ID: 1161055655

View in Genome Browser
Species Human (GRCh38)
Location 19:2189560-2189582
Sequence CTCGCTTTCCGCCCTGATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 71}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161055655_1161055663 14 Left 1161055655 19:2189560-2189582 CCTGCATCAGGGCGGAAAGCGAG 0: 1
1: 0
2: 0
3: 4
4: 71
Right 1161055663 19:2189597-2189619 GGTCTTGGCCAGCTGGCTGGTGG 0: 1
1: 0
2: 1
3: 36
4: 226
1161055655_1161055662 11 Left 1161055655 19:2189560-2189582 CCTGCATCAGGGCGGAAAGCGAG 0: 1
1: 0
2: 0
3: 4
4: 71
Right 1161055662 19:2189594-2189616 AAGGGTCTTGGCCAGCTGGCTGG 0: 1
1: 0
2: 1
3: 13
4: 181
1161055655_1161055667 28 Left 1161055655 19:2189560-2189582 CCTGCATCAGGGCGGAAAGCGAG 0: 1
1: 0
2: 0
3: 4
4: 71
Right 1161055667 19:2189611-2189633 GGCTGGTGGCTGTCCAGGCAGGG 0: 1
1: 0
2: 2
3: 36
4: 334
1161055655_1161055658 -7 Left 1161055655 19:2189560-2189582 CCTGCATCAGGGCGGAAAGCGAG 0: 1
1: 0
2: 0
3: 4
4: 71
Right 1161055658 19:2189576-2189598 AAGCGAGGCTTCTGCCAGAAGGG 0: 1
1: 0
2: 1
3: 3
4: 106
1161055655_1161055659 -1 Left 1161055655 19:2189560-2189582 CCTGCATCAGGGCGGAAAGCGAG 0: 1
1: 0
2: 0
3: 4
4: 71
Right 1161055659 19:2189582-2189604 GGCTTCTGCCAGAAGGGTCTTGG 0: 1
1: 0
2: 0
3: 15
4: 194
1161055655_1161055665 23 Left 1161055655 19:2189560-2189582 CCTGCATCAGGGCGGAAAGCGAG 0: 1
1: 0
2: 0
3: 4
4: 71
Right 1161055665 19:2189606-2189628 CAGCTGGCTGGTGGCTGTCCAGG 0: 1
1: 0
2: 2
3: 36
4: 367
1161055655_1161055657 -8 Left 1161055655 19:2189560-2189582 CCTGCATCAGGGCGGAAAGCGAG 0: 1
1: 0
2: 0
3: 4
4: 71
Right 1161055657 19:2189575-2189597 AAAGCGAGGCTTCTGCCAGAAGG 0: 1
1: 0
2: 1
3: 7
4: 123
1161055655_1161055661 7 Left 1161055655 19:2189560-2189582 CCTGCATCAGGGCGGAAAGCGAG 0: 1
1: 0
2: 0
3: 4
4: 71
Right 1161055661 19:2189590-2189612 CCAGAAGGGTCTTGGCCAGCTGG 0: 1
1: 0
2: 0
3: 25
4: 142
1161055655_1161055666 27 Left 1161055655 19:2189560-2189582 CCTGCATCAGGGCGGAAAGCGAG 0: 1
1: 0
2: 0
3: 4
4: 71
Right 1161055666 19:2189610-2189632 TGGCTGGTGGCTGTCCAGGCAGG 0: 1
1: 0
2: 3
3: 33
4: 351

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161055655 Original CRISPR CTCGCTTTCCGCCCTGATGC AGG (reversed) Intronic
900514627 1:3075696-3075718 CGCGTTTTCCGCGCTGATGGCGG + Intronic
900947062 1:5837009-5837031 CTGGCTTTCTGCCCTGGAGCTGG - Intergenic
901766561 1:11503561-11503583 CTCTCTTTCCCCCCTGGAGCTGG - Intronic
902988527 1:20170602-20170624 CTCGCTCTCAGCCCTGCTCCTGG + Intronic
904762954 1:32818215-32818237 CCCGCTTTCCGCCGGGAGGCGGG + Intronic
907319033 1:53591266-53591288 CTCCCTCTCCTCCATGATGCTGG - Intronic
921388376 1:214594447-214594469 CTCTCTTTCATCCCTGACGCTGG - Intergenic
1067369746 10:45672492-45672514 CTCGCCTTGCGGCCTGACGCCGG - Intronic
1067455835 10:46418734-46418756 CTCCCTCTCCTCCCTGAGGCCGG + Intergenic
1067460708 10:46456246-46456268 CTCTCTGTCCACCCTGATACTGG - Intergenic
1067626483 10:47928354-47928376 CTCTCTGTCCACCCTGATACTGG + Intergenic
1067631365 10:47965905-47965927 CTCCCTCTCCTCCCTGAGGCCGG - Intergenic
1070799876 10:79239076-79239098 CTCCCTTTCCCCCCTCATCCTGG - Intronic
1072450738 10:95537684-95537706 CTCTCATTCCACCCTGATGCTGG + Intronic
1075748381 10:124743776-124743798 CTCGGTCTCGCCCCTGATGCAGG - Intronic
1081657805 11:44868773-44868795 CTCACTTTCTGCCCTGGTGTGGG - Intronic
1084528497 11:69712576-69712598 CTGGCTCTCCGCCTTGCTGCAGG - Intergenic
1085322122 11:75581715-75581737 CTCGCTTTCCACACTCCTGCTGG + Intergenic
1089695848 11:120215926-120215948 CTCCCTATCCTCCCTGATGCTGG - Intronic
1091626523 12:2125007-2125029 CTCCCACTCCACCCTGATGCAGG - Intronic
1096713298 12:53474334-53474356 GTCTCTTTCCACCCTGATACTGG + Intronic
1097812616 12:64035016-64035038 AACTCTTTCAGCCCTGATGCTGG + Intronic
1099757547 12:86873196-86873218 CTCACTTTCCACCATGTTGCTGG - Intergenic
1102709844 12:114916248-114916270 CTCGCCTTCAGCCATGATGTTGG - Intergenic
1103332189 12:120162016-120162038 CTCCCTTTCCGTCCTGTCGCCGG - Exonic
1103716942 12:122950387-122950409 CTCCCTTCCCTCCCTGGTGCAGG + Intronic
1110552152 13:76822034-76822056 CTCGCTTTCCACTCTGCTTCAGG + Intergenic
1118908038 14:70037216-70037238 CTCCCTAGCCACCCTGATGCTGG + Intergenic
1129235995 15:74224128-74224150 CTCTCTCTCCGCCATGGTGCCGG - Intergenic
1131777982 15:95823118-95823140 CTGGCTCTCCGCCCTGCTCCTGG - Intergenic
1133090702 16:3401573-3401595 GTCGGTTTCCGCCAGGATGCGGG + Exonic
1136636919 16:31529863-31529885 TTCCCTTTCCACCCTGATCCAGG - Intergenic
1141806901 16:86347814-86347836 CTCGCTTTCCCCACTGAAGGAGG + Intergenic
1144213287 17:13033091-13033113 CACGCATTCTGCCCTGATGCTGG + Intergenic
1147805118 17:43125736-43125758 CACTCTTTCCGCCCTAATGGAGG + Intergenic
1147811124 17:43170577-43170599 CACTCTTTCCGCCCTAATGGAGG + Exonic
1148453193 17:47794383-47794405 CTCGATTTCCTCCCGGATGGAGG - Intergenic
1152661591 17:81544806-81544828 AGCCCTTTCAGCCCTGATGCTGG - Intronic
1156301514 18:35840532-35840554 CTTACTTTCCAACCTGATGCTGG - Intergenic
1156486708 18:37471093-37471115 CTCCCTCTCTGCCCTGAAGCTGG - Intronic
1158830599 18:61273603-61273625 CTTCATTTCCGCCCAGATGCTGG - Intergenic
1159832413 18:73293581-73293603 CTGGCTTTCCATCCTGATGATGG + Intergenic
1161055655 19:2189560-2189582 CTCGCTTTCCGCCCTGATGCAGG - Intronic
1162478567 19:10915250-10915272 CTCCCCTTCTGCCCTGATGGTGG + Intronic
925318484 2:2942700-2942722 CTCCCTTTCAGCCCTGAGACTGG - Intergenic
927333465 2:21892897-21892919 CTCACTTTCTACCCTGAGGCAGG + Intergenic
931224537 2:60318627-60318649 CTCCCTCCCCGCCCTGCTGCAGG + Intergenic
938962403 2:136355160-136355182 CTGGGATTCAGCCCTGATGCTGG + Intergenic
948504972 2:238422508-238422530 CCCGCTTTCCGCCCCGCAGCTGG - Intergenic
1170575594 20:17659541-17659563 CTCCCTTTTTGCCCTGATTCTGG + Intronic
1174467804 20:50731164-50731186 CTGGCTCTCCGGCCTGAAGCGGG + Intergenic
1174542226 20:51298570-51298592 ATCTCTCTCCGCCCTGGTGCTGG - Intergenic
1175181360 20:57149998-57150020 CTCACTTTCCAACCTGACGCTGG - Intergenic
1184124815 22:42479644-42479666 CCCTCATTCCGCCCTGAGGCTGG + Intergenic
1184579413 22:45404273-45404295 CTTACTTTCCAACCTGATGCTGG + Intronic
961201510 3:125049355-125049377 CTCTCATTGCGCCCTCATGCCGG + Intronic
988629618 5:32914824-32914846 CTGCCTTTCCTCCCTGGTGCTGG - Intergenic
991674293 5:69076025-69076047 CTCTCTTCCAGCCCTGAGGCTGG - Intergenic
992587961 5:78260766-78260788 CTCGCTTTCCCCCTAGCTGCTGG + Intronic
1000046772 5:157528320-157528342 CTCCCTTTCAGCACTGCTGCTGG + Intronic
1000147866 5:158470924-158470946 CTCACTGTCCTACCTGATGCGGG - Intergenic
1001744588 5:174082508-174082530 CTGGCTTCCCTCCCTGTTGCAGG + Intronic
1006189775 6:32200836-32200858 CTGGCTGTCCACCCTCATGCAGG - Exonic
1006630567 6:35427288-35427310 CTCCCTTCCCTCCCTGAGGCAGG + Exonic
1015835634 6:137417251-137417273 CTGGCCTTCCACCCTGATTCAGG - Intergenic
1018204185 6:161421491-161421513 CTCTCTATCCACCCTCATGCTGG - Intronic
1019388945 7:774478-774500 CTCGGTTTCCGGCCCAATGCTGG + Intronic
1019695936 7:2446173-2446195 CTCCCTTCCAGCCCTGCTGCTGG - Intergenic
1022791775 7:33696321-33696343 CTCACTTTCCACCATGCTGCCGG + Intergenic
1024231852 7:47368914-47368936 CTCAGTGTCCGCCCAGATGCAGG - Exonic
1024799969 7:53065346-53065368 CTCTCTTTCCTCCCTGATTCTGG + Intergenic
1027244160 7:76354766-76354788 CTCGTTTTCAGCCCTAAGGCTGG - Intronic
1032274375 7:130441230-130441252 CTCTCTTCCCGCCCTAAGGCTGG - Exonic
1034410283 7:150937608-150937630 CTCACTTCCCGTCCTGCTGCAGG - Intergenic
1061120283 9:128637772-128637794 CTTGCTTTCAGCCCTGCAGCCGG + Intronic
1200935440 Y:8734387-8734409 CTCCTTTTCCGCCAAGATGCAGG + Intergenic