGAAGGGGACAGAGTAAGG - Intergenic
991543779 5:67758694-67758716 ACTGACAAGTTGAGAGAAGAAGG + Intergenic
992083713 5:73259349-73259371 ACTGAGTAGGGGACAGAGGGTGG + Intergenic
992110140 5:73485077-73485099 ACAGACTGGGAGACAGGGGATGG - Intergenic
993929730 5:93923074-93923096 GCTGAGGAGGAGAAAGAGGAGGG - Intronic
994737630 5:103575150-103575172 ACTGGGAGGGAGAGAGAGGAAGG - Intergenic
995319981 5:110823610-110823632 GCTGACAATGAGAGTGAGGAGGG - Intergenic
996148120 5:120000005-120000027 AGGGAGAAGGAGATAGAGGAAGG + Intergenic
996181533 5:120426198-120426220 ACTGACAAGCTGAGAGAAGAAGG - Intergenic
996769113 5:127066952-127066974 ATTGTCAAGGAGACTGATGAGGG + Intronic
997136940 5:131336954-131336976 ACTGACGAGCTGACAGAGGAAGG - Intronic
998921779 5:147076769-147076791 ACTGAAGAGGAGACAGAGCATGG - Intronic
998975617 5:147643285-147643307 ACTGCCACTGAGACAGAGAAAGG - Intronic
999107781 5:149088927-149088949 ACTGGCAAGGTGCAAGAGGAAGG - Intergenic
999247814 5:150164658-150164680 ACTGGCAAGTACACAGAGGAGGG - Intergenic
999323024 5:150626319-150626341 TCTCCTAAGGAGACAGAGGAAGG - Intronic
999408959 5:151333493-151333515 AATGCCAAAGAGCCAGAGGACGG + Intronic
999904398 5:156123581-156123603 ACTTACAGGGAAACTGAGGATGG - Intronic
1000505997 5:162118905-162118927 ACTCAGAGGAAGACAGAGGAAGG + Intronic
1000508107 5:162147342-162147364 ACAGAAAGAGAGACAGAGGAAGG - Intronic
1000853332 5:166367683-166367705 ACTGACAAGTGTACAGAGAATGG + Intergenic
1001993430 5:176135085-176135107 ACTGATAAGGAGGGAGAGGCTGG + Intergenic
1002100206 5:176853830-176853852 ACTGCTAGGGCGACAGAGGATGG + Intronic
1002107320 5:176886617-176886639 ACTGAGAAGGAAACAAAGAAAGG + Intronic
1002175242 5:177397910-177397932 GCAGACAAGGAGATAGAGGACGG - Exonic
1002449969 5:179313216-179313238 ACACACACCGAGACAGAGGAGGG + Intronic
1002449982 5:179313298-179313320 ACTCACACCGAGACAGAGGAGGG + Intronic
1002449995 5:179313380-179313402 ACACACACCGAGACAGAGGAGGG + Intronic
1002450008 5:179313462-179313484 ACTCACACCGAGACAGAGGAGGG + Intronic
1002450021 5:179313544-179313566 ACACACATCGAGACAGAGGAGGG + Intronic
1002450033 5:179313630-179313652 ACTCACACCGAGACAGAGGAGGG + Intronic
1002450045 5:179313716-179313738 ACTCACACCGAGACAGAGGAGGG + Intronic
1002450058 5:179313802-179313824 ACTCACACCGAGACAGAGGAGGG + Intronic
1002450072 5:179313888-179313910 ACTCACATCGAGACAGAGGAGGG + Intronic
1002450085 5:179313974-179313996 ACTCACACCGAGACAGAGGAGGG + Intronic
1002958668 6:1893525-1893547 ACTGAGAATGAAAAAGAGGATGG - Intronic
1004184370 6:13409350-13409372 AGAGAGAAAGAGACAGAGGAAGG + Intronic
1004185679 6:13419439-13419461 ACAGTCCAGGAGAGAGAGGATGG - Intronic
1005033021 6:21529082-21529104 ATTGAAAAGGAGAAAGAAGAAGG - Intergenic
1005041567 6:21605170-21605192 ACTGACATGGTGACAAAGTATGG + Intergenic
1005882996 6:30074650-30074672 ACTGACAAGAGGATGGAGGAAGG - Intronic
1005941877 6:30566604-30566626 CCAGACAAGGAGACTAAGGAGGG + Intergenic
1006365967 6:33615332-33615354 ACTGTCAGGGAGAAAGAGGTGGG - Intergenic
1006590019 6:35148117-35148139 ACTTACAAGGTGAAAAAGGATGG - Intronic
1007765717 6:44158705-44158727 ACTGAGAAGGAGAAAAGGGAAGG + Intergenic
1008200921 6:48589149-48589171 ACTCAGAAGGACAAAGAGGAAGG + Intergenic
1008310250 6:49959823-49959845 TCTTGCAAGGTGACAGAGGAAGG + Intergenic
1008585992 6:52949964-52949986 GCTGAGGAGGAGAAAGAGGAGGG - Intergenic
1009056785 6:58345908-58345930 ACTGAGGAGGAGAAAGAGGAGGG - Intergenic
1009834196 6:68976740-68976762 GCTGAGAAGGAGAAAGAGGAGGG + Intronic
1010544688 6:77137848-77137870 ACTGACATGGGGAGAGTGGATGG - Intergenic
1010897238 6:81379391-81379413 ACAGGCAAGGGCACAGAGGAAGG + Intergenic
1012547995 6:100441259-100441281 AGTGCCAAGGGGCCAGAGGATGG + Intronic
1012912272 6:105131938-105131960 AATGACAAGGAAAAAGAGGCTGG - Intronic
1014461078 6:121696349-121696371 ACAAATAAGGATACAGAGGAGGG - Intergenic
1014573835 6:123045450-123045472 AGTGACACCGAGAAAGAGGAAGG + Intronic
1014708108 6:124773290-124773312 AATGGGAAGGAGAAAGAGGAGGG + Intronic
1015766969 6:136728992-136729014 AGTGAAACAGAGACAGAGGAGGG + Intronic
1016097955 6:140061255-140061277 AATAAGATGGAGACAGAGGATGG + Intergenic
1017444433 6:154494498-154494520 ACTGTCAAGGAAACAGAACACGG + Intronic
1017488028 6:154920917-154920939 ACTGATAAGGACAGAGAGGAGGG - Intronic
1017644026 6:156522476-156522498 ACAGAGACAGAGACAGAGGAGGG - Intergenic
1018717206 6:166542711-166542733 AGTGACAGGGAGAAAGATGAGGG + Intronic
1019404647 7:877116-877138 GCGGCCGAGGAGACAGAGGAAGG - Intronic
1019908642 7:4083826-4083848 ACAGACAGAGAGAGAGAGGAAGG - Intronic
1020083180 7:5297225-5297247 ACAGAGAAGGGGACAGAGAAGGG - Intronic
1020173951 7:5867584-5867606 AGAGAAAAGGAGAAAGAGGAGGG - Intergenic
1021695239 7:23269909-23269931 ACAGAGAAGGGGAGAGAGGAAGG - Intronic
1022106722 7:27202032-27202054 AGTGACAAAGAGACAGAGTAGGG + Intergenic
1023040900 7:36172485-36172507 ACTGGAAAGGATACAGATGAAGG - Intronic
1023153995 7:37229476-37229498 ATAGAGAAGGAGACAGAGGCTGG + Intronic
1023374447 7:39541984-39542006 ACTGCTTAGGAGACAAAGGAGGG - Intergenic
1024601042 7:50982015-50982037 ACTGTCAAACAGGCAGAGGATGG - Intergenic
1024805096 7:53130185-53130207 ACCTGCAAGGAGAAAGAGGACGG + Intergenic
1025593954 7:62900998-62901020 ACTGACAAGTTGAGAGAAGAAGG + Intergenic
1026662415 7:72313840-72313862 AACTACAAGGAAACAGAGGAAGG + Intronic
1026831236 7:73611430-73611452 ACAAACGAGGACACAGAGGAAGG + Intronic
1027879369 7:83813906-83813928 ACTGACAAGAAAAAAGAGAATGG - Intergenic
1028094014 7:86738077-86738099 AATGACAAGGAGAGACAGGCAGG + Intronic
1028134284 7:87210030-87210052 GGTGACAGAGAGACAGAGGAGGG + Intronic
1029217461 7:98961616-98961638 ACTGACATGGAAACATAGAATGG + Intronic
1029601438 7:101565799-101565821 ACTCAGAAGGAGGCAGAGGCTGG - Intergenic
1030169641 7:106588509-106588531 ACTGAGAAGGAGAAAGATAATGG + Intergenic
1030235296 7:107253280-107253302 ACTAACAAGGAAACTGAGAAAGG + Intronic
1030306812 7:108027169-108027191 TCTGACAAGTGGTCAGAGGATGG + Intronic
1030518707 7:110569570-110569592 ACTGACAAGCAGAAAGAAGGAGG - Intergenic
1030564905 7:111141602-111141624 ACCCACAATGATACAGAGGATGG - Intronic
1030714023 7:112788153-112788175 ACCTTCAAGGAGACCGAGGAGGG - Intronic
1032369949 7:131338897-131338919 GCTGAGAAGGAGAAAGAGAAGGG - Intronic
1032763791 7:134971197-134971219 ACTGGCAATGAGAAGGAGGATGG - Intergenic
1034338907 7:150340211-150340233 ACAGACAGGCAGGCAGAGGATGG + Intronic
1036165638 8:6430086-6430108 TCTGACAAGGAGGCAGATGTGGG - Intronic
1036767687 8:11559084-11559106 ATTGAATAGGAGACAGCGGAGGG - Intronic
1037007341 8:13798431-13798453 AATGACAAGGAGCCAGGGGGAGG - Intergenic
1037623327 8:20586321-20586343 AGTGACAAGAAGAGAGGGGATGG + Intergenic
1037999392 8:23378920-23378942 ACTGACAAGTTGAGAGAAGAAGG - Intronic
1038683687 8:29695105-29695127 ACTGGCAAAGATAGAGAGGAAGG - Intergenic
1038980364 8:32752690-32752712 AATGACAGAGAGACCGAGGAAGG - Intronic
1039307374 8:36277449-36277471 ACTGCAAAGGACACAGAGGGAGG - Intergenic
1040027295 8:42793474-42793496 GCTGGCAAGGATACAGAGAAAGG - Intronic
1040642939 8:49361536-49361558 GCTGATAAGGACACAGAGAAAGG - Intergenic
1040643059 8:49363137-49363159 GCTGATAAGGACACAGAGAAAGG - Intergenic
1041522386 8:58770805-58770827 AAAGACAAAGAGGCAGAGGAAGG + Intergenic
1041558323 8:59184650-59184672 ACAGAATAGGAGACAGAGCATGG - Intergenic
1042115582 8:65427498-65427520 TTTGACAAGTAGAGAGAGGAAGG + Intergenic
1043360572 8:79466994-79467016 ACTAAGATGGAGACAGAGGCAGG - Intergenic
1043624016 8:82232316-82232338 GCTGACAAGGATGCAGAGAAAGG + Intergenic
1044045338 8:87425305-87425327 ACTGACGAGCTGACAGAAGAAGG - Intronic
1044053807 8:87542861-87542883 ACTGACAAGGAGGGAGACCAAGG - Intronic
1045149629 8:99389653-99389675 ACTGAGGAGGAGGAAGAGGAGGG + Intronic
1045194840 8:99920077-99920099 TCTGACAAAGAGGAAGAGGAAGG + Intergenic
1045251748 8:100488493-100488515 AGTGACAGGGAGGCTGAGGAAGG + Intergenic
1046389937 8:113557444-113557466 GCTGGCAAGGAGAGAAAGGAGGG + Intergenic
1046595988 8:116261729-116261751 ACTGCAAAGGAGACTGAGGAAGG + Intergenic
1048014564 8:130485893-130485915 AGTGGAAAGGAGACAGAGGTGGG + Intergenic
1048526646 8:135208869-135208891 ACAGACAAGAAGACAGAGTCAGG + Intergenic
1048729443 8:137421105-137421127 ACTGGAAAGGAGAGAGATGAGGG + Intergenic
1048987776 8:139744435-139744457 TCAGACAGGGAGACAGAGGCTGG + Intronic
1049729742 8:144170165-144170187 AATGAGGAGGAGAGAGAGGAGGG + Intronic
1050039127 9:1470125-1470147 ACTCACCAGGAGACACAGGCAGG - Intergenic
1050525011 9:6538715-6538737 ATTTGCAAGGAGAGAGAGGAGGG - Intronic
1050787812 9:9427061-9427083 ACTGACAAGTTGAGAGAAGAAGG + Intronic
1052233004 9:26177606-26177628 ACAGACAGAGAGACAGAGGAAGG - Intergenic
1052359551 9:27539552-27539574 ACTGTCATGAAGCCAGAGGAAGG - Intergenic
1052484149 9:29074430-29074452 TCAGAAAAGGAGCCAGAGGAAGG - Intergenic
1053280292 9:36816227-36816249 ACTGTCAAGGAGTCCAAGGATGG - Intergenic
1053299517 9:36939084-36939106 GCTGAGAAGGGGACACAGGAAGG - Intronic
1054826656 9:69580278-69580300 TCTGCCAAGGGCACAGAGGATGG + Intronic
1055066068 9:72120067-72120089 ACTGGCAAGGAGAGAGAAGCAGG - Intronic
1055205478 9:73724182-73724204 GCTGAGAAGGAGGAAGAGGAGGG - Intergenic
1055300994 9:74882616-74882638 ACTGGCAAGGATGCAGAGAAAGG + Intronic
1055379608 9:75691545-75691567 GCTGACCAGGAGACAGATGGAGG - Intergenic
1055668193 9:78573205-78573227 ACAAATAAGGAGACAAAGGAAGG - Intergenic
1055713107 9:79086978-79087000 ACAGAAAAAGAGAGAGAGGAAGG + Intergenic
1055855588 9:80683291-80683313 ACAGACAAGGAAAAAGATGAAGG - Intergenic
1056041345 9:82670476-82670498 AGAGAGAAAGAGACAGAGGAAGG + Intergenic
1056047701 9:82736258-82736280 AATGAGATAGAGACAGAGGAGGG - Intergenic
1056692795 9:88822486-88822508 TCTGAAAGGGAGAAAGAGGAGGG - Intergenic
1057593096 9:96390968-96390990 GCTAACCAGGAGAAAGAGGAGGG + Intronic
1058426783 9:104882382-104882404 CCTGGCAAGGGGACAGAGGCTGG - Intronic
1059118750 9:111622446-111622468 AATGGCAGGGAGTCAGAGGATGG - Intergenic
1059426788 9:114226262-114226284 ACAGACAAGGAAACAAAGGCAGG - Intronic
1059487573 9:114638522-114638544 ACTGCAAAGGAAACAGAGAAGGG - Exonic
1060424524 9:123493400-123493422 ACTGAGAGGGTGAAAGAGGATGG + Intronic
1062025730 9:134339298-134339320 GCTCACACGCAGACAGAGGAGGG - Intronic
1185807709 X:3075706-3075728 AGAGACAAGCAGACAGAGAAAGG - Intronic
1186568599 X:10690985-10691007 AATCACAAGGAGACAGTGGTAGG - Intronic
1187416699 X:19099507-19099529 ACAGACAAGGAAACTGAGGCAGG + Intronic
1188004268 X:25006436-25006458 ACAGACAAAGAAACAAAGGAGGG - Intronic
1188381639 X:29500933-29500955 ACTGGCAAGGATGTAGAGGAAGG - Intronic
1189120617 X:38390508-38390530 GCTGACTGGGAGATAGAGGAAGG - Intronic
1189191832 X:39115951-39115973 ACAGAAAATGAGAGAGAGGATGG - Intergenic
1189252099 X:39608989-39609011 ACAGACTAGGAAACAGAGAAGGG + Intergenic
1192294743 X:69835705-69835727 ACTGACAAGTTGACAGAAGTAGG - Intronic
1192356635 X:70410281-70410303 ACTGAAAAGGAGACTGAAGCAGG + Intronic
1192587619 X:72331898-72331920 ACTGTAAAGGAGGTAGAGGAGGG - Intronic
1192843075 X:74877975-74877997 ACTGACAAGCTGAGAGAAGAAGG - Intronic
1193627418 X:83838042-83838064 ACAGACAAGGAAATGGAGGAAGG - Intergenic
1195207622 X:102618729-102618751 ACTGACAAGAATAAAAAGGAAGG - Intergenic
1195873635 X:109514580-109514602 ACTGAGGAGGAGGAAGAGGAAGG + Intergenic
1196604410 X:117640367-117640389 AATGACAAGGAGACAGATAGGGG - Intergenic
1198722173 X:139634847-139634869 ACAGGCTAGGAGACCGAGGATGG + Intronic
1199578242 X:149335019-149335041 ACTGACAAGCTGAGAGAAGAAGG + Intergenic
1199934958 X:152563778-152563800 ACAGGCAAGGATACAGAGAAAGG + Intergenic
1200776064 Y:7171359-7171381 ACTAAAAAGAGGACAGAGGAAGG - Intergenic
1201695753 Y:16823895-16823917 TCAGCCAGGGAGACAGAGGAAGG - Intergenic
1202115245 Y:21465551-21465573 ACTAAGAAGGAGAAAGAGGATGG + Intergenic
1202590539 Y:26478767-26478789 ATTGTAAAGGAGACAGAGTATGG - Intergenic